Download Structural determinants for rCNT2 sorting to the plasma membrane

Biochem. J. (2012) 442, 517–525 (Printed in Great Britain)
517
doi:10.1042/BJ20110605
Structural determinants for rCNT2 sorting to the plasma membrane
of polarized and non-polarized cells
Itziar PINILLA-MACUA, F. Javier CASADO and Marçal PASTOR-ANGLADA1
Department of Biochemistry and Molecular Biology, Institute of Biomedicine (IBUB), University of Barcelona, Barcelona, Spain, and Biomedical Centre for Investigation into Hepatic and
Digestive Diseases (CIBER-EHD), University of Barcelona, Barcelona, Spain
rCNT2 (rat concentrative nucleoside transporter 2) (Slc28a2)
is a purine-preferring concentrative nucleoside transporter. It is
expressed in both non-polarized and polarized cells, where it is
localized in the brush border membrane. Since no information
about the domains implicated in the plasma membrane sorting
of rCNT2 is available, the present study aimed to identify
structural and functional requirements for rCNT2 trafficking.
The comprehensive topological mapping of the intracellular
N-terminal tail revealed two main features: (i) a glutamateenriched region (NPGLELME) between residues 21 and 28
that seems to be implicated in the stabilization of rCNT2
in the cell surface, since mutagenesis of these conserved
glutamates resulted in enhanced endocytosis; and (ii) mutation
of a potential protein kinase CK2 domain that led to a
loss of brush border-specific sorting. Although the shortest
proteins assayed (rCNT2-74AA, -48AA and -37AA) accumulated
intracellularly and lost their brush border membrane preference,
they were still functional. A deeper analysis of CK2 implication
in CNT2 trafficking, using a CK2-specific inhibitor [DMAT
(2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole)] and
other complementary mutations mimicking the negative charge
provided by phosphorylation (S46D and S46E), demonstrated
an effect of this kinase on rCNT2 activity. In summary, the Nterminal tail of rCNT2 contains dual sorting signals. An acidic
region is responsible for its proper stabilization at the plasma
membrane, whereas the putative CK2 domain (Ser46 ) is implicated
in the apical sorting of the transporter.
INTRODUCTION
adenosine 1 receptors (A1 R) are found [9,10], thus contributing to
the modulation of the accessibility of extracellular adenosine to
its receptors.
Previous studies from our group showed that both the
expression and the subcellular localization of rCNT2 (rat CNT2)
are highly regulated. In this regard, it has been described
that bile acids can increase plasma membrane rCNT2 activity
by promoting the transporter translocation from intracellular
compartments to the plasma membrane [11]. CNT2 has also
been described as a key player in energy metabolism, necessary
for the activation of AMPK (AMP-activated protein kinase)
by extracellular adenosine [12]. Interestingly, the only proteins
known so far to interact directly with rCNT2 are the glycolitic
enzyme aldolase B and the glucose-dependent chaperone grp58
(glucose-regulated protein 58), both intimately implicated in
energy metabolism [13]. In addition, rCNT2 expression and
activity are under endocrine and paracrine control, since
differentiating factors such as glucocorticoids, and proliferative
agents such as EGF (epidermal growth factor) and TGFβ
(transforming growth factor β) increase its expression and activity
at the plasma membrane [14,15]. Although rCNT2 has been
shown to be regulated by a wide range of stimuli and most
of them result in changes in the subcellular localization of the
transporter, the precise molecular mechanisms that regulate
the plasma membrane localization of this transporter remain
poorly understood. The finding that a putative spliced variant
CNT (concentrative nucleoside transporter) 2 is a sodium–
purine nucleoside co-transporter putatively structured in
13 transmembrane domains with cytosolic N-terminal and
extracellular C-terminal tails. CNT2 is expressed in most
epithelial and immune system cells [1–3]. In rat liver parenchymal
cells, it is mostly located at the sinusoidal pole and in
intracellular compartments, but in humans, it is found at both
the canalicular and the sinusoidal membrane compartments [4,5].
In absorptive epithelia, CNT2 is mostly located at the apical
domain [6]. The asymmetrical distribution of concentrative (CNTtype) and equilibrative (ENT-type) nucleoside transporter proteins
in intestinal and renal epithelia, with equilibrative transporters
mainly expressed at the basolateral domain and concentrative ones
at the apical domain, allows the establishment of a transepithelial
flux of natural nucleosides and nucleoside-derived drugs, as
described previously [7,8]. Although these results point towards
a putative role for CNT2 in the (re)absorption processes of purine
nucleosides as well as purine derivatives such as ribavirin, there
could be additional roles for CNT2, as suggested by the expression
pattern of this transporter along the rat nephron. The highest
CNT2 mRNA levels are found in the glomerulus, although it
is also expressed in some renal tubular segments (mostly the
proximal convoluted tubule) [9], where it can play a major role in
purine nucleoside reabsorption. CNT2 is found in regions where
Key words: concentrative nucleoside transporter 2 (CNT2),
epithelium, phosphorylation, plasma membrane, protein kinase
CK2, sorting.
Abbreviations used: ABCA1, ATP-binding cassette transporter A1; AMPK, AMP-activated protein kinase; Asbt, apical sodium-dependent bile transporter;
BCA, bicinchoninic acid; CHO, Chinese-hamster ovary; CNT, concentrative nucleoside transporter; DMAT, 2-dimethylamino-4,5,6,7-tetrabromo-1H benzimidazole; ENT, equilibrative nucleoside transporter; ER, endoplasmic reticulum; FBS, fetal bovine serum; grp58, glucose-regulated protein 58;
hCNT3, human CNT3; MDCK, Madin–Darby canine kidney; NHE3, Na + / H + exchanger 3; rCNT2, rat CNT2; TRITC, tetramethylrhodamine β-isothiocyanate;
WGA, wheat germ agglutinin; YFP, yellow fluorescent protein.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2012 Biochemical Society
518
I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada
of hCNT3 (human CNT3) lacking the first 69 amino acids of the
N-terminal tail shows ER (endoplasmic reticulum) retention [16]
anticipates a role for the intracellular N-terminal domain in the
regulation of the plasma membrane localization of CNT proteins.
rCNT2 possesses a large intracellular N-terminal tail (80
amino acids) which contains some highly conserved domains
among CNT2 orthologues. Among those motifs, there is a
diacidic motif and a NPG (Asn-Pro-Gly) sequence which strongly
resemble the sorting sequence described for Asbt (apical sodiumdependent bile transporter) [17]. Prediction of consensus motifs
using PROSITE identified two putative protein kinase CK2
phosphorylation domains, T37 LEE and S46 LKD, within the Nterminal tail, with the latter being highly conserved among
orthologues.
