Download Molecular cloning, characterization and gene expression of an

Fish & Shellfish Immunology 32 (2012) 670e682
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology
journal homepage: www.elsevier.com/locate/fsi
Molecular cloning, characterization and gene expression of an antioxidant
enzyme catalase (MrCat) from Macrobrachium rosenbergii
Jesu Arockiaraj a, Sarasvathi Easwvaran a, Puganeshwaran Vanaraja a, Arun Singh b,
Rofina Yasmin Othman a, Subha Bhassu a, *
a
Centre for Biotechnology in Agriculture Research, Division of Genetics & Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya,
50603 Kuala Lumpur, Malaysia
Centre for Aquaculture Research and Extension, St. Xavier’s College (Autonomous), Palayamkottai, Tamil Nadu 627002, India
b
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 15 November 2011
Received in revised form
7 January 2012
Accepted 13 January 2012
Available online 21 January 2012
In this study, we reported a full length of catalase gene (designated as MrCat), identified from the
transcriptome database of freshwater prawn Macrobrachium rosenbergii. The complete gene sequence of
the MrCat is 2504 base pairs in length, and encodes 516 amino acids. The MrCat protein contains three
domains such as catalase 1 (catalase proximal heme-ligand signature) at 350-358, catalase 2 (catalase
proximal active site signature) at 60-76 and catalase 3 (catalase family profile) at 20-499. The mRNA
expressions of MrCat in healthy and the infectious hypodermal and hematopoietic necrosis virus (IHHNV)
challenged M. rosenbergii were examined using quantitative real time polymerase chain reaction (qRTPCR). The MrCat is highly expressed in digestive tract and all the other tissues (walking leg, gills, muscle,
hemocyte, hepatopancreas, pleopods, brain and eye stalk) of M. rosenbergii taken for analysis. The
expression is strongly up-regulated in digestive tract after IHHNV challenge. To understand its biological
activity, the recombinant MrCat gene was constructed and expressed in Escherichia coli BL21 (DE3). The
recombinant MrCat existed in high thermal stability and broad spectrum of pH, which showed over 95%
enzyme activity between pH 5 and 10.5, and was stable from 40 C to 70 C, and exhibited 85e100%
enzyme activity from 30 C to 40 C.
Ó 2012 Elsevier Ltd. All rights reserved.
Keywords:
Catalase
Macrobrachium rosenbergii
IHHNV
Gene expression
Protein characterization
1. Introduction
Antioxidant enzymes play a major role in protecting organisms
from the potentially deleterious effects of oxidative stress and have
been implicated in pathophysiological processes such as cancer
and aging [1e3]. Oxidative stress causes damage to various organs,
and it was recently reported that reactive oxygen species are
involved in Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis [4]. Reactive oxygen is not only the cause of
such diseases, but it is also used to signal processes such as
apoptosis [5], life span determination [6], cell differentiation [7,8]
and pathogen defense [9].
The physiological level of reactive oxygen species (ROS) is
maintained by an antioxidant defense system. A major component
of the antioxidant defense system consists of three types of primary
antioxidant enzymes, including the superoxide dismutases (SODs),
catalases, and peroxidases. The first line of defense against ROS
* Corresponding author. Tel.: þ60 3 79675829; fax: þ60 3 79675908.
E-mail address: [email protected] (S. Bhassu).
1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2012.01.013
includes the enzymatic activity of SOD, which catalyzes the
disproportionation of superoxide to hydrogen Peroxide (H2O2) and
water [10,11]. The second involves removal of hydrogen peroxide to
water and oxygen, which, in most cells, is normally achieved by
catalase and various peroxidases [12,13]. Catalase is a more significant H2O2 scavenger at a higher steady-state concentration [14,15].
Hydrogen peroxide, superoxides and hydroxyl radicals are
formed unavoidably during aerobic metabolism. All aerobic
organisms have enzymatic and non-enzymatic detoxification
systems to combat reactive oxygen. Catalase is a key antioxidant
enzyme present in virtually all aerobic organisms. Catalase is one of
the most potent catalysts known and its function is crucial to life.
Catalase catalyzes conversion of H2O2, a powerful and potentially
harmful oxidizing agent to water and molecular oxygen. Catalase
also uses H2O2 to oxidize toxins including phenols, formic acid,
formaldehyde and alcohols [16]. Catalase has one of the highest
turnover numbers of all enzymes; one catalase molecule can
convert 40 million molecules of H2O2 to water and oxygen each
second [17]. Catalases, superoxide dismutases and peroxidases
have a central role in enzymatic detoxification [18].
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
Catalases are the most important enzymes to degrade H2O2, and
they are classified into three separate families: Mn-catalases [19],
catalase-peroxidases and mono-functional catalases. The monofunctional catalases are the best characterized, and they are homo
tetrameric and heme-containing enzymes. As catalases are found in
organisms from eubacteria to eukaryotes [9,20e26], they are
essential, strongly expressed, and tightly regulated [27]. Catalase
comprises four ferriphotophorphyrin groups per molecule, and its
enzymatic activity in tissues varies greatly [28,29]. Each monomer
harbors a single heme and nicotinamide adenine dinucleotide
phosphate (NADPH). The NADPH is bound on the surface of each
monomer by 12 amino acid residues [30] and protects the enzyme
from oxidation by its H2O2 substrate. However, phagocytosis
increases the consumption of oxygen and induces the production of
ROS [31].
Catalase is a very highly conserved enzyme that has been
identified from numerous species including bacteria, fungi, plants
and animals. This enzyme is ubiquitous and present in archaea [22],
prokaryotes and eukaryotes [32e35]. To date, much information
about the structure and regulation of catalase genes and proteins
has been accumulated in mammals [36,37], plants [38] and bacteria
[39]. Antioxidant related enzymes, including catalase, are known to
be involved in crustaceans’ innate immune reaction [40e43]. It is
reported [41,44] that white spot syndrome virus (WSSV) infection
decreased the activity of antioxidant enzymes including catalase in
Fenneropenaeus indicus and also [42] that the activity of catalase
changed in Penaeus monodon after WSSV infection. However, the
genetic information about catalase in freshwater giant prawn
Macrobrachium rosenbergii is very limited.
