* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Structural determinants for rCNT2 sorting to the plasma membrane
Survey
Document related concepts
Hedgehog signaling pathway wikipedia , lookup
Cell culture wikipedia , lookup
Cellular differentiation wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
Cell encapsulation wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Cytokinesis wikipedia , lookup
Magnesium transporter wikipedia , lookup
Signal transduction wikipedia , lookup
Cell membrane wikipedia , lookup
Transcript
Biochem. J. (2012) 442, 517–525 (Printed in Great Britain) 517 doi:10.1042/BJ20110605 Structural determinants for rCNT2 sorting to the plasma membrane of polarized and non-polarized cells Itziar PINILLA-MACUA, F. Javier CASADO and Marçal PASTOR-ANGLADA1 Department of Biochemistry and Molecular Biology, Institute of Biomedicine (IBUB), University of Barcelona, Barcelona, Spain, and Biomedical Centre for Investigation into Hepatic and Digestive Diseases (CIBER-EHD), University of Barcelona, Barcelona, Spain rCNT2 (rat concentrative nucleoside transporter 2) (Slc28a2) is a purine-preferring concentrative nucleoside transporter. It is expressed in both non-polarized and polarized cells, where it is localized in the brush border membrane. Since no information about the domains implicated in the plasma membrane sorting of rCNT2 is available, the present study aimed to identify structural and functional requirements for rCNT2 trafficking. The comprehensive topological mapping of the intracellular N-terminal tail revealed two main features: (i) a glutamateenriched region (NPGLELME) between residues 21 and 28 that seems to be implicated in the stabilization of rCNT2 in the cell surface, since mutagenesis of these conserved glutamates resulted in enhanced endocytosis; and (ii) mutation of a potential protein kinase CK2 domain that led to a loss of brush border-specific sorting. Although the shortest proteins assayed (rCNT2-74AA, -48AA and -37AA) accumulated intracellularly and lost their brush border membrane preference, they were still functional. A deeper analysis of CK2 implication in CNT2 trafficking, using a CK2-specific inhibitor [DMAT (2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole)] and other complementary mutations mimicking the negative charge provided by phosphorylation (S46D and S46E), demonstrated an effect of this kinase on rCNT2 activity. In summary, the Nterminal tail of rCNT2 contains dual sorting signals. An acidic region is responsible for its proper stabilization at the plasma membrane, whereas the putative CK2 domain (Ser46 ) is implicated in the apical sorting of the transporter. INTRODUCTION adenosine 1 receptors (A1 R) are found [9,10], thus contributing to the modulation of the accessibility of extracellular adenosine to its receptors. Previous studies from our group showed that both the expression and the subcellular localization of rCNT2 (rat CNT2) are highly regulated. In this regard, it has been described that bile acids can increase plasma membrane rCNT2 activity by promoting the transporter translocation from intracellular compartments to the plasma membrane [11]. CNT2 has also been described as a key player in energy metabolism, necessary for the activation of AMPK (AMP-activated protein kinase) by extracellular adenosine [12]. Interestingly, the only proteins known so far to interact directly with rCNT2 are the glycolitic enzyme aldolase B and the glucose-dependent chaperone grp58 (glucose-regulated protein 58), both intimately implicated in energy metabolism [13]. In addition, rCNT2 expression and activity are under endocrine and paracrine control, since differentiating factors such as glucocorticoids, and proliferative agents such as EGF (epidermal growth factor) and TGFβ (transforming growth factor β) increase its expression and activity at the plasma membrane [14,15]. Although rCNT2 has been shown to be regulated by a wide range of stimuli and most of them result in changes in the subcellular localization of the transporter, the precise molecular mechanisms that regulate the plasma membrane localization of this transporter remain poorly understood. The finding that a putative spliced variant CNT (concentrative nucleoside transporter) 2 is a sodium– purine nucleoside co-transporter putatively structured in 13 transmembrane domains with cytosolic N-terminal and extracellular C-terminal tails. CNT2 is expressed in most epithelial and immune system cells [1–3]. In rat liver parenchymal cells, it is mostly located at the sinusoidal pole and in intracellular compartments, but in humans, it is found at both the canalicular and the sinusoidal membrane compartments [4,5]. In absorptive epithelia, CNT2 is mostly located at the apical domain [6]. The asymmetrical distribution of concentrative (CNTtype) and equilibrative (ENT-type) nucleoside transporter proteins in intestinal and renal epithelia, with equilibrative transporters mainly expressed at the basolateral domain and concentrative ones at the apical domain, allows the establishment of a transepithelial flux of natural nucleosides and nucleoside-derived drugs, as described previously [7,8]. Although these results point towards a putative role for CNT2 in the (re)absorption processes of purine nucleosides as well as purine derivatives such as ribavirin, there could be additional roles for CNT2, as suggested by the expression pattern of this transporter along the rat nephron. The highest CNT2 mRNA levels are found in the glomerulus, although it is also expressed in some renal tubular segments (mostly the proximal convoluted tubule) [9], where it can play a major role in purine nucleoside reabsorption. CNT2 is found in regions where Key words: concentrative nucleoside transporter 2 (CNT2), epithelium, phosphorylation, plasma membrane, protein kinase CK2, sorting. Abbreviations used: ABCA1, ATP-binding cassette transporter A1; AMPK, AMP-activated protein kinase; Asbt, apical sodium-dependent bile transporter; BCA, bicinchoninic acid; CHO, Chinese-hamster ovary; CNT, concentrative nucleoside transporter; DMAT, 2-dimethylamino-4,5,6,7-tetrabromo-1H benzimidazole; ENT, equilibrative nucleoside transporter; ER, endoplasmic reticulum; FBS, fetal bovine serum; grp58, glucose-regulated protein 58; hCNT3, human CNT3; MDCK, Madin–Darby canine kidney; NHE3, Na + / H + exchanger 3; rCNT2, rat CNT2; TRITC, tetramethylrhodamine β-isothiocyanate; WGA, wheat germ agglutinin; YFP, yellow fluorescent protein. 