The protein kinase CK2 heterotetramer is a constitutively
active serine/threonine kinase whose holoenzymes consist of
two catalytic subunits (α and α ) and a dimer of regulatory β
subunits. CK2 is essential for cell viability and appears to be
implicated in global processes such as tRNA and rRNA synthesis,
apoptosis, cell survival, transformation, and the regulation of
cytoskeleton elements that shape cell morphology [18–20]. CK2
has been proved to regulate the sorting to the plasma membrane
of some transporters such as ABCA1 (ATP-binding cassette
transporter A1), a phospholipid and cholesterol transporter;
ENT1, an equilibrative nucleoside transporter and NHE3 (Na + /
H + exchanger 3) [21–23].
The aim of the present study was to map structural motifs
present at the N-terminal tail of the rCNT2 protein implicated
in constitutive sorting of this transporter in both polarized and
non-polarized cells.
MATERIALS AND METHODS
Chemicals and reagents
Guanosine, DMAT (2-dimethylamino-4,5,6,7-tetrabromo-1Hbenzimidazole) and Dynasore were purchased from Sigma–
Aldrich. [3 H]Guanosine was from Hartmann Analytic. WGA
(wheat germ agglutinin)–TRITC (tetramethylrhodamine βisothiocyanate) membrane marker was obtained from Molecular
Probes and Aqua-Poly/Mount coverslipping medium from
Polysciences.
Cell culture and transfection
The CHO (Chinese-hamster ovary)-K1 cell line was routinely
cultured in EMEM (Eagle’s minimal essential medium)
supplemented with 5 % (v/v) FBS (fetal bovine serum),
1 % antibiotic mixture (100 units/ml penicillin G, 0.1 mg/ml
streptomycin and 0.25 μg/ml fungizone), 2 mM glutamine,
0.1 mM non-essential amino acids and 1 mM sodium pyruvate.
All reagents were purchased from Invitrogen. The MDCK
(Madin–Darby canine kidney) II cell line was cultured in
DMEM (Dulbecco’s modified Eagle’s medium) (Invitrogen)
supplemented with 10 % FBS, 1 % antibiotic mixture and 2 mM
glutamine. Both cell lines were maintained at 37 ◦ C/5 % CO2 and
neither express endogenous CNT2 activity
CHO-K1 cells were transiently transfected with plasmids
described below using LipofectamineTM 2000 (Invitrogen)
following the manufacturer’s protocol. Nucleoside transport,
confocal microscopy and flow cytometry were carried out 48 h
after transfection. MDCK II cells were seeded on transwell plates
(12 mm diameter, 0.3 μm pore; Corning Costar) and transfected
using LipofectamineTM 2000 as described previously [24].
c The Authors Journal compilation c 2012 Biochemical Society
Table 1
Oligonucleotides for PCR
Restriction sites are underlined.
Primer
Restriction site
Sequence (5 →3 )
rC2EcoRI Fw
rC2delEcoRI Fw
rC2SmaI Rv
rCNT2-20AA Fw
rCNT2-37AA Fw
rCNT2-48AA Fw
EcoRI
EcoRI
SmaI
EcoRI
EcoRI
EcoRI
GGGGGAATTCGATGGCGAAGTCAGA
GGGGGAATTCTGCTGGTTTATTCA
TTTTCCCGGGTCAGGCACACACAGT
CCCCGAATTCAAACCCAGGCCTGGAGCTCATGG
GGGGGAATTCCCTGGAGGAAGTG
GGGTGAATTCGGATGGCTTGGGGC
Table 2
Oligonucleotides for site-directed mutagenesis
Primer
Sequence (5 →3 )
rC2-S46G Fw
rC2-S46G Rv
rC2-S46D Fw
rC2-S46D Rv
rC2-S46E Fw
rC2-S46E Rv
rC2-E16G Fw
rC2-E16G Rv
rC2 E25G Fw
rC2 E25G Rv
rC2 E28G Fw
rC2 E28G Rv
rC2-E25G/E28G
Fw
rC2-E25G/E28G
Rv
rC2-2EQ-YFP
Fw
rC2-2EQ-YFP
Rv
rC2-NPG Fw
rC2-NPG Rv
GGAAGTGACACAGGGACATGGCCTGAAGAATGGCTTGGG
CCCAAGCCATCCTTCAGGCCATGTCCCTGTGTCACTTCC
AGTGACACAGGGACATGACCTGAAGGATGGCTTGGGG
CCCCAAGCCATCCTTCAGGTCATGTCCCTGTGTCACT
AGTGACACAGGGACATGAGCTGAAGGATGGCTTGGGG
CCCCAAGCCATCCTTCAGCTCATGTCCCTGTGTCACT
CTGCTTCCCAGGACACATCGGGGAATGGCATGGAGAACCCAG
CTGGGTTCTCCATGCCATTCCCCGATGTGTCCTGGGAAGCAG
GCATGGAGAACCCAGGCCTGGGGCTCATGGAAGTCGGAAACCTTGAGCAA
TTGCTCAAGGTTTCCGACTTCCATGAGCCCCAGGCCTGGGTTCTCCATGC
GCATGGAGAACCCAGGCCTGGAGCTCATGGGAGTCGGAAACCTTGAGCAA
TTGCTCAAGGTTTCCGACTCCCATGAGCTCCAGGCCTGGGTTCTCCATGC
GCATGGAGAACCCAGGCCTGGGGCTCATGGGAGTCGGAAACCTTGAGCAA
TTGCTCAAGGTTTCCGACTCCCATGAGCCCCAGGCCTGGGTTCTCCATGC
GGAGAACCCAGGCCTGCAGCTCATGCAAGTCGGAAACCTTGACCAA
TTGCTCAAGGTTTCCGACGTTCATGAGCTGCAGGCCTGGGTTCTCCA
GGACACATCGGAGAATGGCATGGAGCTGGAGCTCATGGAAGTCGGAAACC
GGTTTCCGACTTCCATGAGCTCCAGCTCCATGCCATTCTCCGATGTGTCC
Generation of rCNT2–YFP (yellow fluorescent protein) constructs
rCNT2 cDNA (kindly donated by Dr Ruben Boado, Division
of Endocrinology, Diabetes and Hypertension, University of
California Los Angeles, Los Angeles, CA, U.S.A.) [25] was
subcloned into the pEYFP-C1 vector (Clontech) using EcoRI and
SmaI restriction sites (Roche) at the 5 and 3 ends respectively.
rCNT2 N-terminal deletions were generated by PCR adding the
restriction sites described above and subcloning the PCR product
into pEYFP-C1. The QuikChange® site-directed mutagenesis kit
(Stratagene) was used to generate CNT2 mutants according to
the manufacturer’s protocol. The YFP-fused CNT2 was used
as template. Specific primer sequences and combinations are
shown in Tables 1 and 2. All constructions were verified by DNA
sequencing using the Big Dye Terminator sequencing kit version
3.1 (Applied Biosystems) and used for transient transfection.