In our earlier findings, we reported [45,46] that freshwater giant
prawn M. rosenbergii industry is affected all over the World due to
various viral and bacterial pathogens. However, infectious diseases
mainly, infectious hypodermal and hematopoietic necrosis virus
(IHHNV) have affected the M. rosenbergii industry enormously.
Thus, research into freshwater prawn defense mechanisms is
important to develop disease control strategies, but the detailed
functions and characterization of immune genes in M. rosenbergii
are poorly understood. Since the antioxidant related enzymes,
including catalase, are known to be involved in crustaceans’ innate
immune reaction, we obtained a full-length antioxidant enzyme,
catalase gene from the constructed M. rosenbergii transcriptome
unigenes by Illumina’s Solexa sequencing technology. In this study
we characterized full-length catalase gene from M. rosenbergii
(designated as MrCat), at molecular level and investigated the
related mRNA expression profile after IHHNV infection and in
addition to the functional activities of purified recombinant MrCat.
The results of this article will assist subsequent research on the
adaptive responses of M. rosenbergii to conditions of oxidative
stress and environmental toxicity.
2. Materials and methods
671
technology. Briefly, unigenes obtained from the assembly of the
Illumina Solexa short reads from the RNA sequencing of the muscle,
gill and hepatopancreas transcriptomes of M. rosenbergii were
mined for sequences which had been identified as catalase gene
through BLAST homology search against the NCBI database (http://
blast.ncbi.nlm.nih.gov/Blast).
2.3. Bioinformatic analysis
The full-length MrCat sequence was compared with other
sequences available in NCBI database and the similarities were
analyzed. The open reading frame (ORF) and amino acid sequence
of MrCat was obtained by using DNAssist 2.2. Characteristic
domains or motifs were identified using the PROSITE profile database [47]. Identity, similarity and gap percentages were calculated
using FASTA program [48]. The N-terminal transmembrane
sequence was determined by DAS transmembrane prediction
program (http://www.sbc.su.se/wmiklos/DAS). Signal peptide
analysis was done using the SignalP worldwide P server (http://
www.cbs.dtu.dk). Pair-wise and multiple sequence alignment
were analyzed using the ClustalW version 2 program [49]. The
phylogenetic relationship of MrCat was determined using the
Neighbor-Joining (NJ) Method and PHYLIP (3.69). The presumed
tertiary structures were established for MrCat [50] using the
SWISS-MODEL prediction algorithm (http://swissmodel.expasy.
org/).
2.4. Gene expression analysis of MrCat mRNA after IHHNV infection
For IHHNV induced mRNA expression analysis, the prawns were
injected with IHHNV, as described by Dhar et al. [51]. Briefly, IHHNV
infected prawn tail tissue, tested positive by nested PCR was
homogenized in sterile 2% NaCl (1:10, w/v) solution and centrifuged in a tabletop centrifuge at 5000 rpm for 5 min at 4 C. The
supernatant was filtered through 0.45 mm filter and used for
injecting (100 ml per 10 g prawn) the animals. Samples were
collected before (0 h), and after injection (3, 6, 12, 24 and 48 h) and
were immediately snap-frozen in liquid nitrogen and stored
at 80 C until the total RNA was isolated. Using a sterilized syringe,
the hemolymph (0.2e0.5 mL per prawn) was collected from the
prawn heart and immediately centrifuged at 3000 g for 10 min at
4 C to allow hemocyte collection for total RNA extraction. Tissue
homogenate prepared from healthy tail muscle served as control.
All samples were analyzed in three duplications and the results are
expressed as relative fold of one sample as mean standard
deviation.
2.5. Total RNA isolation and cDNA conversion
Total RNA was isolated from the tissues of each animal using
TRI Reagent following manufacturer’s protocol (Guangzhou
2.1. M. rosenbergii
Healthy prawns (average body weight 10 g) were obtained from
the Bandar Sri Sendayan, Negeri Sembilan, Malaysia. Prawns were
maintained in flat-bottomed glass tanks (300 L) with aerated and
filtered freshwater at 28 1 C in the laboratory. All prawns were
acclimatized for 1 week before challenge to IHHNV. A maximum of
15 prawns per tank were maintained during the experiment.
Table 1
Details of primers used in this study.
Name
Target
Sequence (50 -30 direction)
MrCat (F1)
MrCat (R2)
b-actin (F3)
ACTACAACCAGGAAAGTGCTCCCA
TGGCGTTCCTCTTCGTTCATGACT
ACCACCGAAATTGCTCCATCCTCT
2.2. Identification of full-length MrCat
MrCat (F5)
qRT-PCR amplification
qRT-PCR amplification
qRT-PCR internal
control
qRT-PCR internal
control
ORF amplification
A full-length MrCat gene was identified from the M. rosenbergii
transcriptome unigenes obtained by Illumina’s Solexa sequencing
MrCat (R6)
ORF amplification
b-actin (R4)
ACGGTCACTTGTTCACCATCGGCATT
GAGAGAgaattcTCAGAAGAGGAACCC
AGCAACACA EcoRI
GAGAGActgcag ATGGCGATGGGTGTC
ATTGTAGGA PstI
Fig. 1. Nucleotide and deduced amino acid sequences of M. rosenbergii catalase (MrCat). The nucleotide sequence is numbered from 50 end, and the single letter amino acid code is
shown below the corresponding codon. The start codon (ATG) and the end codon (TAA) is bolded. In amino acid sequence, the catalase family profile (catalase 3) is available
between 20 and 499 and it is highlighted in gray color. The termination code is marked with an asterisk.
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
673
Fig. 1. (continued).
Dongsheng Biotech, China). Total RNA was treated with RNase free
DNA set (5 Prime GmbH, Hamburg, Germany) to remove the
contaminating DNA. The total RNA concentration was measured
spectrophotometrically (NanoVue Plus Spectrophotometer, GE
Healthcare UK Ltd., England). First-strand cDNA was synthesized
from total RNA by M-MLV reverse transcriptase (Promega, USA)
following the manufacturer’s protocol with AOLP primer
(50 GGCCACGCGTCGACTAGTAC(T)16(A/C/G)30 ).
Table 1. After the PCR program, data were analyzed with ABI 7500
SDS software (Applied Biosystems). To maintain consistency, the
baseline was set automatically by the software. The comparative
CT method (2ddCT method) was used to analyze the expression
level of MrCat [52].