1 To whom correspondence should be addressed (email [email protected]). c The Authors Journal compilation c 2012 Biochemical Society 518 I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada of hCNT3 (human CNT3) lacking the first 69 amino acids of the N-terminal tail shows ER (endoplasmic reticulum) retention [16] anticipates a role for the intracellular N-terminal domain in the regulation of the plasma membrane localization of CNT proteins. rCNT2 possesses a large intracellular N-terminal tail (80 amino acids) which contains some highly conserved domains among CNT2 orthologues. Among those motifs, there is a diacidic motif and a NPG (Asn-Pro-Gly) sequence which strongly resemble the sorting sequence described for Asbt (apical sodiumdependent bile transporter) [17]. Prediction of consensus motifs using PROSITE identified two putative protein kinase CK2 phosphorylation domains, T37 LEE and S46 LKD, within the Nterminal tail, with the latter being highly conserved among orthologues. The protein kinase CK2 heterotetramer is a constitutively active serine/threonine kinase whose holoenzymes consist of two catalytic subunits (α and α ) and a dimer of regulatory β subunits. CK2 is essential for cell viability and appears to be implicated in global processes such as tRNA and rRNA synthesis, apoptosis, cell survival, transformation, and the regulation of cytoskeleton elements that shape cell morphology [18–20]. CK2 has been proved to regulate the sorting to the plasma membrane of some transporters such as ABCA1 (ATP-binding cassette transporter A1), a phospholipid and cholesterol transporter; ENT1, an equilibrative nucleoside transporter and NHE3 (Na + / H + exchanger 3) [21–23]. The aim of the present study was to map structural motifs present at the N-terminal tail of the rCNT2 protein implicated in constitutive sorting of this transporter in both polarized and non-polarized cells. MATERIALS AND METHODS Chemicals and reagents Guanosine, DMAT (2-dimethylamino-4,5,6,7-tetrabromo-1Hbenzimidazole) and Dynasore were purchased from Sigma– Aldrich. [3 H]Guanosine was from Hartmann Analytic. WGA (wheat germ agglutinin)–TRITC (tetramethylrhodamine βisothiocyanate) membrane marker was obtained from Molecular Probes and Aqua-Poly/Mount coverslipping medium from Polysciences. Cell culture and transfection The CHO (Chinese-hamster ovary)-K1 cell line was routinely cultured in EMEM (Eagle’s minimal essential medium) supplemented with 5 % (v/v) FBS (fetal bovine serum), 1 % antibiotic mixture (100 units/ml penicillin G, 0.1 mg/ml streptomycin and 0.25 μg/ml fungizone), 2 mM glutamine, 0.1 mM non-essential amino acids and 1 mM sodium pyruvate. All reagents were purchased from Invitrogen. The MDCK (Madin–Darby canine kidney) II cell line was cultured in DMEM (Dulbecco’s modified Eagle’s medium) (Invitrogen) supplemented with 10 % FBS, 1 % antibiotic mixture and 2 mM glutamine. Both cell lines were maintained at 37 ◦ C/5 % CO2 and neither express endogenous CNT2 activity CHO-K1 cells were transiently transfected with plasmids described below using LipofectamineTM 2000 (Invitrogen) following the manufacturer’s protocol. Nucleoside transport, confocal microscopy and flow cytometry were carried out 48 h after transfection. MDCK II cells were seeded on transwell plates (12 mm diameter, 0.3 μm pore; Corning Costar) and transfected using LipofectamineTM 2000 as described previously [24]. c The Authors Journal compilation c 2012 Biochemical Society Table 1 Oligonucleotides for PCR Restriction sites are underlined. Primer Restriction site Sequence (5 →3 ) rC2EcoRI Fw rC2delEcoRI Fw rC2SmaI Rv rCNT2-20AA Fw rCNT2-37AA Fw rCNT2-48AA Fw EcoRI EcoRI SmaI EcoRI EcoRI EcoRI GGGGGAATTCGATGGCGAAGTCAGA GGGGGAATTCTGCTGGTTTATTCA TTTTCCCGGGTCAGGCACACACAGT CCCCGAATTCAAACCCAGGCCTGGAGCTCATGG GGGGGAATTCCCTGGAGGAAGTG GGGTGAATTCGGATGGCTTGGGGC Table 2 Oligonucleotides for site-directed mutagenesis Primer Sequence (5 →3 ) rC2-S46G Fw rC2-S46G Rv rC2-S46D Fw rC2-S46D Rv rC2-S46E Fw rC2-S46E Rv rC2-E16G Fw rC2-E16G Rv rC2 E25G Fw rC2 E25G Rv rC2 E28G Fw rC2 E28G Rv rC2-E25G/E28G Fw rC2-E25G/E28G Rv rC2-2EQ-YFP Fw rC2-2EQ-YFP Rv rC2-NPG Fw rC2-NPG Rv GGAAGTGACACAGGGACATGGCCTGAAGAATGGCTTGGG CCCAAGCCATCCTTCAGGCCATGTCCCTGTGTCACTTCC AGTGACACAGGGACATGACCTGAAGGATGGCTTGGGG CCCCAAGCCATCCTTCAGGTCATGTCCCTGTGTCACT AGTGACACAGGGACATGAGCTGAAGGATGGCTTGGGG CCCCAAGCCATCCTTCAGCTCATGTCCCTGTGTCACT CTGCTTCCCAGGACACATCGGGGAATGGCATGGAGAACCCAG CTGGGTTCTCCATGCCATTCCCCGATGTGTCCTGGGAAGCAG GCATGGAGAACCCAGGCCTGGGGCTCATGGAAGTCGGAAACCTTGAGCAA TTGCTCAAGGTTTCCGACTTCCATGAGCCCCAGGCCTGGGTTCTCCATGC GCATGGAGAACCCAGGCCTGGAGCTCATGGGAGTCGGAAACCTTGAGCAA TTGCTCAAGGTTTCCGACTCCCATGAGCTCCAGGCCTGGGTTCTCCATGC GCATGGAGAACCCAGGCCTGGGGCTCATGGGAGTCGGAAACCTTGAGCAA TTGCTCAAGGTTTCCGACTCCCATGAGCCCCAGGCCTGGGTTCTCCATGC GGAGAACCCAGGCCTGCAGCTCATGCAAGTCGGAAACCTTGACCAA TTGCTCAAGGTTTCCGACGTTCATGAGCTGCAGGCCTGGGTTCTCCA GGACACATCGGAGAATGGCATGGAGCTGGAGCTCATGGAAGTCGGAAACC GGTTTCCGACTTCCATGAGCTCCAGCTCCATGCCATTCTCCGATGTGTCC Generation of rCNT2–YFP (yellow fluorescent protein) constructs rCNT2 cDNA (kindly donated by Dr Ruben Boado, Division of Endocrinology, Diabetes and Hypertension, University of California Los Angeles, Los Angeles, CA, U.S.A.) [25] was subcloned into the pEYFP-C1 vector (Clontech) using EcoRI and SmaI restriction sites (Roche) at the 5 and 3 ends respectively. rCNT2 N-terminal deletions were generated by PCR adding the restriction sites described above and subcloning the PCR product into pEYFP-C1. The QuikChange® site-directed mutagenesis kit (Stratagene) was used to generate CNT2 mutants according to the manufacturer’s protocol. The YFP-fused CNT2 was used as template. Specific primer sequences and combinations are shown in Tables 1 and 2. All constructions were verified by DNA sequencing using the Big Dye Terminator sequencing kit version 3.1 (Applied Biosystems) and used for transient transfection. Nucleoside transport assay