Nucleoside transport assay
Nucleoside transport activity was monitored in cultured CHOK1 cells in either Na + -containing or Na + -free medium as
described previously [15]. The uptake of [3 H]guanosine (1 μM,
1 μCi/ml) was measured in the presence of either 137 mM NaCl
or 137 mM choline chloride. The uptake medium also contained
5.4 mM KCl, 1,8 mM CaCl2 , 1.2 mM MgSO4 and 10 mM Hepes
rCNT2 N-terminal tail is involved in its sorting to plasma membrane
(pH 7.4). Incubation was stopped after 1 min (thus maintaining
initial velocity conditions) by washing the monolayers twice in
2 ml of cold stop buffer (137 mM NaCl and 10 mM Tris/Hepes,
pH 7.4). Cells were then lysed with 100 μl of 100 mM NaOH
and 0.5 % Triton X-100. Aliquots of 10 μl were taken for protein
determination [BCA (bicinchoninic acid) Protein Assay Reagent
(Pierce)] and radioactivity measurements.
Saturation kinetics were monitored in cultured CHO-K1 cells
either in Na + -containing or Na + -free medium as described
above for initial velocity conditions in a range of substrate
concentrations between 0.5 and 100 μM. Data were evaluated by
non-linear regression analysis using the GraphPad Prism version
5.03 software to obtain kinetic parameters.
Transwell transport assays
MDCK II cells were grown on transwell filters, transiently
transfected and monitored for uptake rates as described previously
[24]. Filters were washed twice with Na + -containing or Na + free buffers. For apical uptake, 0.5 ml of the buffer containing
[3 H]guanosine (1 μM, 1 μCi/ml) was added to the upper
compartment, whereas 0.5 ml of non-radioactive buffer was
added to the lower compartment; for basolateral uptake, 0.5 ml
of radiolabelled buffer was added to the lower compartment
and 0.5 ml of non-radioactive buffer was added to the upper
compartment. The incubation was stopped after 2 min by washing
the filters twice with cold stop buffer. The cells on the filters were
solubilized with 200 μl of lysis buffer containing 0.1 % SDS and
100 mM NaOH, and aliquots of 90 μl were taken for protein
determination (BCA Protein Assay Reagent) and radioactivity
measurements.
Confocal microscopy imaging
To determine the localization of each construct, confocal
microscopy of YFP-fused proteins was performed on
subconfluent monolayer of transfected CHO-K1 cells cultured
on glass coverslips. Glass coverslip-grown cells were rinsed three
times with PBS supplemented with 0.1 mM CaCl2 and 1 mM
MgCl2 , fixed with 3.7 % (w/v) paraformaldehyde and 0.06 M
sucrose in PBS, rinsed three times with PBS supplemented
with 20 mM glycine. To analyse plasma membrane localization,
WGA–TRITC was used at 1 μg/ml for 10 min at room
temperature (25 ◦ C) after fixation, then rinsed three times in PBS
and mounted with Aqua-Poly/Mount coverslipping medium.
To analyse polarized membrane location, MDCK II cells
were grown on transwell filters, transfected and, 48 h later,
fixed as described above. Actin was stained using 0.5 μg/ml
phalloidin–TRITC (Sigma–Aldrich) and then mounted with
Aqua-Poly/Mount coverslipping medium.
Sections were viewed using a Leica TCS SP5 laserscanning confocal microscope equipped with a DMI6000 inverted
microscope, argon laser, diode-pumped solid-state (561 nm), and
a 63× oil-immersion objective lens [NA (numerical aperture) 1.4]
was used. Image processing and apical/basolateral fluorescence
intensity measurements were performed with ImageJ software
(NIH; http://rsb.info.nih.gov/ij/).
Flow cytometry assays
Cultured CHO-K1 and MDCK II cells transiently transfected with
CNT2–YFP constructs were trypsinized 48 h after transfection
and measured by flow cytometry using a Cytomics FC 500
MPL Flow Cytometry System (Beckman Coulter). Transfection
519
efficiency and fluorescence intensity of all the constructs were
determined to evaluate proper expression and internalization of
YFP-tagged constructs in relation to rCNT2 control construct.
Data analysis
Data are expressed as the means +
− S.E.M. of uptake values
obtained from triplicates from at least three independent
experiments carried out on different days on different batches
of cells. Statistical analysis was performed using GraphPad
Prism version 5.03. Statistical differences were assessed using
the unpaired Student’s t test, P values <0.05 were considered
statistically significant. For kinetic analysis, non-linear regression
was performed assuming that data could be fitted to a one-site
binding hyperbola without constraints.
RESULTS
Glu25 and Glu28 are essential for proper plasma membrane location
On the basis of previous observations on hCNT3 N-terminal tail
which associated this intracellular domain with sorting regulation
[16,26], the rCNT2 intracellular N-terminal tail was considered
to be a candidate to regulate the sorting of the transporter to the
plasma membrane. To elucidate the possible sequences contained
in this domain of rCNT2 responsible for this process, sequential
deletions of the N-terminal tail were performed (Figure 1A).
The expression ratios of the deleted constructs, measured
as the relationship between the mean fluorescence intensity
of these variants compared with control (wild-type rCNT2)
(see Supplementary Table S1 at http://www.BiochemJ.org/
bj/442/bj4420517add.htm) showed similar expression levels for
all these proteins, so uptake changes are due to differential
activity and/or localization. Guanosine-uptake assays showed
significantly impaired activity when the N-terminal region was
deleted beyond Thr37 (Figure 1B), which was consistent with
intracellular retention of the truncated transporters (Figure 1C).
Comparing the amino acid sequences of CNT2 orthologues,
a highly conserved region is defined between Asn21 and Thr37 ,
where activity and location differences can be found. To study the
involvement of this conserved region in rCNT2 plasma membrane
insertion, site-directed mutagenesis was performed (Figure 2A).