2.6. qRT-PCR analysis of MrCat
All the cloning experiments were carried out according to
Sambrook et al. [53] with slight modifications [45]. The primer
set of MrCat was designed with the corresponding restriction
enzyme sites for EcoRI and PstI at the N- and C-termini respectively (Table 1) in order to clone the coding sequence into the
expression vector, pMAL-c2X (New England Biolabs UK Ltd,
United Kingdom). Using plasmid DNA of MrCat as a template and
Taq DNA polymerase (Invitrogen BioServices India Pvt. Ltd.,
Bangalore, India), PCR was carried out to amplify the coding
sequence. The PCR product was purified using the QIAquick Gel
Extraction Kit (QIAGEN India Pvt. Ltd., New Delhi, India). Then,
both insert and vector were digested with the respective
restriction enzymes. The ligated product was transformed into
XL1 blue cells and the correct recombinant product (as confirmed
by restriction enzyme digestion and sequencing) was transformed into competent Escherichia coli BL21 (DE3) cells for
protein expression.
The relative expression of MrCat in the hemocytes, pleopods,
walking legs, eye stalk, gill, hepatopancreas, stomach, intestine,
brain and muscle were measured by quantitative real time polymerase chain reaction (qRT-PCR). qRT-PCR was carried out using
a ABI 7500 Real time Detection System (Applied Biosystems) in
20 ml reaction volume containing 4 ml of cDNA from each tissue,
10 ml of Fast SYBRÒ Green Master Mix, 0.5 ml of each primer
(20 pmol/ml) and 5 ml dH2O. The qRT-PCR cycle profile was 1 cycle
of 95 C for 10 s, followed by 35 cycles of 95 C for 5 s, 58 C for
10 s and 72 C for 20 s and finally 1 cycle of 95 C for 15 s, 60 C for
30 s and 95 C for 15 s. The same qRT-PCR cycle profile was used
for the internal control gene, b-actin. The b-actin primers were
designed based on EST of 1357 bp (GenBank Accession No.
AY651918) from M. rosenbergii. The primer details of gene specific
primer (MrCat) and internal control (b-actin) are presented in
2.7. Cloning of MrCat gene into the pMAL expression vector
system
Fig. 2. Multiple sequence alignments of M. rosenbergii catalase with five other homologous catalase amino acid sequences. Catalase of fleshy prawn F. chinensis (ABW82155), Pacific white shrimp
L. vannamei (AAR99908), mud crab S. paramamosain (ACX46120), gazami crab P. trituberculatus (ACI13850) and pearl oyster P. fucata (ADW08700) are shown. Asterisk marks indicate identical
amino acids and numbers to the right indicate the amino acid position of catalase in the corresponding species. Conserved substitutions are indicated by (:) and semi-conserved substitutions are
indicated by (.). Deletions are indicated by dashes. GenBank accession numbers for the amino acid sequences of catalase given in the parentheses. The proximal active site signature (FDRERIPERVVHAKGAGA) is highlighted in green color. The proximal heme-ligand signature (RLFSYNDT) is highlighted in blue color. The conserved catalytic amino acids (His71, Asn144 and Tyr354) are
boxed in blue color. Peroxysome targeting signal (AKL) is boxed in red color. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
675
Fig. 2. (continued).
2.8. Induction of recombinant MrCat protein expression in E. coli
BL21
Transformed E. coli BL21 (DE3) cells were incubated in ampicillin (100 mg/mL) Luria broth (LB) overnight. This culture was then
used to inoculate 100 mL of LB broth in 0.2% glucose-rich medium
with ampicillin at 37 C until cell density reached 0.7 at OD600.
E. coli BL21 (DE3) harboring pMAL-c2x-MrCat was induced for over
expression with 1 mM isopropyl-b-thiogalactopyranoside (IPTG)
and incubated at 15 C for 4 h. Cells were harvested by centrifugation (4000 g for 20 min at 4 C). E. coli BL21 (DE3) uninduced
culture was used as a negative control. Then the cells were resuspended in column buffer (TriseHCl, pH 7.4, 200 mM NaCl) and
frozen at 20 C overnight. After thawing on ice, cells were disrupted by sonication. The crude MrCat fusion protein fused with
maltose binding protein (MBP) was purified using pMALÔ protein
fusion and purification system protocol (New England Biolabs UK
Ltd, United Kingdom). Further, DEAE-SepharoseÔ ion exchange
676
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
chromatography method used to purify the recombinant MrCat
protein away from MBP and the protease, and we also provided an
additional purification step for removing trace contaminants
according to the manufacture’s protocol (New England Biolabs UK
Ltd, United Kingdom). Then the purity of the expressed enzyme
was verified by 12% SDS-PAGE and the molecular weight of target
protein was evaluated using protein molecular weight standards.
Proteins were visualized by staining with 0.05% Coomassie blue R250. The concentrations of purified proteins were determined by
the method of Bradford using bovine serum albumin (BSA) as the
standard [54]. The purified enzyme was kept at 80 C until
determination of enzymatic activity.
2.9. Catalase enzyme activity and functional properties of MrCat
Catalase enzyme activity assay and their functional properties
of recombinant MrCat protein (rMrCat) experiments were carried
out according to Aebi [55] with slight modifications [15]. Briefly,
catalase enzyme activity was evaluated by the rate of H2O2
decomposition measured at 240 nm. The purified recombinant
MrCat protein (0.5 mg) was added to 1 mL of 70 mM potassium
phosphate buffer (pH 6.5) containing 15 mM H2O2. The decrease in
absorbance at 240 nm was observed at 30 C. One unit was
defined as the amount of enzyme capable of catalyzing the
degradation of 1 mmol of H2O2 min1. The concentration of protein
was measured following the methodology of Lowry et al. [56]. The
rMrCat enzyme activity was observed at different temperatures
(30 Ce100 C) and pH (3.0e10.5) to find out the optimum
temperature and pH. The acetate, phosphate and glycine-NaOH
buffers were used to adjust the pH. The activity assay was
carried out in three replicates, and the average measurement was
taken for the final calculation.
2.10. Statistics
For comparison of relative MrCat mRNA expression, statistical
analysis was performed using one-way ANOVA and mean
comparisons were performed by Tukey’s Multiple Range Test using
SPSS 11.5 at the 5% significant level.
