* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Transcription Translation 2017 p2.notebook
Biochemistry wikipedia , lookup
RNA interference wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
RNA silencing wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Molecular evolution wikipedia , lookup
Expanded genetic code wikipedia , lookup
List of types of proteins wikipedia , lookup
Non-coding DNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Polyadenylation wikipedia , lookup
Gene regulatory network wikipedia , lookup
Genetic code wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Transcription factor wikipedia , lookup
Non-coding RNA wikipedia , lookup
Biosynthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Gene expression wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcription Translation 2017 p2.notebook April 25, 2017 Do Now Explain the process between DNA and proteins. Mar 35:08 PM 1 Transcription Translation 2017 p2.notebook April 25, 2017 I. 1909 Archibald Garrod's Experiment A. Suggested a relationship between genotype and phenotype of individuals B. Researched the autosomal recessive disorder alkaptonuria (disorder where urine appears black due to a chemical called alkapton) 1. Hypothesized that normal individuals have the enzyme to break down alkapton in their urine 2. Individual that have alkaptonuria cannot make that enzyme 3. "inborn errors in metabolism" C. Later research confirmed this idea that cells make and break down biologically important molecules via a set pathway. http://www.dnalc.org/view/15398Chromosome3geneassociatedwith alkaptonuriaMattRidley.html Mar 35:16 PM 2 Transcription Translation 2017 p2.notebook April 25, 2017 George Beadle and Edward Tatum http://www.dnalc.org/resources/nobel/beadle_tatum.html Mar 35:28 PM 3 Transcription Translation 2017 p2.notebook April 25, 2017 Mar 35:09 PM 4 Transcription Translation 2017 p2.notebook April 25, 2017 II. 1941 George Beadle and Edward Tatum A. Worked with Neurospora crassa (bread mold) B. Studied strains of the bread mold and mutated several strains C. Strains could grow in a complete medium but could not grow in a minimal medium D. Then further analyzed the mutant strains. Grew them in minimal media supplemented with various substances 1. Found mutant mold could grow in minimal media supplemented with arginine (amino acid) 2. Mutation in the genetic pathway that creates an essential molecule the mold required to survive (arginine) 3. Mutation in enzyme that help to produce arginine E. Concluded that one gene codes for one enzyme (One gene one protein, one gene one polypeptide) Mar 39:03 PM 5 Transcription Translation 2017 p2.notebook April 25, 2017 DO NOW Write 3 statements that support the idea that these children are related. Apr 216:53 AM 6 Transcription Translation 2017 p2.notebook April 25, 2017 Why do those children have red hair? Where are genes located? Apr 216:57 AM 7 Transcription Translation 2017 p2.notebook April 25, 2017 Explain the overall significance of this diagram! Apr 216:58 AM 8 Transcription Translation 2017 p2.notebook April 25, 2017 III. Central Dogma A. DNA (gene) mRNA (transcription) B. mRNA Protein (translation) Mar 39:18 PM 9 Transcription Translation 2017 p2.notebook April 25, 2017 IV. Transcription (first step in creation of proteins) A. Goal: Take a gene from DNA and make a mRNA copy B. Location: Nucleus (eukaryotic cell) C. Steps to Transcription: 1. Initiation: RNA Polymerase binds to the promoter (start sequence) of a gene on a DNA strand 2. Elongation: RNA Polymerase build a new RNA strand off the template strand of DNA. a. Hydrogen bonds allow the complementary base pairs to be held in place. b. RNA peels away from DNA template. 3. Termination: RNA Polymerase reaches termination (end of a gene) sequence of DNA. RNA Polymerase detaches from RNA and DNA strands. http://wwwclass.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html Mar 39:24 PM 10 Transcription Translation 2017 p2.notebook April 25, 2017 Mar 68:08 AM 11 Transcription Translation 2017 p2.notebook April 25, 2017 Do Now Use this diagram to describe the evolution of lactase persistence. Apr 247:10 AM 12 Transcription Translation 2017 p2.notebook April 25, 2017 Let's Try These... • 1. Where in the cell does transcription occur? • 2. What nucleic acids are involved in the process of transcription? • 3. What is the importance of transcription? • 4. In transcription, how come the whole DNA molecule is not copied into mRNA? • 5. How does one gene differ structurally from another? • 6. Because one gene differs from another, what molecules in the cell will also be different? Mar 67:19 AM 13 Transcription Translation 2017 p2.notebook April 25, 2017 V. RNA Processing (eukaryotes only) A. Location: Nucleus after transcription B. Parts of RNA Processing: 1. 