This region consists of an N21 PG23 sequence, similar to the sorting
signal described for Asbt [17], and a putative diacidic motif (Glu25
and Glu28 ). The deletion of the N21 PG23 region had no effect either
on the activity of the truncated transporter or on its arrival to the
plasma membrane (Figures 2B and 2D), whereas mutation of
Glu25 and Glu28 plus Glu16 (Figure 2B) revealed a significant loss
of activity associated with the substitution by glycine for Glu25
and Glu28 , but not for Glu16 (Figure 2D). The combination of
mutations of Glu25 and Glu28 caused a similar reduction in activity
to that of Glu25 and Glu28 alone, and is associated with intracellular
retention (Figures 2B and 2D). Analysing the expression ratio
of the mutants, only E28G and the double mutant E25G/E28G
showed significant differences (see Supplementary Table S1).
When their activity was corrected to the expression ratio, the
double mutant appeared to be as active as the wild-type rCNT2,
but its localization turned out to be different, suggesting increased
internalization of the double mutant (Figure 2C). On the other
hand, the E28G rCNT2 mutant showed even lower uptake rates
than wild-type when corrected to their corresponding expression
ratios. This might be explained by either increased expression or
reduced degradation of the mutant. The substitution of glutamine
for Glu25 and Glu28 showed no significant differences compared
c The Authors Journal compilation c 2012 Biochemical Society
520
Figure 1
I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada
Role of rCNT2 intracellular N-terminal tail on the plasma membrane localization of rCNT2 in CHO-K1 cells
(A) Schematic representation of YFP-tagged rCNT2 N-terminally truncated constructs. (B) Na + -dependent uptake of [3 H]guanosine (1 μM, 1 min) by YFP-tagged rCNT2 constructs was measured
in transport medium containing 137mM NaCl or 137 mM choline chloride. Na + -dependent transport was calculated as uptake in Na + -containing medium minus uptake in choline-containing
medium. Results were normalized to control (ctrl) uptake values (80–90 pmol of guanosine/mg of protein per min) and are means +
− S.E.M. for at least three independent experiments. Statistical
significance was assessed using Student’s t test: ***P < 0.01. (C) Subcellular localization of YFP-fused rCNT2 constructs matching activity differences between constructs.
Figure 2
Identification of the importance of Glu25 and Glu28 in rCNT2 surface localization and activity in CHO-K1 cells
(A) Schematic representation of YFP-tagged rCNT2 mutants in the first 30 amino acids. (B) Na + -dependent uptake of [3 H]guanosine (1 μM, 1 min) by YFP-tagged rCNT2 constructs was measured in
transport medium containing 137 mM NaCl or 137 mM choline chloride. Na + -dependent transport was calculated as uptake in Na + -containing medium minus uptake in choline-containing medium.
Results were normalized to control uptake values (80–90 pmol of guanosine/mg of protein per min) and are means +
− S.E.M. for at least three independent experiments. Statistical significance was
assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05. (C) Activity corrections of rCNT2 mutants which showed impaired expression rates on transiently transfected CHO-K1 cells.
(D) Subcellular localization of YFP-fused rCNT2 constructions matching activity differences between constructions. YFP-fused rCNT2 constructs (green), plasma membrane WGA–TRITC (red) and
merge (yellow).
c The Authors Journal compilation c 2012 Biochemical Society
rCNT2 N-terminal tail is involved in its sorting to plasma membrane
Figure 3
521
Kinetic analysis of YFP-tagged rCNT2 constructs by Michaelis–Menten representation in CHO-K1 cells
(A) Na + -dependent [3 H]guanosine (Guo) uptake (1 min) at increasing concentrations (0.5–100 μM) by YFP-tagged rCNT2 truncated constructs and E25G/E28G mutant in transiently transfected
CHO-K1 cells. (B) Kinetic parameters measured using GraphPad Prism software, according to the Michaelis–Menten curve. Results are means +
− S.E.M. for at least three independent experiments.
with wild-type rCNT2, suggesting a need for residues with long
lateral chains in positions 25 and 28, rather than the occurrence
of negative charges (Figures 2B and 2D).
To identify the nature of the loss of function of the truncated
rCNT2 proteins as well as that of the mutant rCNT2-E25G/E28G,
uptake kinetic analyses were performed. Three different patterns
of activity changes were identified. Constructions retaining Glu25
and Glu28 showed transport rates similar to those of the wild-type
transporter, whereas deletion of 38, 47 or 74 amino acids caused
a 50 % loss of function, consistent with low V max and unaltered
apparent K m values (Figure 3). The E25G/E28G double mutant
showed lower activity rates than the wild-type transporter and the
apparent K m value was markedly decreased (10-fold) (Figure 3B).
Glu25 and Glu28 are important for rCNT2 stability at the plasma
membrane
As rCNT2-E25G/E28G showed a lower expression ratio and
V max value, but was still functional, showing an uptake rate
similar to control rCNT2, we hypothesized that the rCNT2
double mutant may be endocytosed faster than the wild-type.
To analyse this possibility further, we used the dynamin inhibitor
dynasore. Dynasore inhibits the GTPase activity of various dynamins, thus blocking both clathrin- and caveolin-dependent
endocytosis. As shown in Figure 4(A), inhibition of endocytosis
by dynasore resulted in an increase of rCNT2-E25G/E28G activity
thus reaching rCNT2 wild-type levels after 30 min of treatment.
This increased activity is consistent with higher amounts of the
transporter proteins at the plasma membrane (Figure 4B).
The integrity of the rCNT2 N-terminal tail is essential for its
asymmetrical distribution in epithelia
rCNT2 has been described as an apical transporter in
(re)absorptive epithelia [6,27], but the particular signals
determining its localization in polarized cells remain unknown.
Considering that N-terminal integrity is important for proper
CNT2 insertion into the plasma membrane, we analysed this
protein fragment further, searching for motifs implicated in the
asymmetrical distribution of the transporter. To do so, deleted
N-terminal tail transporters and the rCNT2-E25G/E28G double
mutant were expressed in the epithelial cell model MDCK II
grown on transwells. Transient transfection of rCNT2 resulted
in a much higher expression of protein at the apical than at the
basolateral side of MDCK II cells, shown by a higher activity
at the apical side of the polarized cells. Results also revealed
that rCNT2 requires a complete intracellular tail for proper brush
border membrane sorting. This is based on the observation that
any modification in the first 80 amino acids of the rCNT2
N-terminal tail somehow impaired its apical activity without
affecting basolateral function (Figure 5A). When analysing the
x–z confocal images of the various tagged transporter mutants
expressed in this polarized epithelium, different patterns were
observed (Figure 5B). The shorter rCNT2 constructs (rCNT237AA, -48AA and -74AA) seemed to be misfolded and retained
in intracellular structures, although images shown in Figure 5(B)
were chosen to avoid the high intracellular fluorescence for a
better visualization of the plasma membrane. rCNT2-20AA and
rCNT2-NPG were distributed all along the plasma membrane,
thus suggesting a loss of apical specificity. Interestingly, the
rCNT2-E25G/E28G double mutant was retained in intracellular
c The Authors Journal compilation c 2012 Biochemical Society
522
I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada
of apical guanosine uptake, whereas substitution of aspartate
or glutamate for Ser46 to mimic the negative charge of the
phosphorylated residue, caused a full recovery of the wild-type
phenotype (Figure 6C). x–z confocal images of the transporter
proteins expressed in polarized MDCK II cells supported the
functional data. The transporter protein showed homogeneous
distribution and loss of apical specificity either after DMAT
treatment or after replacing Ser46 with glycine (Figure 6D). This
was not the case when Ser46 was replaced by negatively charged
residues such as glutamate and aspartate (Figure 6D).