3. Results
3.1. Identification and sequence analysis of MrCat
A full-length gene MrCat was identified from the M. rosenbergii
transcriptome unigenes obtained by Illumina’s Solexa sequencing
technology. The nucleotide and deduced amino acid structure of
MrCat is given in Fig. 1. The MrCat nucleotide sequence has been
deposited in GenBank under accession number HQ668089. The
complete nucleotide sequence of MrCat is 2504 base pairs (bp),
which consisted of a 50 untranslated region (UTR) of 107 bp, an open
reading frame of 1548 bp encoding 516 amino acid (aa) residues
and a 30 UTR of 849 bp. This putative MrCat amino acid sequence
does not have either signal peptide region or transmembrane
region. The deduced mature MrCat protein had a theoretical mass
of 59 kDa and an isoelectric point of 6.6.
3.2. Bioinformatic analysis of MrCat
Prosite analysis showed that MrCat amino acid contains three
catalase domains. They are catalase 1 (catalase proximal hemeligand signature) at 350-358, catalase 2 (catalase proximal active
site signature) at 60-76 and catalase 3 (catalase family profile) at
20-499 (Fig. 1). There are another 28 high probability motifs which
occurred in the MrCat sequence. They are 2 cAMP and cGMP
dependent protein kinase phosphorylation sites at 15-18 and 412415; 7 casein kinase II phosphorylation sites at 18-21, 121-124, 252255, 281-284, 353-356, 430-433 and 479-482; 6 N-myristoylation
sites at 28-33, 113-118, 117-122, 200-205, 363-368 and 488-493; 1
amidation site at Ile99-gly100-Lys101-Lys102; 6 protein kinase C
phosphorylation sites at 121-123, 163-165, 183-185, 197-199, 215217and 357-359; 5 N-glycosylation sites at 240-243, 355-358, 365368, 435-438 and 477-480 and 1 microbodies C-terminal targeting
signal at Ala514-Lys515-Lue516.
The sequence similarities between MrCat and other catalase
proteins were analyzed using the ClustalW software (Fig. 2). The
length of the amino acid sequences taken for multi sequence
alignment ranged from 505 to 520, except, gazami crab Portunus
trituberculatus (468 aa). There are plenty of identical, conserved
and semi-conserved regions available both in the N terminal as well
as C-terminal region. MrCat exhibited 93% similarity to the catalase
protein from Pacific white shrimp Litopenaeus vannamei (Table 2).
In overall performances of homologous comparisons, all the individuals taken for analysis showed not less than 80% similarity to
MrCat.
The phylogenetic analysis (Fig. 3) shows the relative position of
MrCat in evolution with 27 representative species. Analysis results
show that the MrCat is closely related to catalase from fleshy prawn
Fenneropenaeus chinensis and L. vannamei and formed a sister group
with catalase from mud crab Scylla paramamosain and P. trituberculatus and finally clustered with catalase from rotifer Brachionus plicatilis.
Based on the similarities with other homologous catalase, the
potential tertiary structure of MrCat was established using the
Swiss-model prediction algorithm program. The Swiss-model 3D
structure of MrCat was drawn based on the template ‘1f4jB’ from
Table 2
Amino acid sequence similarities (%) between M. rosenbergii catalase and other
catalase from the closest organisms (gap ¼ 0%).
Species
Molluscs
Pinctada fucata
Cristaria plicata
Chlamys farreri
Anemonia viridis
Crassostrea gigas
Hyriopsis cumingii
Haliotis discus discus
Arthropods
Fenneropenaeus chinensis
Litopenaeus vannamei
Scylla paramamosain
Portunus trituberculatus
Pediculus humanus corporis
Brachionus plicatilis
Aedes aegypti
Daphnia magna
Pisces
Hypophthalmichthys molitrix
Rachycentron canadum
Ctenopharyngodon idella
Takifugu obscurus
Oplegnathus fasciatus
Danio rerio
Aves
Melopsittacus undulatus
Mammals
Mus musculus
Bos taurus
Canis lupus familiaris
Rattus norvegicus
Cavia porcellus
GenBank
accession no.
Amino acid
length
Identity
(%)
Similarity
(%)
ADW08700
ADM64337
ABI64115
AAZ50618
ABS18267
ADL14588
ABF67505
495
495
504
497
506
460
488
73
73
70
71
69
74
71
85
86
84
84
81
87
85
ABW82155
AAR99908
ACX46120
ACI13850
EEB14972
BAH28837
EAT34333
ACU81116
520
501
517
449
484
505
504
495
83
84
82
84
75
71
68
73
92
93
90
90
84
86
82
83
ADJ67807
ACO07305
ACL99859
ABV24056
AAU44617
AAH51626
495
516
495
501
502
495
70
68
70
69
69
69
82
80
82
81
80
82
AAO72713
495
71
83
AAA37373
DAA21837
BAA36420
AAH81853
CAB57222
507
507
507
507
495
69
70
69
69
71
82
81
81
81
83
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
677
Fig. 3. A phylogenetic tree of MrCat with 27 other homologous catalase species was reconstructed by the Neighbor-Joining Method. The tree is based on an alignment corresponding to full-length amino acid sequences, using PHYLIP (3.69). The numbers shown at the branches denote the bootstrap majority consensus values of 1000 replicates. The
GenBank accession number and gene details are given in Table 2.
a tetragonal crystal of human Homo sapiens (homo tetrameric)
erythrocyte catalase. The sequence similarity between the template
and the target is 85.18% (Fig. 4). The root mean square deviation
(rmsd) between MrCat and the template ‘1f4jB’ is 2.40 Å over 463
aligned residues.
3.3. qRT-PCR analysis of MrCat
The MrCat mRNA tissue distribution in healthy M. rosenbergii
and its induction pattern challenged by IHHNV were determined
using quantitative real time PCR. In the healthy tissue, MrCat
expression was significantly (P < 0.05) higher in digestive tract
followed by hemocyte, gills, muscle, pleopods, brain, eye stalk,
walking legs and hepatopancreas (Fig. 5A). Hence, digestive tract
was selected to investigate the temporary expression of MrCat after
IHHNV challenge.