Nucleoside transport activity was monitored in cultured CHOK1 cells in either Na + -containing or Na + -free medium as described previously [15]. The uptake of [3 H]guanosine (1 μM, 1 μCi/ml) was measured in the presence of either 137 mM NaCl or 137 mM choline chloride. The uptake medium also contained 5.4 mM KCl, 1,8 mM CaCl2 , 1.2 mM MgSO4 and 10 mM Hepes rCNT2 N-terminal tail is involved in its sorting to plasma membrane (pH 7.4). Incubation was stopped after 1 min (thus maintaining initial velocity conditions) by washing the monolayers twice in 2 ml of cold stop buffer (137 mM NaCl and 10 mM Tris/Hepes, pH 7.4). Cells were then lysed with 100 μl of 100 mM NaOH and 0.5 % Triton X-100. Aliquots of 10 μl were taken for protein determination [BCA (bicinchoninic acid) Protein Assay Reagent (Pierce)] and radioactivity measurements. Saturation kinetics were monitored in cultured CHO-K1 cells either in Na + -containing or Na + -free medium as described above for initial velocity conditions in a range of substrate concentrations between 0.5 and 100 μM. Data were evaluated by non-linear regression analysis using the GraphPad Prism version 5.03 software to obtain kinetic parameters. Transwell transport assays MDCK II cells were grown on transwell filters, transiently transfected and monitored for uptake rates as described previously [24]. Filters were washed twice with Na + -containing or Na + free buffers. For apical uptake, 0.5 ml of the buffer containing [3 H]guanosine (1 μM, 1 μCi/ml) was added to the upper compartment, whereas 0.5 ml of non-radioactive buffer was added to the lower compartment; for basolateral uptake, 0.5 ml of radiolabelled buffer was added to the lower compartment and 0.5 ml of non-radioactive buffer was added to the upper compartment. The incubation was stopped after 2 min by washing the filters twice with cold stop buffer. The cells on the filters were solubilized with 200 μl of lysis buffer containing 0.1 % SDS and 100 mM NaOH, and aliquots of 90 μl were taken for protein determination (BCA Protein Assay Reagent) and radioactivity measurements. Confocal microscopy imaging To determine the localization of each construct, confocal microscopy of YFP-fused proteins was performed on subconfluent monolayer of transfected CHO-K1 cells cultured on glass coverslips. Glass coverslip-grown cells were rinsed three times with PBS supplemented with 0.1 mM CaCl2 and 1 mM MgCl2 , fixed with 3.7 % (w/v) paraformaldehyde and 0.06 M sucrose in PBS, rinsed three times with PBS supplemented with 20 mM glycine. To analyse plasma membrane localization, WGA–TRITC was used at 1 μg/ml for 10 min at room temperature (25 ◦ C) after fixation, then rinsed three times in PBS and mounted with Aqua-Poly/Mount coverslipping medium. To analyse polarized membrane location, MDCK II cells were grown on transwell filters, transfected and, 48 h later, fixed as described above. Actin was stained using 0.5 μg/ml phalloidin–TRITC (Sigma–Aldrich) and then mounted with Aqua-Poly/Mount coverslipping medium. Sections were viewed using a Leica TCS SP5 laserscanning confocal microscope equipped with a DMI6000 inverted microscope, argon laser, diode-pumped solid-state (561 nm), and a 63× oil-immersion objective lens [NA (numerical aperture) 1.4] was used. Image processing and apical/basolateral fluorescence intensity measurements were performed with ImageJ software (NIH; http://rsb.info.nih.gov/ij/). Flow cytometry assays Cultured CHO-K1 and MDCK II cells transiently transfected with CNT2–YFP constructs were trypsinized 48 h after transfection and measured by flow cytometry using a Cytomics FC 500 MPL Flow Cytometry System (Beckman Coulter). Transfection 519 efficiency and fluorescence intensity of all the constructs were determined to evaluate proper expression and internalization of YFP-tagged constructs in relation to rCNT2 control construct. Data analysis Data are expressed as the means + − S.E.M. of uptake values obtained from triplicates from at least three independent experiments carried out on different days on different batches of cells. Statistical analysis was performed using GraphPad Prism version 5.03. Statistical differences were assessed using the unpaired Student’s t test, P values <0.05 were considered statistically significant. For kinetic analysis, non-linear regression was performed assuming that data could be fitted to a one-site binding hyperbola without constraints. RESULTS Glu25 and Glu28 are essential for proper plasma membrane location On the basis of previous observations on hCNT3 N-terminal tail which associated this intracellular domain with sorting regulation [16,26], the rCNT2 intracellular N-terminal tail was considered to be a candidate to regulate the sorting of the transporter to the plasma membrane. To elucidate the possible sequences contained in this domain of rCNT2 responsible for this process, sequential deletions of the N-terminal tail were performed (Figure 1A). The expression ratios of the deleted constructs, measured as the relationship between the mean fluorescence intensity of these variants compared with control (wild-type rCNT2) (see Supplementary Table S1 at http://www.BiochemJ.org/ bj/442/bj4420517add.htm) showed similar expression levels for all these proteins, so uptake changes are due to differential activity and/or localization. Guanosine-uptake assays showed significantly impaired activity when the N-terminal region was deleted beyond Thr37 (Figure 1B), which was consistent with intracellular retention of the truncated transporters (Figure 1C). Comparing the amino acid sequences of CNT2 orthologues, a highly conserved region is defined between Asn21 and Thr37 , where activity and location differences can be found. To study the involvement of this conserved region in rCNT2 plasma membrane insertion, site-directed mutagenesis was performed (Figure 2A). This region consists of an N21 PG23 sequence, similar to the sorting signal described for Asbt [17], and a putative diacidic motif (Glu25 and Glu28 ). The deletion of the N21 PG23 region had no effect either on the activity of the truncated transporter or on its arrival to the plasma membrane (Figures 2B and 2D), whereas mutation of Glu25 and Glu28 