DISCUSSION
Figure 4 Involvement of Glu25 and Glu28 in plasma membrane stabilization
and rCNT2-E25G/E28G subcellular distribution in CHO-K1 cells
(A) Na + -dependent uptake of [3 H]guanosine (1 μM, 1 min) by YFP-tagged rCNT2 and
rCNT2-E25G/E28G was measured in transport medium containing 137 mM NaCl or 137 mM
choline chloride after 30 min of treatment with 80 μM dynasore. Na + -dependent transport was
calculated as uptake in Na + -containing medium minus uptake in choline-containing medium.
Results were normalized to control uptake values (60–70 pmol of guanosine/mg of protein per
min) and are means +
− S.E.M. for at least three independent experiments. Statistical significance
was assessed using Student’s t test: *P < 0.05. (B) CHO-K1 cells were transiently transfected
with rCNT2 or rCNT2-E25G/E28G YFP-fused chimaeras (green) and were monitored in vivo for
0–30 min of treatment with 80 μM dynasore. Arrowheads show increased plasma membrane
detection.
structures compatible with the ER (Figure 5B). In order to
internally normalize the expression levels of these constructs, we
measured fluorescence intensities at the apical and basolateral
plasma membranes, thus resulting in the ratios shown in
Figure 5(C). This parameter followed the activity changes shown
in Figure 5(A).
A CK2 putative phosphorylation domain controls rCNT2
asymmetrical distribution in epithelia
Within the intracellular N-terminal fragment of rCNT2, several
putative functional domains can be identified using PROSITE
scan software. Among them, two putative phosphorylation sites
for CK2 appeared, although only one is highly conserved among
orthologues (S46 LKD). CK2 has been described as a key regulator
in many processes, including plasma membrane endocytosis,
cytoskeleton reorganization, cell survival, protein distribution
along membrane domains and transporter sorting [18,21–23,28–
30]. To study the contribution of CK2 on rCNT2 activity, sitedirected mutagenesis of this consensus motif was performed
(Figure 6A) and the expression ratio of the mutants was quantified
by flow cytometry, revealing no significant differences among
mutants (Figure 6B). Either substitution of glycine for Ser46 or
inhibition of CK2 by DMAT [31–33] resulted in a specific loss
c The Authors Journal compilation c 2012 Biochemical Society
Previous studies in our laboratory suggested that sorting signals
implicated in the membrane insertion of CNTs are localized in
the intracellular N-terminal tail of these proteins [13,16,26]. This
is based on the evidence that an alternative splicing variant of
hCNT3, which is truncated in its N-terminus tail is retained in the
ER [16]. Moreover, a β-turn domain in this segment of the hCNT3
protein has been shown to be essential for proper sorting of the
transporter to the apical plasma membrane in polarized epithelia
[26].
Regarding CNT2, we have recently used the first 74 amino
acids of the N-terminal tail as bait in two-hybrid and GST
(glutathione transferase) pull-down studies, to identify CNT2
protein partners. Transient interactions with two glucoserelated proteins, aldolase B and grp58, have been characterized
[13]. Short-term modulation of CNT2-related function appears to
be associated with transient changes in its N-tail interaction with
aldolase B [12], a glycolytic enzyme. A link of CNT2
with intracellular energy metabolism had been anticipated
previously by demonstrating energy-dependent purinergic
regulation of CNT2 [34] and CNT2-mediated adenosine
intracellular signalling via AMPK [12]. Evidence for regulated
trafficking of CNT2 has also been provided [11]. Although the
N-terminal tail of the transporter might be relevant for many of
its regulatory properties, this has not been mapped previously as
a first step to understand constitutive sorting of CNT2 in nonpolarized and polarized epithelia
Within the first 80 amino acids of the rCNT2 sequence,
which comprise the intracellular N terminal tail, there are two
highly conserved regions, N21 PGLELME28 and S46 LKD. The
former contains a putative sorting signal described for Asbt,
i.e. NPG, and two glutamate residues that may constitute a
diacidic motif [17,33,35]; the latter matches with a putative CK2
phosphorylation domain predicted using PROSITE software.
Detailed study of the region N21 PGLELME28 showed that both
glutamate residues, Glu25 and Glu28 , are important for rCNT2
sorting, as demonstrated by site-directed mutagenesis of these
residues independently. Two polymorphisms of hCNT2 have been
described within its N-terminus and the amino acid substitution
in this region has been associated with changes in substrate
uptake [31]. This double mutant unexpectedly showed a decreased
apparent K m value, but its transport efficiency, measured as
V max /K m , remained similar to that of rCNT2 due to the lower
abundance at the plasma membrane (V max ) of the mutant, which
is corroborated when the activity is normalized to the expression
ratio. In fact, these residues constitute a domain that might allow
the stabilization of the transporter at the plasma membrane.
Site-directed mutagenesis of both Glu25 and Glu28 resulted in a
loss of activity and intracellular retention. However, when cells
were transfected with the double mutant and then treated with
dynasore, a specific inhibitor of dynamin, an increase in activity
was observed [32]. The comparatively low expression ratio of
rCNT2 N-terminal tail is involved in its sorting to plasma membrane
Figure 5
523
Characterization of rCNT2–YFP-derived constructs in MDCK II epithelia
(A) Na + -dependent [3 H]guanosine uptake (1 μM, 2 min) into apical and basolateral compartments of polarized MDCK II cells transiently transfected with YFP-tagged rCNT2 constructs.
Na + -dependent transport was calculated as uptake in NaCl medium minus uptake in choline chloride medium. Results were normalized to control apical uptake values (23–25 pmol of guanosine/mg
of protein per 2 min) and are means +
− S.E.M. for at least three independent experiments. Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05.