To analyze the expression profile of M. rosenbergii MrCat
during disease challenge, M. rosenbergii were challenged with
IHHNV and the digestive tract was analyzed by quantitative real
time PCR (Fig. 5B). The levels of MrCat mRNA transcripts significantly (P < 0.05) increased at 3 h post-injection (p.i.) and then
a slight decrease of MrCat mRNA expression at 6 h, and again
a slight increase at 12 h and at 24 h followed by a significant
(P < 0.05) decrease in MrCat mRNA expression at 48 h. Significant
differences (P < 0.05) in expression were found at 3, 6, 12, 24 and
48 h post-injection between the IHHNV challenged and the
control group.
3.4. Protein expression and purification of MrCat
The putative mature MrCat molecule was expressed in E. coli
cells after cloning the cDNA into the EcoRI and PstI restriction sites
678
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
Fig. 4. The Swiss-Model 3D structure of M. rosenbergii catalase drawn based on the template ‘1f4jB’ (2.40 Å) from the tetragonal crystals of human Homo sapiens (homo tetrameric)
erythrocyte catalase.
of pMAL-c2x-MrCat expression vector, IPTG driven expression of
MrCat was done in E. coli BL 21 (DE3) cells. The recombinant MrCat
was purified from the supernatant of induced cells. Fig. 6 (lane FP)
shows the result of SDS-PAGE of the recombinant MrCat along with
fusion protein, the recombinant protein gave a major single band
with molecular mass around 101.5 kDa (42.5 kDa for MBP and
59 kDa for MrCat). Further, the recombinant MrCat protein has been
purified from the MBP fusion protein using DEAE-Sepharose ion
exchange chromatography method, and finally the recombinant
MrCat protein showed a single band with molecular weight about
59 kDa (Fig. 6).
3.5. Catalase enzyme activity and functional properties of MrCat
To determine the enzymatic activity of recombinant MrCat
protein, we conducted the enzyme activity assay at various
temperatures and pH. The enzyme activity assay of the recombinant MrCat protein was measured at various temperatures given in
Fig. 7. One hundred percentage relative activities was observed at
30 C and thereafter decreased linearly until 100 C. The thermal
stability of recombinant MrCat protein at various temperatures is
presented in Fig. 8. At 50 C, M. rosenbergii catalase enzyme inactivation was observed for over 30 min. And we also observed the
enzyme inactivation above 50 C. Further, we determined the
optimum pH of recombinant MrCat enzyme activity (Fig. 9). The
optimum pH of the recombinant MrCat was determined to be in
a pH range of 3.0e10.5 by incubating the enzyme at 30 C for
30 min, and pH 7.0 was optimal.
4. Discussion
Catalase is one of the main enzymes of the biological antioxidant system. It plays an important role in the antioxidant defense
pathways [41,42,57e59]. The characterization of catalase and its
role in immunomodulation has been reported widely [34,42,43,60].
The active site of catalase is hemoglobin, and it acts as the catalytic
in the decomposition of H2O2 into water and molecular oxygen, and
prevents lipid peroxidation, protecting the body from injury [61].
M. rosenbergii, which is of great economical importance and known
as ‘freshwater giant prawn’ in the aquaculture industry of South
East Asian countries, has been suffering serious problems in recent
years due to the outbreak of diseases. Understanding the immunity
of freshwater prawn is beneficial of managing diseases and developing sustainable prawn culture. So far, the antioxidant systems of
M. rosenbergii were not been clearly understood. In this study, we
reported an antioxidant enzyme, catalase from M. rosenbergii.
Catalase is ubiquitous in prokaryotes and eukaryotes as a hemoprotein with four identical subunits, the size of subunit in the range
of 460e590 amino acids, and the molecular weight approximately
50e60 kDa [21,32]. In fact, the molecular weight of MrCat was
59 kDa, which was very close to that of vertebrate and invertebrate.
Moreover, several characteristic motifs or signature sequences of
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
679
Fig. 5. Gene expression patterns of MrCat by qRT-PCR. 5A: Tissue distribution of MrCat in different tissues of M. rosenbergii. Data are expressed as a ratio to MrCat mRNA expression
in hepatopancreas. 5B: The time course of MrCat mRNA expression in digestive tract at 0, 3, 6, 12, 24, and 48 h post-injection with IHHNV. Data are expressed as a ratio to MrCat
mRNA in sample from unchallenged control group.
the catalase gene family were also identified in MrCat such as
catalase 1 (catalase proximal heme-ligand signature) at 350-358,
catalase 2 (catalase proximal active site signature) at 60-76 and
catalase 3 (catalase family profile) at 20-499.
Nevertheless, several differences were found in the sequence of
the deduced amino acid sequence of MrCat, it displayed highest
sequence similarities to catalase of L. vannamei. For instance, the
Asn61 (N) residue of catalytic site motif in other invertebrate such as
peal oyster Pinctada fucata was replaced by Asp61 (D) residue in
MrCat, this case was also found in Chinese shrimp F. chinensis [44].
Two glycosylation sites (N145 and N435) were found in MrCat just
the same as F. chinensis [44], but only one (N145) was found in
freshwater mussel Cristaria plicata [35]. The mature catalase
proteins were targeted to the interior of peroxisomes by peroxysome targeting signal (PTS), three amino acids were usually at the
C-terminus of the protein, which served as the PTS [62]. The
prototypic sequence (with many variations) was ‘Ser-Lys-Leu’. This
motif, and its variations, was known in the PTS1 [63]. The PTS were
‘Ala-Asn-Leu’ in human, mouse and rat catalase, ‘Ser-Lys-Met’ in
zebrafish catalase [34], ‘Ala-Asn-Leu’ in saltwater bivalves catalase
[64], ‘Ser-Lys-Thr’ in Penaeus vannamei catalase [65] and ‘Lys-SerLeu’ in C. plicata [35]. However, the C-terminus of MrCat was
‘Ala514-Lys515-Lue516’. Besides for this sequence, its amino acid
composition was consistent with PTS1. This suggested that MrCat
might be also a peroxisomal glycoprotein family.
A phylogenetic tree was constructed using various catalases
from mollusks, arthropods, fishes, bird and mammals to evaluate
the molecular evolutionary relationships of MrCat. It is closely
related to F. chinensis and L. vannamei and formed a sister group
with catalase from S. paramamosain and P. trituberculatus and
finally clustered with catalase from B. plicatilis. Therefore, phylogenetic analysis provides evidence that the MrCat has been derived
from a common ancestor, but remains further extending with the
identification of new catalase genes.