5' Cap is added (methylated guanine molecule) 2. Polyadenylation (50 250 adenine molecules added to 3' end) ~ Poly A Tail 3. Purpose for Cap and Tail a. facilitate the export of mRNA from nucleus b. protect mRNA from attack from cellular enzymes c. help ribosome bind to mRNA 4. RNA Splicing: process where introns are removed and exons are adhered together a. intron: non coded regions b. exons: coding regions (will be translated) c. process is catalyzed by small RNA molecules and proteins (sometimes by RNA itself!) d. Purpose of introns and exons: eukaryotes have DNA sequences that code for proteins that are not continuous and allow for evolution of new proteins (different proteins produced from same gene alternative splicing) http://highered.mcgrawhill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/ 0072437316/120077/bio30.swf::How%20Spliceosomes%20Process%20RNA Mar 39:25 PM 14 Transcription Translation 2017 p2.notebook April 25, 2017 HMWK: bring book to class on MONDAY Mar 138:16 AM 15 Transcription Translation 2017 p2.notebook April 25, 2017 Feb 251:00 PM 16 Transcription Translation 2017 p2.notebook April 25, 2017 > DO NOW: • Trascribe the DNA Strand (nontemplate strand) • 5’ ATCGGTAGAGTATTTACAGATA 3’ • Process it: • Introns: UUACAG • CGGUA Feb 2610:42 AM 17 Transcription Translation 2017 p2.notebook April 25, 2017 Translation Translation the process of creating a polypetide from mRNA Location: Three parts to translation: initiation, elongation, termination Ribosome Structure: made of two subunits (large and small) composed of rRNA and several small proteins eukaryote and prokaryote ribosomes differ in size but not in function 3 grooves on ribosome (A, P, E) A site: tRNA binds P site: polypeptide formation E site: exit site Mar 71:34 PM 18 Transcription Translation 2017 p2.notebook April 25, 2017 A. Steps to initiation: 1. mRNA leaves the nucleus through nuclear pores 2. the 5’ end of mRNA binds to small subunit on ribosome 3. initiator tRNA binds to the start codon in the P site of ribosome and large subunit binds to the small subunit Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons) Anticodon: Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon) Mar 128:09 AM 19 Transcription Translation 2017 p2.notebook April 25, 2017 Mar 138:16 AM 20 Transcription Translation 2017 p2.notebook April 25, 2017 Mar 128:46 AM 21 Transcription Translation 2017 p2.notebook April 25, 2017 tRNA Structure: composed of a single polynucleotide chain (80 nucleotides) folded over upon itself creating double stranded sections matches up amino acids with proper codon contains the anticodon that pairs with the codon B. Elongation 1. Codon recognition: the anticodon of incoming tRNA pairs with the codon on A site 2. Peptide bond formation: polypeptide separates from tRNA and forms a peptide bond with the AA in A site 3. Translocation: ribosome moves one triplet over and uncharged tRNA now goes to the E site and exits the tRNA C. Termination 1. Process continues until a stop codon is reached (UGA, UAG, UAA) 2. Release factors bind to ribosome and cause ribosome subunits, mRNA, and polypeptide chain to be released http://wwwclass.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html Mar 128:18 AM 22 Transcription Translation 2017 p2.notebook April 25, 2017 Mutations • A permanent change that occurs in a cell’s DNA is called a mutation. • Three types of mutations: > Point mutation > Insertion > Deletion • Point Mutation (substitution): A change in just one base pair > Missense Mutation: amino acid is change > Nonsense Mutation: amino acid is changed to a stop codon • Frameshift Mutation:Causes the reading frame to shift to the left or the right • Insertion: Addition of a nucleotide • Deletion: Removal of a nucleotide Mar 1212:10 PM 23 Transcription Translation 2017 p2.notebook April 25, 2017 Do Now Original Sequence: ACGAAATACAGACAT • Decide what type of mutation occurred: 1. ACGAAATAGAGACAT 2. ACAAATACAGACAT 3. ACGAAATACAGGACAT Mar 1910:09 AM 24 Transcription Translation 2017 p2.notebook April 25, 2017 Mar 1212:13 PM 25 Transcription Translation 2017 p2.notebook April 25, 2017 Causes of Mutations • Mutations can happen spontaneously • Mutagens: Certain chemicals or radiation that can cause DNA damage • Causes bases to mispair and bond with the wrong base • Highenergy forms of radiation, such as X rays and gamma rays, are highly mutagenic. Mar 1212:14 PM 26