(B) x –z images of MDCK II epithelia transiently transfected with YFP-tagged rCNT2 constructions. Cells were fixed, stained for actin with Texas Red-conjugated phalloidin and visualized by confocal
microscopy. Actin is stained red, and YFP-tagged rCNT2 constructs are stained green. (C) Fluorescence intensity ratio (apical/basolateral) of rCNT2–YFP constructs, a ratio of >1 implies apical
preference, and a ratio of 1 indicates homogeneous distribution. Statistical significance was assessed using Student’s t test: ***P < 0.001 relative to a ratio of 1.
the E25G/E28G mutant points towards a higher susceptibility to
degradation of the double mutant when compared with the wildtype. The analysis of the truncated rCNT2 constructs showed that
at least 37 amino acid residues are necessary for the correct folding
of the transporter. Nevertheless, some basal transport remained
even with the shortest construct analysed. In the epithelial model
used in the present study, any modification of the N-terminal
tail resulted in a loss of brush border membrane specificity, with
the shortest truncated proteins being misfolded and aggregated.
rCNT2-NPG and rCNT2-20AA distributed along the plasma
membrane in a manner that would be consistent with loss of
polarity specificity. The E25G/E28G double mutant, as shown
when using CHO-K1 cell monolayers, seemed to be internalized,
but also partially retained in the ER, which could be interpreted on
the basis that stability mechanisms are conserved in both polarized
and non-polarized cell types.
Moreover, in the present study, it has also been demonstrated
that CK2-dependent phosphorylation processes might contribute
to the polarized insertion of CNT2 in epithelia. Although this
assumption is based exclusively on observations generated on
transiently transfected MDCK cells, when grown on transwells,
this cell line mimics (re)absorptive epithelial barriers and has been
widely used for this type of study [36–38]. CK2 is a constitutively
active serine/threonine kinase identified as a key regulator in
sorting processes of plasma membrane proteins such as ABCA1,
NHE3 and ENT1 [21–23]. The putative CK2 domain S46 LKD
appears to be involved in the asymmetrical distribution of rCNT2
in MDCK II epithelia. Both the mutant S46G and the wildtype transporter treated with DMAT showed a significant loss
of apical sorting, and this effect was reverted by replacing Ser46
with negatively charged amino acids (aspartate and glutamate).
When CHO-K1 cells were grown on monolayers, minor effects
on activity and none in transporter subcellular localization were
observed for the S46G mutant and wild-type rCNT2 treated with
DMAT (results not shown).
In fact, the localization of regulatory and sorting signals in the
N-terminal half of CNT proteins is consistent with the observation
that prokaryote orthologues of CNTs, such as NupC, lack the Nterminal intracellular domain and the first three transmembrane
helices, but retain all the prototypical characteristics of a
nucleoside transporter [36]. This supports the view that the region
we have partially mapped in the present study is not essential for
function, but might contribute to provide regulatory properties to
eukaryotic transporters.
In conclusion, the intracellular N-terminal tail of rCNT2
contains two major sorting signals with independent function. A
diacidic domain (Glu25 and Glu28 ), implicated in the stabilization
of the transporter at the plasma membrane, and a putative CK2
phosphorylation site, that regulates the asymmetrical distribution
of rCNT2 in epithelia. This supports further the view that the
N-terminal tail of mammalian CNTs is relevant for regulatory
purposes. Work on regulated CNT2 trafficking is warranted,
c The Authors Journal compilation c 2012 Biochemical Society
524
Figure 6
I. Pinilla-Macua, F. J. Casado and M. Pastor-Anglada
Characterization of role of the putative CK2 phosphorylation domain mutants in polarized MDCK II cells
(A) Schematic representation of YFP-tagged CK2 mutants. (B) Na + -dependent [3 H]guanosine uptake (1 μM, 2 min) into apical and basolateral compartments of polarized MDCK II cells transiently
transfected with YFP-tagged rCNT2 CK2 mutants and with rCNT2 treated with DMAT (10 μM, 2 h). Na + -dependent transport was calculated as uptake in NaCl medium minus uptake in choline
chloride medium. Results were normalized to control apical uptake values (23–25 pmol of guanosine/mg of protein per 2 min) and are means +
− S.E.M. of at least three independent experiments.
Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05. (C) x –z images of MDCK II epithelia transiently transfected with YFP-tagged CK2 mutants and
with rCNT2 treated with DMAT (10 μM, 2 h). Cells were fixed, stained for actin with Texas Red-conjugated phalloidin and visualized by confocal microscopy. Actin is stained red, and YFP-tagged
rCNT2 mutants are stained green. (D) Fluorescence intensity ratio (apical/basolateral) of rCNT2 constructs in transiently transfected MDCK II. A ratio of >1 implies apical preference, and a ratio of 1
indicates homogeneous distribution. Statistical significance was assessed using Student’s t test: ***P < 0.001; **P < 0.01; *P < 0.05 relative to a ratio of 1.
particularly considering the important role CNT2 might also play
in the clinical setting.
AUTHOR CONTRIBUTION
Itziar Pinilla-Macua designed and performed the experiments, analysed the data and wrote
the paper. Javier Casado provided statistical support and experimental supervision. Marçal
Pastor-Anglada supervised data analysis and writing of the paper.
ACKNOWLEDGEMENTS
We thank the technical support of Mrs Ingrid Iglesias (CIBER-EHD) and the help of Dr
Maria Calvo (Centres Cientı́fics I Tècnics, University of Barcelona) in confocal microscopy
analysis.
FUNDING
This study was supported by the Ministerio de Ciencia e Innovación [grant numbers
SAF2008-00577 and SAF2011-23660] and Generalitat de Catalunya [grant number
2009SGR624]. The laboratory belongs to the Biomedical Research Institute Network:
Liver and Gastrointestinal Diseases (CIBER-EHD). CIBER is an initiative of the Instituto de
Salud Carlos III (Ministerio de Ciencia e Innovación). I.P.M. was funded by Ministerio
de Ciencia e Innovación (MICINN) and CIBER-EHD.