In order to further elucidate the function of MrCat, the
presumed tertiary structure of the molecule was established based
on the template ‘1f4jB’ from a tetragonal crystal of human Homo
sapiens (homo tetrameric) erythrocyte catalase using the Swissmodel prediction algorithm, and the secondary structure
elements were indicated by ‘a’ (a-helix) and ‘b’ (b-sheets). About
52% of MrCat was composed of regular secondary structural motifs,
in which a-helix accounted for 30% and b-sheet for 22%. The
content of a-helix and b-sheet in MrCat was very similar to that of
human catalase (25% a-helix and 14% b-sheet) [30] and Chlamys
farreri (25% a-helix and 18% b-sheet) [34]. As reported by Li et al.
[34] the predicted tertiary structure of MrCat, His71 was to be
neighboring b2, Asn145 was located on b4’, and Tyr357 was speculated to be in a10. These spatial locations of the catalytic residues
were exactly consistent with that in catalase beef [66], human [30]
and C. farreri [34] and catalase A from brewer’s yeast Saccharomyces
cerevisiae [67], and infer that MrCat probably performed its function in the same mechanism as human catalase.
The native expression and localization of MrCat in M. rosenbergii
was investigated at the transcriptional level. Even though MrCat
680
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
Fig. 6. Expression and purification of the recombinant M. rosenbergii catalase protein.
Protein samples were separated by SDS-PAGE and stained with Coomassie brilliant
blue. Un, before induction with IPTG; In, after IPTG induction; FP, purified fusion
protein, M, protein marker and P, purified recombinant protein.
mRNA was found in many tissues, e.g., hepatopancreas, walking
legs, gills, muscle, hemocyte, digestive tract, pleopods, brain and
eye stalk, it was highly expressed in the digestive tract and hence its
expression was analyzed in M. rosenbergii challenged with IHHNV
virus. The results of mRNA expression in digestive tract were
similar with the earlier findings of F. chinensis catalase [44]. These
results suggest that homeostasis of redox controlled by immune
regulated catalase is one of the most crucial factors affecting host
survival during continuous hostemicrobe interaction in the
gastrointestinal tract of flies as described by Zhang et al. [44]. Viral
infection is indeed a stressful process [68,69]. Cellular responses to
stressors are an evolutionary ancient, ubiquitous and essential
mechanism for cell survival. Diseases caused by viruses are the
greatest challenge to worldwide shrimp aquaculture [70]. Levine
et al. [71] reported that microbial elicitors could trigger oxidative
burst, leading to rapid production of reactive oxygen species to
combat and destroy invading microorganisms. Further Lambert
et al. [72] and Liu et al. [73] reported that H2O2, the most stable
reactive oxygen intermediate, is produced to directly contact and
kill pathogenic microorganisms at the early stages of infection, or to
induce cellular protection and defense through certain signal
transduction pathways. During this stage, catalase must be
restricted to a low level to avoid the degradation of H2O2, though
H2O2 also has poisonous effects on M. rosenbergii. The results of
mRNA expression of MrCat after IHHNV challenge indicate the
adverse effect of H2O2 as reported by Li et al. [34]. And also, they
suggested that catalase stringently regulated H2O2 and was
involved in eliminating ROS. The results of the present study also
indicated that MrCat was a constitutive and inducible protein
involved in the host innate immune response through elimination
of H2O2 in M. rosenbergii.
This MrCat sequence was validated by the pMAL-c2x-MrCat
expression vector and expressed in E. coli as fusion protein.
Recombinant MrCat was purified to homogeneity using pMALÔ
protein fusion and purification system. The molecular mass of
protein was about 59 kDa on 12% SDS-PAGE gel, similar to the
earlier reported catalase from C. plicata [35]. The purified
recombinant MrCat protein exhibited catalase enzyme activity. The
recombinant MrCat existed in high thermal stability and broad
spectrum of pH, which showed over 95% enzyme activity between
pH 5 and 10.5, and was stable from 40 C to 70 C, and exhibited
85e100% enzyme activity from 30 C to 40 C, similar to catalase
from Listeria seeligeri and [74] and C. plicata [35]. The results of
catalase enzyme activity assays indicated that the MrCat enzyme
was stable. Murthy et al. [75] reported that the high thermal
stability might be due to the long b-barrel domain containing
a heme moiety in the catalytic site. Similarly, previous report [66]
on beef liver catalase structure revealed that b-barrel domain
with anti-parallel b-sheets supported maintenance of enzymatic
activity at higher temperatures.
In conclusion, we identified a full-length MrCat gene from the
constructed M. rosenbergii transcriptome database. The mRNA
encoding catalase was found in all the tissues tested. The expression of catalase in digestive tract changed rapidly and dynamically
in response to IHHNV infection. The catalase mRNA expression after
infection indicated that it was inducible and might be involved in
the M. rosenbergii immune response. We successfully expressed the
MrCat gene from M. rosenbergii through an E. coli expression vector
and acquired a highly purified protein and showed antioxidant
activity against H2O2. These data would be helpful to understand
the significance of catalase in M. rosenbergii defense system.
Fig. 7. Enzyme activity assay of the recombinant M. rosenbergii catalase was measured at various temperatures.
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
681
Fig. 8. Thermal stability of recombinant M. rosenbergii catalase at various temperatures.
Fig. 9. Percentage relative enzyme activity of recombinant M. rosenbergii catalase at different pH conditions.
Acknowledgments
The authors would like to thank the funding agency ABI (53-0203-1030) for supporting this research. And also University of
Malaya, Kuala Lumpur, Malaysia is gratefully acknowledged for
providing the postdoctoral research fellowship grant to the first
author J. Arockiaraj.
References
[1] Sun Y. Free radicals, antioxidant enzymes, and carcinogenesis. Free Radic Biol
Med 1990;8:583e99.
[2] Sohal RS, Orr WC. Relationship between antioxidants, proxidants, and the
aging process. Ann NY Acad Sci 1992;663:74e84.
[3] Gerhard GS, Kauffman EJ, Grundy MA. Molecular cloning and sequence analysis
of the Danio rerio catalase gene. Comp Biochem Physiol Part B 2000;127:447e57.