plus Glu16 (Figure 2B) revealed a significant loss of activity associated with the substitution by glycine for Glu25 and Glu28 , but not for Glu16 (Figure 2D). The combination of mutations of Glu25 and Glu28 caused a similar reduction in activity to that of Glu25 and Glu28 alone, and is associated with intracellular retention (Figures 2B and 2D). Analysing the expression ratio of the mutants, only E28G and the double mutant E25G/E28G showed significant differences (see Supplementary Table S1). When their activity was corrected to the expression ratio, the double mutant appeared to be as active as the wild-type rCNT2, but its localization turned out to be different, suggesting increased internalization of the double mutant (Figure 2C). On the other hand, the E28G rCNT2 mutant showed even lower uptake rates than wild-type when corrected to their corresponding expression ratios. This might be explained by either increased expression or reduced degradation of the mutant. The substitution of glutamine for Glu25 and Glu28 showed no significant differences compared c The Authors Journal compilation c 2012 Biochemical Society 520 Figure 1 I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada Role of rCNT2 intracellular N-terminal tail on the plasma membrane localization of rCNT2 in CHO-K1 cells (A) Schematic representation of YFP-tagged rCNT2 N-terminally truncated constructs. (B) Na + -dependent uptake of [3 H]guanosine (1 μM, 1 min) by YFP-tagged rCNT2 constructs was measured in transport medium containing 137mM NaCl or 137 mM choline chloride. Na + -dependent transport was calculated as uptake in Na + -containing medium minus uptake in choline-containing medium. Results were normalized to control (ctrl) uptake values (80–90 pmol of guanosine/mg of protein per min) and are means + − S.E.M. for at least three independent experiments. Statistical significance was assessed using Student’s t test: ***P < 0.01. (C) Subcellular localization of YFP-fused rCNT2 constructs matching activity differences between constructs. Figure 2 Identification of the importance of Glu25 and Glu28 in rCNT2 surface localization and activity in CHO-K1 cells (A) Schematic representation of YFP-tagged rCNT2 mutants in the first 30 amino acids. (B) Na + -dependent uptake of [3 H]guanosine (1 μM, 1 min) by YFP-tagged rCNT2 constructs was measured in transport medium containing 137 mM NaCl or 137 mM choline chloride. Na + -dependent transport was calculated as uptake in Na + -containing medium minus uptake in choline-containing medium. Results were normalized to control uptake values (80–90 pmol of guanosine/mg of protein per min) and are means + − S.E.M. for at least three independent experiments. Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05. (C) Activity corrections of rCNT2 mutants which showed impaired expression rates on transiently transfected CHO-K1 cells. (D) Subcellular localization of YFP-fused rCNT2 constructions matching activity differences between constructions. YFP-fused rCNT2 constructs (green), plasma membrane WGA–TRITC (red) and merge (yellow). c The Authors Journal compilation c 2012 Biochemical Society rCNT2 N-terminal tail is involved in its sorting to plasma membrane Figure 3 521 Kinetic analysis of YFP-tagged rCNT2 constructs by Michaelis–Menten representation in CHO-K1 cells (A) Na + -dependent [3 H]guanosine (Guo) uptake (1 min) at increasing concentrations (0.5–100 μM) by YFP-tagged rCNT2 truncated constructs and E25G/E28G mutant in transiently transfected CHO-K1 cells. (B) Kinetic parameters measured using GraphPad Prism software, according to the Michaelis–Menten curve. Results are means + − S.E.M. for at least three independent experiments. with wild-type rCNT2, suggesting a need for residues with long lateral chains in positions 25 and 28, rather than the occurrence of negative charges (Figures 2B and 2D). To identify the nature of the loss of function of the truncated rCNT2 proteins as well as that of the mutant rCNT2-E25G/E28G, uptake kinetic analyses were performed. Three different patterns of activity changes were identified. Constructions retaining Glu25 and Glu28 showed transport rates similar to those of the wild-type transporter, whereas deletion of 38, 47 or 74 amino acids caused a 50 % loss of function, consistent with low V max and unaltered apparent K m values (Figure 3). The E25G/E28G double mutant showed lower activity rates than the wild-type transporter and the apparent K m value was markedly decreased (10-fold) (Figure 3B). Glu25 and Glu28 are important for rCNT2 stability at the plasma membrane As rCNT2-E25G/E28G showed a lower expression ratio and V max value, but was still functional, showing an uptake rate similar to control rCNT2, we hypothesized that the rCNT2 double mutant may be endocytosed faster than the wild-type. To analyse this possibility further, we used the dynamin inhibitor dynasore. Dynasore inhibits the GTPase activity of various dynamins, thus blocking both clathrin- and caveolin-dependent endocytosis. As shown in Figure 4(A), inhibition of endocytosis by dynasore resulted in an increase of rCNT2-E25G/E28G activity thus reaching rCNT2 wild-type levels after 30 min of treatment. This increased activity is consistent with higher amounts of the transporter proteins at the plasma membrane (Figure 4B). The integrity of the rCNT2 N-terminal tail is essential for its asymmetrical distribution in epithelia rCNT2 has been described as an apical transporter in (re)absorptive epithelia [6,27], but the particular signals determining its localization in polarized cells remain unknown. Considering that N-terminal integrity is important for proper CNT2 insertion into the plasma membrane, we analysed this protein fragment further, searching for motifs implicated in the asymmetrical distribution of the transporter. To do so, deleted N-terminal tail transporters and the rCNT2-E25G/E28G double mutant were expressed in the epithelial cell model MDCK II grown on transwells. Transient transfection of rCNT2 resulted in a much higher expression of protein at the apical than at the basolateral side of MDCK II cells, shown by a higher activity at the apical side of the polarized cells. Results also