c The Authors Journal compilation c 2012 Biochemical Society
REFERENCES
1 Soler, C., Garcia-Manteiga, J., Valdes, R., Xaus, J., Comalada, M., Casado, F.J.,
Pastor-Anglada, M., Celada, A. and Felipe, A. (2001) Macrophages require different
nucleoside transport systems for proliferation and activation. FASEB J. 15, 1979–1988
2 Soler, C., Valdes, R., Garcia-Manteiga, J., Xaus, J., Comalada, M., Casado, F. J.,
Modolell, M., Nicholson, B., Macleod, C., Felipe, A. et al. (2001)
Lipopolysaccharide-induced apoptosis of macrophages determines the up-regulation of
concentrative nucleoside transporters Cnt1 and Cnt2 through tumor necrosis
factor-α-dependent and -independent mechanisms. J. Biol. Chem. 276, 30043–30049
3 Valdes, R., Ortega, M. A., Casado, F. J., Felipe, A., Gil, A., Sanchez-Pozo, A. and
Pastor-Anglada, M. (2000) Nutritional regulation of nucleoside transporter expression in
rat small intestine. Gastroenterology 119, 1623–1630
4 Duflot, S., Calvo, M., Casado, F. J., Enrich, C. and Pastor-Anglada, M. (2002)
Concentrative nucleoside transporter (rCNT1) is targeted to the apical membrane through
the hepatic transcytotic pathway. Exp. Cell Res. 281, 77–85
5 Govindarajan, R., Endres, C. J., Whittington, D., Lecluyse, E., Pastor-Anglada, M., Tse,
C. M. and Unadkat, J. D. (2008) Expression and hepatobiliary transport characteristics of
the concentrative and equilibrative nucleoside transporters in sandwich-cultured human
hepatocytes. Am. J. Physiol. Gastrointest. Liver Physiol. 295, G570–G580
6 Mangravite, L. M., Badagnani, I. and Giacomini, K. M. (2003) Nucleoside transporters in
the disposition and targeting of nucleoside analogs in the kidney. Eur. J. Pharmacol. 479,
269–281
rCNT2 N-terminal tail is involved in its sorting to plasma membrane
7 Lai, Y., Bakken, A. H. and Unadkat, J. D. (2002) Simultaneous expression of hCNT1–CFP
and hENT1–YFP in Madin–Darby canine kidney cells: localization and vectorial transport
studies. J. Biol. Chem. 277, 37711–37717
8 Errasti-Murugarren, E., Pastor-Anglada, M. and Casado, F. J. (2007) Role of CNT3 in the
transepithelial flux of nucleosides and nucleoside-derived drugs. J. Physiol. 582,
1249–1260
9 Rodriguez-Mulero, S., Errasti-Murugarren, E., Ballarin, J., Felipe, A., Doucet, A., Casado,
F. J. and Pastor-Anglada, M. (2005) Expression of concentrative nucleoside transporters
SLC28 (CNT1, CNT2, and CNT3) along the rat nephron: effect of diabetes. Kidney Int. 68,
665–672
10 Vitzthum, H., Weiss, B., Bachleitner, W., Kramer, B. K. and Kurtz, A. (2004) Gene
expression of adenosine receptors along the nephron. Kidney Int. 65, 1180–1190
11 Fernandez-Veledo, S., Huber-Ruano, I., Aymerich, I., Duflot, S., Casado, F. J. and
Pastor-Anglada, M. (2006) Bile acids alter the subcellular localization of CNT2
(concentrative nucleoside cotransporter) and increase CNT2-related transport activity in
liver parenchymal cells. Biochem. J. 395, 337–344
12 Aymerich, I., Foufelle, F., Ferré, P., Casado, F. J. and Pastor-Anglada, M. (2006)
Extracellular adenosine activates AMP-dependent protein kinase (AMPK). J. Cell Sci.
119, 1612–1621
13 Huber-Ruano, I., Pinilla-Macua, I., Torres, G., Casado, F. J. and Pastor-Anglada, M.
(2010) Link between high-affinity adenosine concentrative nucleoside transporter-2
(CNT2) and energy metabolism in intestinal and liver parenchymal cells. J. Cell. Physiol.
225, 620–630
14 Aymerich, I., Pastor-Anglada, M. and Casado, F. J. (2004) Long term endocrine regulation
of nucleoside transporters in rat intestinal epithelial cells. J. Gen. Physiol. 124, 505–512
15 Del Santo, B., Valdes, R., Mata, J., Felipe, A., Casado, F. J. and Pastor-Anglada, M.
(1998) Differential expression and regulation of nucleoside transport systems in rat liver
parenchymal and hepatoma cells. Hepatology 28, 1504–1511
16 Errasti-Murugarren, E., Molina-Arcas, M., Casado, F. J. and Pastor-Anglada, M. (2009) A
splice variant of the SLC28A3 gene encodes a novel human concentrative nucleoside
transporter-3 (hCNT3) protein localized in the endoplasmic reticulum. FASEB J. 23,
172–182
17 Sun, A. Q., Salkar, R., Sachchidanand, R., Xu, S., Zeng, L., Zhou, M. M. and Suchy, F. J.
(2003) A 14-amino acid sequence with a β-turn structure is required for apical membrane
sorting of the rat ileal bile acid transporter. J. Biol. Chem. 278, 4000–4009
18 Ahmed, K., Gerber, D. A. and Cochet, C. (2002) Joining the cell survival squad: an
emerging role for protein kinase CK2. Trends Cell Biol. 12, 226–230
19 Lim, A. C., Tiu, S. Y., Li, Q. and Qi, R. Z. (2004) Direct regulation of microtubule dynamics
by protein kinase CK2. J. Biol. Chem. 279, 4433–4439
20 Niefind, K., Raaf, J. and Issinger, O. G. (2009) Protein kinase CK2 in health and disease:
protein kinase CK2: from structures to insights. Cell. Mol. Life Sci. 66, 1800–1816
21 Roosbeek, S., Peelman, F., Verhee, A., Labeur, C., Caster, H., Lensink, M. F., Cirulli, C.,
Grooten, J., Cochet, C., Vandekerckhove, J. et al. (2004) Phosphorylation by protein
kinase CK2 modulates the activity of the ATP binding cassette A1 transporter. J. Biol.