[4] Barnham KJ, Masters CL, Bush AI. Neurodegenerative diseases and oxidative
stress. Nat Rev Drug Discov 2004;3:205e14.
[5] Cantara S, Donnini S, Giachetti A, Thorpe PE, Ziche M. Exogenous BH4/Bcl-2
peptide reverts coronary endothelial cell apoptosis induced by oxidative
stress. J Vasc Res 2004;41:202e7.
[6] Droge W. Oxidative stress and aging. Adv Exp Med Biol 2003;543:191e200.
[7] Hansberg W, Aguirre J. Hyperoxidant states cause microbial cell differentiation by cell isolation from dioxygen. J Theor Biol 1990;142:201e21.
[8] Carter AB, Tephly LA, Venkataraman S, Oberley LW, Zhang Y, Buettner GR,
et al. High levels of catalase and GPx activity dampen H2O2 signaling in human
alveolar macrophages. Am J Respir Cell Mol Biol 2004;31:43e53.
[9] Paris S, Wysong D, Debeaupuis JP, Shibuya K, Philippe B, Diamond RD, et al.
Catalases of Aspergillus fumigatus. Infect Immun 2003;71:3551e62.
[10] Fridovich I. Superoxide dismutases. Adv Enzymol Relat Areas Mol Biol 1986;
58:61e97.
[11] Fridovich I. Superoxide radical and superoxide dismutase. Ann Rev Biochem
1995;64:97e112.
[12] Bauer H, Kanzok SM, Schirmer RH. Thioredoxin-2 but not thioredoxin-1 is
a substrate of thioredoxin peroxidase-1 from Drosophila melanogaster. J Biol
Chem 2002;277:17457e63.
[13] Switala J, Loewen PC. Diversity of properties among catalases. Arch Biochem
Biophys 2002;401:145e54.
[14] Chance B, Sies H, Boveris A. Hydrogen peroxide metabolism in mammalian
organs. Physiol Rev 1979;59:527e605.
[15] Kim BY, Kim HJ, Lee KS, Seo SJ, Jin BR. Catalase from the white-spotted flower
chafer, Protaetia brevitarsis: cDNA sequence, expression, and functional
characterization. Comp Biochem Physiol Part B 2008;149:183e90.
[16] Chelikani P, Fita I, Loewen PC. Diversity of structures and properties among
catalases. Cell Mol Life Sci 2004;61:192e208.
[17] Ho YS, Xiong Y, Ma W, Spector A, Ho D. Mice lacking catalase develop normally but show differential sensitivity to oxidant tissue injury. J Biol Chem
2004;279:32804e12.
[18] Muradian KK, Utko NA, Fraifeld V, Mozzhukhina TG, Pishel IN, Litoshenko AY.
Superoxide dismutase, catalase and glutathione peroxidase activities in the
liver of young and old mice: linear regression and correlation. Arch Gerontol
Geriatr 2002;35:205e14.
[19] Igarashi T, Kono Y, Tanaka K. Molecular cloning of manganese catalase from
Lactobacillus plantarum. J Biol Chem 1996;271:29521e4.
[20] Fowler T, Rey MW, Vaha-Vahe P, Power SD, Berka RM. The catR gene encoding
a catalase from Aspergillus niger: primary structure and elevated expression
through increased gene copy number and use of a strong promoter. Mol
Microbiol 1993;9:989e98.
[21] Klotz MG, Klassen GR, Loewen PC. Phylogenetic relationships among
prokaryotic and eukaryotic catalases. Mol Biol Evol 1997;14:951e8.
[22] Kawasaki L, Aguirre J. Multiple catalase genes are differentially regulated in
Aspergillus nidulans. J Bacteriol 2001;183:1434e40.
[23] Diaz A, Rangel P, Montes de Oca Y, Lledias F, Hansberg W. Molecular and
kinetic study of catalase-1, a durable large catalase of Neurospora crassa. Free
Radic Biol Med 2001;31:1323e33.
[24] Scherer M, Wei H, Liese R, Fischer R. Aspergillus nidulans catalase-peroxidase
gene (cpeA) is transcriptionally induced during sexual development through
the transcription factor StuA. Eukaryot Cell 2002;1:725e35.
[25] Michan S, Lledias F, Baldwin JD, Natvig DO, Hansberg W. Regulation and oxidation
of two large monofunctional catalases. Free Radic Biol Med 2002;33:521e32.
[26] Varnado CL, Hertwig KM, Thomas R, Roberts JK, Goodwin DC. Properties of
a novel periplasmic catalase-peroxidase from Escherichia coli O157:H7. Arch
Biochem Biophys 2004;421:166e74.
[27] Hisada H, Hata Y, Kawato A, Abe Y, Akita O. Cloning and expression analysis of
two catalase genes from Aspergillus oryzae. J Biosci Bioeng 2005;99:562e8.
682
J. Arockiaraj et al. / Fish & Shellfish Immunology 32 (2012) 670e682
[28] David M, Munaswamy V, Halappa R, Marigoudar SR. Impact of sodium cyanide
on catalase activity in the freshwater exotic carp, Cyprinus carpio (Linnaeus).
Pestic Biochem Physiol 2008;92:15e8.
[29] Kim J, Kim S, An KW, Choi CY, Lee S, Choi K. Molecular cloning of Daphnia
magna catalase and its biomarker potential against oxidative stresses. Comp
Biochem Physiol Part C 2010;152:263e9.
[30] Putnam CD, Arvai AS, Bourne Y, Tainer JA. Active and inhibited human catalase
structures: ligand and NADPH binding and catalytic mechanism. J Mol Biol
2000;296:295e309.
[31] Smith V, Brown J, Hauton C. Immunostimulation in crustaceans: does it really
protect against infection? Fish Shellfish Immunol 2003;15:71e90.
[32] Kashiwagi A, Kashiwagi K, Takase M, Hanada H, Nakamura M. Comparison of
catalase in diploid and haploid Rana rugosa using heat and chemical inactivation techniques. Comp Biochem Physiol Part B 1997;118:499e503.
[33] Manduzio H, Monsinjon T, Galap C, Leboulenger F, Rocher B. Seasonal variations in antioxidant defences in blue mussels Mytilus edulis collected from
a polluted area: major contributions in gills of an inducible isoform of Cu/Znsuperoxide dismutase and of glutathione S-transferase. Aqua Toxicol 2004;7:
83e93.