revealed that rCNT2 requires a complete intracellular tail for proper brush border membrane sorting. This is based on the observation that any modification in the first 80 amino acids of the rCNT2 N-terminal tail somehow impaired its apical activity without affecting basolateral function (Figure 5A). When analysing the x–z confocal images of the various tagged transporter mutants expressed in this polarized epithelium, different patterns were observed (Figure 5B). The shorter rCNT2 constructs (rCNT237AA, -48AA and -74AA) seemed to be misfolded and retained in intracellular structures, although images shown in Figure 5(B) were chosen to avoid the high intracellular fluorescence for a better visualization of the plasma membrane. rCNT2-20AA and rCNT2-NPG were distributed all along the plasma membrane, thus suggesting a loss of apical specificity. Interestingly, the rCNT2-E25G/E28G double mutant was retained in intracellular c The Authors Journal compilation c 2012 Biochemical Society 522 I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada of apical guanosine uptake, whereas substitution of aspartate or glutamate for Ser46 to mimic the negative charge of the phosphorylated residue, caused a full recovery of the wild-type phenotype (Figure 6C). x–z confocal images of the transporter proteins expressed in polarized MDCK II cells supported the functional data. The transporter protein showed homogeneous distribution and loss of apical specificity either after DMAT treatment or after replacing Ser46 with glycine (Figure 6D). This was not the case when Ser46 was replaced by negatively charged residues such as glutamate and aspartate (Figure 6D). DISCUSSION Figure 4 Involvement of Glu25 and Glu28 in plasma membrane stabilization and rCNT2-E25G/E28G subcellular distribution in CHO-K1 cells (A) Na + -dependent uptake of [3 H]guanosine (1 μM, 1 min) by YFP-tagged rCNT2 and rCNT2-E25G/E28G was measured in transport medium containing 137 mM NaCl or 137 mM choline chloride after 30 min of treatment with 80 μM dynasore. Na + -dependent transport was calculated as uptake in Na + -containing medium minus uptake in choline-containing medium. Results were normalized to control uptake values (60–70 pmol of guanosine/mg of protein per min) and are means + − S.E.M. for at least three independent experiments. Statistical significance was assessed using Student’s t test: *P < 0.05. (B) CHO-K1 cells were transiently transfected with rCNT2 or rCNT2-E25G/E28G YFP-fused chimaeras (green) and were monitored in vivo for 0–30 min of treatment with 80 μM dynasore. Arrowheads show increased plasma membrane detection. structures compatible with the ER (Figure 5B). In order to internally normalize the expression levels of these constructs, we measured fluorescence intensities at the apical and basolateral plasma membranes, thus resulting in the ratios shown in Figure 5(C). This parameter followed the activity changes shown in Figure 5(A). A CK2 putative phosphorylation domain controls rCNT2 asymmetrical distribution in epithelia Within the intracellular N-terminal fragment of rCNT2, several putative functional domains can be identified using PROSITE scan software. Among them, two putative phosphorylation sites for CK2 appeared, although only one is highly conserved among orthologues (S46 LKD). CK2 has been described as a key regulator in many processes, including plasma membrane endocytosis, cytoskeleton reorganization, cell survival, protein distribution along membrane domains and transporter sorting [18,21–23,28– 30]. To study the contribution of CK2 on rCNT2 activity, sitedirected mutagenesis of this consensus motif was performed (Figure 6A) and the expression ratio of the mutants was quantified by flow cytometry, revealing no significant differences among mutants (Figure 6B). Either substitution of glycine for Ser46 or inhibition of CK2 by DMAT [31–33] resulted in a specific loss c The Authors Journal compilation c 2012 Biochemical Society Previous studies in our laboratory suggested that sorting signals implicated in the membrane insertion of CNTs are localized in the intracellular N-terminal tail of these proteins [13,16,26]. This is based on the evidence that an alternative splicing variant of hCNT3, which is truncated in its N-terminus tail is retained in the ER [16]. Moreover, a β-turn domain in this segment of the hCNT3 protein has been shown to be essential for proper sorting of the transporter to the apical plasma membrane in polarized epithelia [26]. Regarding CNT2, we have recently used the first 74 amino acids of the N-terminal tail as bait in two-hybrid and GST (glutathione transferase) pull-down studies, to identify CNT2 protein partners. Transient interactions with two glucoserelated proteins, aldolase B and grp58, have been characterized [13]. Short-term modulation of CNT2-related function appears to be associated with transient changes in its N-tail interaction with aldolase B [12], a glycolytic enzyme. A link of CNT2 with intracellular energy metabolism had been anticipated previously by demonstrating energy-dependent purinergic regulation of CNT2 [34] and CNT2-mediated adenosine intracellular signalling via AMPK [12]. Evidence for regulated trafficking of CNT2 has also been provided [11]. Although the N-terminal tail of the transporter might be relevant for many of its regulatory properties, this has not been mapped previously as a first step to understand constitutive sorting of CNT2 in nonpolarized and polarized epithelia Within the first 80 amino acids of the rCNT2 sequence, which comprise the intracellular N terminal tail, there are two highly conserved regions, N21 PGLELME28 and S46 LKD. The former contains a putative sorting signal described for Asbt, i.e. NPG, and two glutamate residues that may constitute a diacidic motif [17,33,35]; the latter matches with a putative CK2 phosphorylation domain predicted using PROSITE software. Detailed study of the region N21 PGLELME28 showed that both glutamate residues, Glu25 and Glu28 , are important for rCNT2 sorting, as demonstrated by site-directed mutagenesis of these residues independently. Two polymorphisms of hCNT2 have been described within its N-terminus and the amino acid