Chem. 279, 37779–37788
22 Bone, D. B., Robillard, K. R., Stolk, M. and Hammond, J. R. (2007) Differential regulation
of mouse equilibrative nucleoside transporter 1 (mENT1) splice variants by protein kinase
CK2. Mol. Membr. Biol. 24, 294–303
525
23 Sarker, R., Gronborg, M., Cha, B., Mohan, S., Chen, Y., Pandey, A., Litchfield, D.,
Donowitz, M. and Li, X. (2008) Casein kinase 2 binds to the C terminus of Na + /H +
exchanger 3 (NHE3) and stimulates NHE3 basal activity by phosphorylating a separate
site in NHE3. Mol. Biol. Cell 19, 3859–3870
24 Harris, M. J., Kagawa, T., Dawson, P. A. and Arias, I. M. (2004) Taurocholate transport by
hepatic and intestinal bile acid transporters is independent of FIC1 overexpression in
Madin–Darby canine kidney cells. J. Gastroenterol. Hepatol. 19, 819–825
25 Li, J. Y., Boado, R. J. and Pardridge, W. M. (2001) Differential kinetics of transport of
2 ,3 -dideoxyinosine and adenosine via concentrative Na + nucleoside transporter CNT2
cloned from rat blood–brain barrier. J. Pharmacol. Exp. Ther. 299, 735–740
26 Errasti-Murugarren, E., Casado, F. J. and Pastor-Anglada, M. (2010) Different N-terminal
motifs determine plasma membrane targeting of the human concentrative nucleoside
transporter 3 in polarized and nonpolarized cells. Mol. Pharmacol. 78, 795–803
27 Mangravite, L. M. and Giacomini, K. M. (2003) Sorting of rat SPNT in renal epithelium is
independent of N-glycosylation. Pharm. Res. 20, 319–323
28 Scott, G. K., Fei, H., Thomas, L., Medigeshi, G. R. and Thomas, G. (2006) A PACS-1,
GGA3 and CK2 complex regulates CI-MPR trafficking. EMBO J. 25, 4423–4435
29 Shi, X., Potvin, B., Huang, T., Hilgard, P., Spray, D. C., Suadicani, S. O., Wolkoff, A. W.,
Stanley, P. and Stockert, R. J. (2001) A novel casein kinase 2 α-subunit regulates
membrane protein traffic in the human hepatoma cell line HuH-7. J. Biol. Chem. 276,
2075–2082
30 Bonifacino, J. S. and Traub, L. M. (2003) Signals for sorting of transmembrane proteins
to endosomes and lysosomes. Annu. Rev. Biochem. 72, 395–447
31 Owen, R. P., Gray, J. H., Taylor, T. R., Carlson, E. J., Huang, C. C., Kawamoto, M., Johns,
S. J., Stryke, D., Ferrin, T. E. and Giacomini, K. M. (2005) Genetic analysis and functional
characterization of polymorphisms in the human concentrative nucleoside transporter,
CNT2. Pharmacogenet. Genomics 15, 83–90
32 Kirchhausen, T., Macia, E. and Pelish, H. E. (2008) Use of dynasore, the small molecule
inhibitor of dynamin, in the regulation of endocytosis. Methods Enzymol. 438, 77–93
33 Wolff, S. C., Qi, A. D., Harden, T. K. and Nicholas, R. A. (2010) Charged residues in the
C-terminus of the P2Y1 receptor constitute a basolateral-sorting signal. J. Cell Sci. 123,
2512–2520
34 Duflot, S., Riera, B., Fernandez-Veledo, S., Casado, V., Norman, R. I., Casado, F. J., Lluis,
C., Franco, R. and Pastor-Anglada, M. (2004) ATP-sensitive K + channels regulate the
concentrative adenosine transporter CNT2 following activation by A1 adenosine receptors.
Mol. Cell. Biol. 24, 2710–2719
35 Zuzarte, M., Rinne, S., Schlichthorl, G., Schubert, A., Daut, J. and Preisig-Muller, R.
(2007) A di-acidic sequence motif enhances the surface expression of the potassium
channel TASK-3. Traffic 8, 1093–1100
36 Andersen, M. N., Olesen, S. P. and Rasmussen, H. B. (2011) Kv7.1 surface expression is
regulated by epithelial cell polarization. Am. J. Physiol. Cell. Physiol. 300, C814–C824
37 Krasnov, K. V., Tzetis, M., Cheng, J., Guggino, W. B. and Cutting, G. R. (2008)
Localization studies of rare missense mutations in cystic fibrosis transmembrane
conductance regulator (CFTR) facilitate interpretation of genotype–phenotype
relationships. Hum. Mutat. 29, 1364–1372
38 Andersen, M. N., Krzystanek, K., Jespersen, T., Olesen, S. P. and Rasmussen, H. B. (2012)
AMP-activated protein kinase downregulates Kv7.1 cell surface expression. Traffic 13,
143–156
Received 4 April 2011/25 November 2011; accepted 2 December 2011
Published as BJ Immediate Publication 2 December 2011, doi:10.1042/BJ20110605
c The Authors Journal compilation c 2012 Biochemical Society
Biochem. J. (2012) 442, 517–525 (Printed in Great Britain)
doi:10.1042/BJ20110605
SUPPLEMENTARY ONLINE DATA
Structural determinants for rCNT2 sorting to the plasma membrane
of polarized and non-polarized cells
Itziar PINILLA-MACUA, F. Javier CASADO and Marçal PASTOR-ANGLADA1
Department of Biochemistry and Molecular Biology, Institute of Biomedicine (IBUB), University of Barcelona, Barcelona, Spain, and Biomedical Centre for Investigation into Hepatic and
Digestive Diseases (CIBER-EHD), University of Barcelona, Barcelona, Spain
Table S1
Expression ratio of all rCNT2-derived constructs in CHO-K1 and MDCK II cell lines
The expression ratio is measured as the fluorescence intensity ratio of constructs in relation to rCNT2 control using flow cytometry assays. Statistical significance was assessed using Student’s
t test. P < 0.05 were considered significant.
CHO-K1 cell line
MDCK II cell line
Construct
Expression ratio
S.E.M
Difference relative to control
rCNT2
rCNT2-20AA
rCNT2-37AA
rCNT2-48AA
rCNT2D
rCNT2-NPG
rCNT2-E16G
rCNT2-E25G
rCNT2-E28G
rCNT2-E25G/E28G
rCNT2-E16G/E25G/E28G
rCNT2-E25Q/E28Q
rCNT2-S46G
rCNT2-S46E
rCNT2-S46D
1.00
1.05
0.89
0.85
0.99
1.06
1.06
0.87
2.45
0.54
0.94
0.98
1.10
1.13
1.05
0.00
0.10
0.09
0.05
0.11
0.09
0.10
0.12
0.75
0.04
0.11
0.09
0.05
0.07
0.11
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P < 0.05
P < 0.001
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
Expression ratio
S.E.M
Difference relative to control
1.00
0.94
0.99
0.91
0.89
1.03
0.00
0.12
0.06
0.10
0.03
0.04
P > 0.05
P > 0.05
P > 0.05
P > 0.05
P > 0.05
0.44
0.07
P < 0.05
0.93
0.85
1.02
0.07
0.12
0.16
P > 0.05
P > 0.05
P > 0.05
Received 4 April 2011/25 November 2011; accepted 2 December 2011
Published as BJ Immediate Publication 2 December 2011, doi:10.1042/BJ20110605
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2012 Biochemical Society