substitution in this region has been associated with changes in substrate uptake [31]. This double mutant unexpectedly showed a decreased apparent K m value, but its transport efficiency, measured as V max /K m , remained similar to that of rCNT2 due to the lower abundance at the plasma membrane (V max ) of the mutant, which is corroborated when the activity is normalized to the expression ratio. In fact, these residues constitute a domain that might allow the stabilization of the transporter at the plasma membrane. Site-directed mutagenesis of both Glu25 and Glu28 resulted in a loss of activity and intracellular retention. However, when cells were transfected with the double mutant and then treated with dynasore, a specific inhibitor of dynamin, an increase in activity was observed [32]. The comparatively low expression ratio of rCNT2 N-terminal tail is involved in its sorting to plasma membrane Figure 5 523 Characterization of rCNT2–YFP-derived constructs in MDCK II epithelia (A) Na + -dependent [3 H]guanosine uptake (1 μM, 2 min) into apical and basolateral compartments of polarized MDCK II cells transiently transfected with YFP-tagged rCNT2 constructs. Na + -dependent transport was calculated as uptake in NaCl medium minus uptake in choline chloride medium. Results were normalized to control apical uptake values (23–25 pmol of guanosine/mg of protein per 2 min) and are means + − S.E.M. for at least three independent experiments. Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05. (B) x –z images of MDCK II epithelia transiently transfected with YFP-tagged rCNT2 constructions. Cells were fixed, stained for actin with Texas Red-conjugated phalloidin and visualized by confocal microscopy. Actin is stained red, and YFP-tagged rCNT2 constructs are stained green. (C) Fluorescence intensity ratio (apical/basolateral) of rCNT2–YFP constructs, a ratio of >1 implies apical preference, and a ratio of 1 indicates homogeneous distribution. Statistical significance was assessed using Student’s t test: ***P < 0.001 relative to a ratio of 1. the E25G/E28G mutant points towards a higher susceptibility to degradation of the double mutant when compared with the wildtype. The analysis of the truncated rCNT2 constructs showed that at least 37 amino acid residues are necessary for the correct folding of the transporter. Nevertheless, some basal transport remained even with the shortest construct analysed. In the epithelial model used in the present study, any modification of the N-terminal tail resulted in a loss of brush border membrane specificity, with the shortest truncated proteins being misfolded and aggregated. rCNT2-NPG and rCNT2-20AA distributed along the plasma membrane in a manner that would be consistent with loss of polarity specificity. The E25G/E28G double mutant, as shown when using CHO-K1 cell monolayers, seemed to be internalized, but also partially retained in the ER, which could be interpreted on the basis that stability mechanisms are conserved in both polarized and non-polarized cell types. Moreover, in the present study, it has also been demonstrated that CK2-dependent phosphorylation processes might contribute to the polarized insertion of CNT2 in epithelia. Although this assumption is based exclusively on observations generated on transiently transfected MDCK cells, when grown on transwells, this cell line mimics (re)absorptive epithelial barriers and has been widely used for this type of study [36–38]. CK2 is a constitutively active serine/threonine kinase identified as a key regulator in sorting processes of plasma membrane proteins such as ABCA1, NHE3 and ENT1 [21–23]. The putative CK2 domain S46 LKD appears to be involved in the asymmetrical distribution of rCNT2 in MDCK II epithelia. Both the mutant S46G and the wildtype transporter treated with DMAT showed a significant loss of apical sorting, and this effect was reverted by replacing Ser46 with negatively charged amino acids (aspartate and glutamate). When CHO-K1 cells were grown on monolayers, minor effects on activity and none in transporter subcellular localization were observed for the S46G mutant and wild-type rCNT2 treated with DMAT (results not shown). In fact, the localization of regulatory and sorting signals in the N-terminal half of CNT proteins is consistent with the observation that prokaryote orthologues of CNTs, such as NupC, lack the Nterminal intracellular domain and the first three transmembrane helices, but retain all the prototypical characteristics of a nucleoside transporter [36]. This supports the view that the region we have partially mapped in the present study is not essential for function, but might contribute to provide regulatory properties to eukaryotic transporters. In conclusion, the intracellular N-terminal tail of rCNT2 contains two major sorting signals with independent function. A diacidic domain (Glu25 and Glu28 ), implicated in the stabilization of the transporter at the plasma membrane, and a putative CK2 phosphorylation site, that regulates the asymmetrical distribution of rCNT2 in epithelia. This supports further the view that the N-terminal tail of mammalian CNTs is relevant for regulatory purposes. Work on regulated CNT2 trafficking is warranted, c The Authors Journal compilation c 2012 Biochemical Society 524 Figure 6 I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada Characterization of role of the putative CK2 phosphorylation domain mutants in polarized MDCK II cells (A) Schematic representation of YFP-tagged CK2 mutants. (B) Na + -dependent [3 H]guanosine uptake (1 μM, 2 min) into apical and basolateral compartments of polarized MDCK II cells transiently transfected with YFP-tagged rCNT2 CK2 mutants and with rCNT2 treated with DMAT (10 μM, 2 h). Na + -dependent transport was calculated as uptake in NaCl medium minus uptake in choline chloride medium. Results were normalized to control apical uptake values (23–25 pmol of guanosine/mg of protein per 2 min) and are means + − S.E.M. of at least three independent experiments. Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05. (C) x –z images of MDCK II epithelia transiently transfected with YFP-tagged CK2 mutants and with rCNT2 treated with DMAT (10 μM, 2 h). Cells were fixed, stained for actin with Texas Red-conjugated phalloidin and visualized by confocal microscopy. Actin is stained red, and YFP-tagged rCNT2 mutants are stained green. (D) Fluorescence intensity ratio (apical/basolateral) of rCNT2 constructs in transiently transfected MDCK II. A ratio of >1 implies apical preference, and a ratio of 1 indicates homogeneous distribution. Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05 relative to a ratio of 1. particularly considering the important role CNT2 might also play in the clinical setting. AUTHOR CONTRIBUTION Itziar Pinilla-Macua designed and performed the experiments, analysed the data and wrote the paper. Javier Casado provided statistical support and experimental supervision. Marçal Pastor-Anglada supervised data analysis and writing of the paper. ACKNOWLEDGEMENTS We thank the technical support of Mrs Ingrid Iglesias (CIBER-EHD) and the help of Dr Maria Calvo (Centres Cientı́fics I Tècnics, University of Barcelona) in confocal microscopy analysis. FUNDING This study was supported by the Ministerio de Ciencia e Innovación [grant numbers SAF2008-00577 and SAF2011-23660] and Generalitat de Catalunya [grant number 2009SGR624]. The laboratory belongs to the Biomedical Research Institute Network: Liver and Gastrointestinal Diseases (CIBER-EHD). CIBER is an initiative of the Instituto de Salud Carlos III (Ministerio de Ciencia e Innovación). I.P.M. was funded by Ministerio de Ciencia e Innovación (MICINN) and CIBER-EHD. c The Authors Journal compilation c 2012 Biochemical Society REFERENCES 1 Soler, C., Garcia-Manteiga, J., Valdes, R., Xaus, J., Comalada, M., Casado, F.J., Pastor-Anglada, M., Celada, A. and Felipe, A. (2001) Macrophages require different nucleoside transport systems for proliferation and activation. FASEB J. 15, 1979–1988 2 Soler, C., Valdes, R., Garcia-Manteiga, J., Xaus, J., Comalada, M., Casado, F. J., Modolell, M., Nicholson, B., Macleod, C., Felipe, A. et al. (2001) Lipopolysaccharide-induced apoptosis of macrophages determines the up-regulation of concentrative nucleoside transporters Cnt1 and Cnt2 through tumor necrosis factor-α-dependent and -independent mechanisms. J. Biol. Chem. 276, 30043–30049 3 Valdes, R., Ortega, M. A., Casado, F. J., Felipe, A., Gil, A., Sanchez-Pozo, A. and Pastor-Anglada, M. (2000) Nutritional regulation of nucleoside transporter expression in rat small intestine. Gastroenterology 119, 1623–1630 4 Duflot, S., Calvo, M., Casado, F. J., Enrich, C. and Pastor-Anglada, M. (2002) Concentrative nucleoside transporter (rCNT1) is targeted to the apical membrane through the hepatic transcytotic pathway. Exp. Cell Res. 281, 77–85 5 Govindarajan, R., Endres, C. J., Whittington, D., Lecluyse, E., Pastor-Anglada, M., Tse, C. M. and Unadkat, J. D. (2008) Expression and hepatobiliary transport characteristics of the concentrative and equilibrative nucleoside transporters in sandwich-cultured human hepatocytes. Am. J. Physiol. Gastrointest. Liver Physiol. 295, G570–G580 6 Mangravite, L. M., Badagnani, I. and Giacomini, K. M. (2003) Nucleoside transporters in the disposition and targeting of nucleoside analogs in the kidney. Eur. J. Pharmacol. 479, 269–281 rCNT2 N-terminal tail is involved in its sorting to plasma membrane 7 Lai, Y., Bakken, A. H. and Unadkat, J. D. (2002) Simultaneous expression of hCNT1–CFP and hENT1–YFP in Madin–Darby canine kidney cells: localization and vectorial transport studies. J. Biol. Chem. 277, 37711–37717 8 Errasti-Murugarren, E., Pastor-Anglada, M. and Casado, F. J. (2007) Role of CNT3 in the transepithelial flux of nucleosides and nucleoside-derived drugs. J. Physiol. 582, 1249–1260 9 Rodriguez-Mulero, S., Errasti-Murugarren, E., Ballarin, J., Felipe, A., Doucet, A., Casado, F. J. and Pastor-Anglada, M. (2005) Expression of concentrative nucleoside transporters SLC28 (CNT1, CNT2, and CNT3) along the rat nephron: effect of diabetes. Kidney Int. 68, 665–672 10 Vitzthum, H., Weiss, B., Bachleitner, W., Kramer, B. K. and Kurtz, A. (2004) Gene expression of adenosine receptors along the nephron. Kidney Int. 65, 1180–1190 11 Fernandez-Veledo, S., Huber-Ruano, I., Aymerich, I., Duflot, S., Casado, F. J. and Pastor-Anglada, M. (2006) Bile acids alter the subcellular localization of CNT2 (concentrative nucleoside cotransporter) and increase CNT2-related transport activity in liver parenchymal cells. Biochem. J. 395, 337–344 12 Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J. and Pastor-Anglada, M. (2006) Extracellular adenosine activates AMP-dependent protein kinase (AMPK). J. Cell Sci. 119, 1612–1621 13 Huber-Ruano, I., Pinilla-Macua, I., Torres, G., Casado, F. J. and Pastor-Anglada, M. (2010) Link between high-affinity adenosine concentrative nucleoside transporter-2 (CNT2) and energy metabolism in intestinal and liver parenchymal cells. J. Cell. Physiol. 225, 620–630 14 Aymerich, I., Pastor-Anglada, M. and Casado, F. J. (2004) Long term endocrine regulation of nucleoside transporters in rat intestinal epithelial cells. J. Gen. Physiol. 124, 505–512 15 Del Santo, B., Valdes, R., Mata, J., Felipe, A., Casado, F. J. and Pastor-Anglada, M. (1998) Differential expression and regulation of nucleoside transport systems in rat liver parenchymal and hepatoma cells. Hepatology 28, 1504–1511 16 Errasti-Murugarren, E., Molina-Arcas, M., Casado, F. J. and Pastor-Anglada, M. (2009) A splice variant of the SLC28A3 gene encodes a novel human concentrative nucleoside transporter-3 (hCNT3) protein localized in the endoplasmic reticulum. FASEB J. 23, 172–182 17 Sun, A. Q., Salkar, R., Sachchidanand, R., Xu, S., Zeng, L., Zhou, M. M. and Suchy, F. J. (2003) A 14-amino acid sequence with a β-turn structure is required for apical membrane sorting of the rat ileal bile acid transporter. J. Biol. Chem. 278, 4000–4009 18 Ahmed, K., Gerber, D. A. and Cochet, C. (2002) Joining the cell survival squad: an emerging role for protein kinase CK2. Trends Cell Biol. 12, 226–230 19 Lim, A. C., Tiu, S. Y., Li, Q. and Qi, R. Z. (2004) Direct regulation of microtubule dynamics by protein kinase CK2. J. Biol. Chem. 279, 4433–4439 20 Niefind, K., Raaf, J. and Issinger, O. G. (2009) Protein kinase CK2 in health and disease: protein kinase CK2: from structures to insights. Cell. Mol. Life Sci. 66, 1800–1816 21 Roosbeek, S., Peelman, F., Verhee, A., Labeur, C., Caster, H., Lensink, M. F., Cirulli, C., Grooten, J., Cochet, C., Vandekerckhove, J. et al. (2004) Phosphorylation by protein kinase CK2 modulates the activity of the ATP binding cassette A1 transporter. J. Biol. Chem. 279, 37779–37788 22 Bone, D. B., Robillard, K. R., Stolk, M. and Hammond, J. R. (2007) Differential regulation of mouse equilibrative nucleoside transporter 1 (mENT1) splice variants by protein kinase CK2. Mol. Membr. Biol. 24, 294–303 525 23 Sarker, R., Gronborg, M., Cha, B., Mohan, S., Chen, Y., Pandey, A., Litchfield, D., Donowitz, M. and Li, X. (2008) Casein kinase 2 binds to the C terminus of Na + /H + exchanger 3 (NHE3) and stimulates NHE3 basal activity by phosphorylating a separate site in NHE3. Mol. Biol. Cell 19, 3859–3870 24 Harris, M. J., Kagawa, T., Dawson, P. A. and Arias, I. M. (2004) Taurocholate transport by hepatic and intestinal bile acid transporters is independent of FIC1 overexpression in Madin–Darby canine kidney cells. J. Gastroenterol. Hepatol. 19, 819–825 25 Li, J. Y., Boado, R. J. and Pardridge, W. M. (2001) Differential kinetics of transport of 2 ,3 -dideoxyinosine and adenosine via concentrative Na + nucleoside transporter CNT2 cloned from rat blood–brain barrier. J. Pharmacol. Exp. Ther. 299, 735–740 26 Errasti-Murugarren, E., Casado, F. J. and Pastor-Anglada, M. (2010) Different N-terminal motifs determine plasma membrane targeting of the human concentrative nucleoside transporter 3 in polarized and nonpolarized cells. Mol. Pharmacol. 78, 795–803 27 Mangravite, L. M. and Giacomini, K. M. (2003) Sorting of rat SPNT in renal epithelium is independent of N-glycosylation. Pharm. Res. 20, 319–323 28 Scott, G. K., Fei, H., Thomas, L., Medigeshi, G. R. and Thomas, G. (2006) A PACS-1, GGA3 and CK2 complex regulates CI-MPR trafficking. EMBO J. 25, 4423–4435 29 Shi, X., Potvin, B., Huang, T., Hilgard, P., Spray, D. C., Suadicani, S. O., Wolkoff, A. W., Stanley, P. and Stockert, R. J. (2001) A novel casein kinase 2 α-subunit regulates membrane protein traffic in the human hepatoma cell line HuH-7. J. Biol. Chem. 276, 2075–2082 30 Bonifacino, J. S. and Traub, L. M. (2003) Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. 72, 395–447 31 Owen, R. P., Gray, J. H., Taylor, T. R., Carlson, E. J., Huang, C. C., Kawamoto, M., Johns, S. J., Stryke, D., Ferrin, T. E. and Giacomini, K. M. (2005) Genetic analysis and functional characterization of polymorphisms in the human concentrative nucleoside transporter, CNT2. Pharmacogenet. Genomics 15, 83–90 32 Kirchhausen, T., Macia, E. and Pelish, H. E. (2008) Use of dynasore, the small molecule inhibitor of dynamin, in the regulation of endocytosis. Methods Enzymol. 438, 77–93 33 Wolff, S. C., Qi, A. D., Harden, T. K. and Nicholas, R. A. (2010) Charged residues in the C-terminus of the P2Y1 receptor constitute a basolateral-sorting signal. J. Cell Sci. 123, 2512–2520 34 Duflot, S., Riera, B., Fernandez-Veledo, S., Casado, V., Norman, R. I., Casado, F. J., Lluis, C., Franco, R. and Pastor-Anglada, M. (2004) ATP-sensitive K + channels regulate the concentrative adenosine transporter CNT2 following activation by A1 adenosine receptors. Mol. Cell. Biol. 24, 2710–2719 35 Zuzarte, M., Rinne, S., Schlichthorl, G., Schubert, A., Daut, J. and Preisig-Muller, R. (2007) A di-acidic sequence motif enhances the surface expression of the potassium channel TASK-3. Traffic 8, 1093–1100 36 Andersen, M. N., Olesen, S. P. and Rasmussen, H. B. (2011) Kv7.1 surface expression is regulated by epithelial cell polarization. Am. J. Physiol. Cell. Physiol. 300, C814–C824 37 Krasnov, K. V., Tzetis, M., Cheng, J., Guggino, W. B. and Cutting, G. R. (2008) Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype–phenotype relationships. Hum. Mutat. 29, 1364–1372 38 Andersen, M. N., Krzystanek, K., Jespersen, T., Olesen, S. P. and Rasmussen, H. B. (2012) AMP-activated protein kinase downregulates Kv7.1 cell surface expression. Traffic 13, 143–156 Received 4 April 2011/25 November 2011; accepted 2 December 2011 Published as BJ Immediate Publication 2 December 2011, doi:10.1042/BJ20110605 c The Authors Journal compilation c 2012 Biochemical Society Biochem. J. (2012) 442, 517–525 (Printed in Great Britain) doi:10.1042/BJ20110605 SUPPLEMENTARY ONLINE DATA Structural determinants for rCNT2 sorting to the plasma membrane of polarized and non-polarized cells Itziar PINILLA-MACUA, F. Javier CASADO and Marçal PASTOR-ANGLADA1 Department of Biochemistry and Molecular Biology, Institute of Biomedicine (IBUB), University of Barcelona, Barcelona, Spain, and Biomedical Centre for Investigation into Hepatic and Digestive Diseases (CIBER-EHD), University of Barcelona, Barcelona, Spain Table S1 Expression ratio of all rCNT2-derived constructs in CHO-K1 and MDCK II cell lines The expression ratio is measured as the fluorescence intensity ratio of constructs in relation to rCNT2 control using flow cytometry assays. Statistical significance was assessed using Student’s t test. P < 0.05 were considered significant. CHO-K1 cell line MDCK II cell line Construct Expression ratio S.E.M Difference relative to control rCNT2 rCNT2-20AA rCNT2-37AA rCNT2-48AA rCNT2D rCNT2-NPG rCNT2-E16G rCNT2-E25G rCNT2-E28G rCNT2-E25G/E28G rCNT2-E16G/E25G/E28G rCNT2-E25Q/E28Q rCNT2-S46G rCNT2-S46E rCNT2-S46D 1.00 1.05 0.89 0.85 0.99 1.06 1.06 0.87 2.45 0.54 0.94 0.98 1.10 1.13 1.05 0.00 0.10 0.09 0.05 0.11 0.09 0.10 0.12 0.75 0.04 0.11 0.09 0.05 0.07 0.11 P > 0.05 P > 0.05 P > 0.05 P > 0.05 P > 0.05 P > 0.05 P > 0.05 P < 0.05 P < 0.001 P > 0.05 P > 0.05 P > 0.05 P > 0.05 P > 0.05 Expression ratio S.E.M Difference relative to control 1.00 0.94 0.99 0.91 0.89 1.03 0.00 0.12 0.06 0.10 0.03 0.04 P > 0.05 P > 0.05 P > 0.05 P > 0.05 P > 0.05 0.44 0.07 P < 0.05 0.93 0.85 1.02 0.07 0.12 0.16 P > 0.05 P > 0.05 P > 0.05 Received 4 April 2011/25 November 2011; accepted 2 December 2011 Published as BJ Immediate Publication 2 December 2011, doi:10.1042/BJ20110605 1 To whom correspondence should be addressed (email [email protected]). c The Authors Journal compilation c 2012 Biochemical Society