[34] Li C, Ni D, Song L, Zhao J, Zhang H, Li L. Molecular cloning and characterization
of a catalase gene from Zhikong scallop Chlamys farreri. Fish Shellfish
Immunol 2008;24:26e34.
[35] Xilan Y, Gang L, Chungen W, Baoqing H, Lirong D, Pengzu P, et al. A catalase
from the freshwater mussel Cristaria plicata with cloning, identification and
protein characterization. Fish Shellfish Immunol 2011;31:389e99.
[36] Mackay M, Bewley GC. The genetics of catalase in Drosophila melanogaster:
isolation and characterization of acatalasemic mutants. Genetics 1989;22:
643e52.
[37] Bryant DD, Wilson GN. Differential evolution and expression of murine
peroxisomal membrane protein genes. Biochem Mol Med 1995;55:22e30.
[38] McClung CR. Regulation of catalases in Arabidopsis. Free Radic Biol Med 1997;
23:489e96.
[39] Storz G, Tartaglia LA. OxyR: a regulator of antioxidant genes. J Nutr 1992;122:
627e30.
[40] Campa-Córdova AI, Hernández-Saaverdra NY, De Philippis R, Ascencio F.
Generation of superoxide anion and SOD activity in hemocytes and muscle of
American white shrimp (Litopenaeus vannameii) as a response to b-glucan and
sulphated polysaccharide. Fish Shellfish Immunol 2002;12:353e66.
[41] Mohankumar K, Ramasamy P. White spot syndrome virus infection decreases
the activity of antioxidant enzymes in Fenneropenaeus indicus. Virus Res 2006;
115:69e75.
[42] Mathew S, Kumar AK, Anandan R, Nair VPG, Devadasan K. Changes in tissue
defence system in white spot syndrome virus (WSSV) infected Penaeus
monodon. Comp Biochem Physiol Part C 2007;145:315e20.
[43] Chongsatja PO, Bourchookarn A, Lo CF, Thongboonkerd V, Krittanai C. Proteomic analysis of differentially expressed proteins in Penaeus vannamei
hemocytes upon Taura syndrome virus infection. Proteomics 2007;7:
3592e601.
[44] Zhang Q, Li F, Zhang X, Dong B, Zhang J, Xie Y, et al. cDNA cloning, characterization and expression analysis of the antioxidant enzyme gene, catalase, of
Chinese shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;24:
584e91.
[45] Arockiaraj J, Vanaraja P, Easwvaran S, Singh A, Alinejaid T, Othman RY, et al.
Gene profiling and characterization of arginine kinase-1 (MrAK-1) from
freshwater giant prawn (Macrobrachium rosenbergii). Fish Shellfish Immunol
2011;31:81e9.
[46] Arockiaraj J, Easwvaran S, Vanaraja P, Singh A, Othman RY, Bhassu S. Prophenoloxidase activating enzyme-III from giant freshwater prawn Macrobrachium rosenbergii: characterization, expression and specific enzyme
activity. Mol Biol Rep 2012;39:1377e86.
[47] Bairoch A, Bucher P, Hofmann K. The PROSITE data base, its status in 1997.
Nucleic Acid Res 1997;25:217e21.
[48] Pearson WR. Rapid and sensitive sequence comparison with FASTP and
FASTA. Meth Enzymol 1990;183:63e98.
[49] Thompson JD, Higgins DG, Gibson TJ. Clustal W: improving the sensitivity of
progressive multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice. Nucleic Acid Res
1994;22:4673e80.
[50] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics
2006;22:195e201.
[51] Dhar AK, Bowers RM, Licon KS, Veazey G, Read B. Validation of reference
genes for quantitative measurement of immune gene expression in shrimp.
Mol Immunol 2009;46:1688e95.
[52] Livak KJ, Schmittgenm TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(Delta Delta C(T)) method. Methods
2001;25:402e8.
[53] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual.
2nd ed. New York: Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press; 1989.
[54] Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of proteinedye binding. Anal
Biochem 1976;72:248e54.
[55] Aebi H. Catalase in vitro. Meths Enzymol 1984;105:121e6.
[56] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the
folin phenol reagent. J Biol Chem 1951;193:265e75.
[57] Bai J, Rodriguez AM, Melendez JA, Cederbaum AI. Overexpression of catalase
in cytosolic or mitochondrial compartment protects HepG2 cells against
oxidative injury. J Biol Chem 1999;274:26217e24.
[58] Garcia MX, Foote C, van Es S, Devreotes PN, Alexander S, Alexander H.
Differential development expression and cell type specificity of Dictyostelium
catalases and their response to oxidative stress and UV-light. Biochim Biophys
Acta 2000;1492:295e310.
[59] Mousa HM, Omer OH, Ali BH, Al-Wabel N, Ahmed SM. Antioxidant levels in
tissues of young and adult camels (Camelus dromedarius). J Physiol Biochem
2006;62:213e8.
[60] Ha EM, Oh CT, Ryu JH, Bae YS, Kang SW, Jang IH, et al. An antioxidant system
required for host protection against gut infection in Drosophila. Dev Cell 2005;
8:125e32.
[61] Nordberg J, Arnér ESJ. Reactive oxygen species, antioxidants, and the
mammalian thioredoxin system. Free Radic Biol Med 2001;31:1287e312.
[62] Keller GA, Krisans S, Gould SJ, Sommer JM, Wang CC, Schliebs W, et al.
Evolutionary conservation of a microbody targeting signal that targets proteins
to peroxisomes, glyoxysomes and glycosomes. J Cell Biol 1991;114:893e904.
[63] Gould GW, Mcwhirter JM, East JM, Lee AG. A model for the uptake and release
of Ca2þ by sarcoplasmic-reticulum. Biochem J 1987;245:739e49.
[64] Ken CF, Lin CT, Wu JL, Shaw JF. Cloning and Expression of a cDNA coding for
catalase from zebrafish (Danio rerio). J Agri Food Chem 2000;48:2092e6.
[65] Tavares-Sánchez OL, Gómez-Anduro GA, Felipe-Ortega X, Islas-Osuna MA,
Sotelo-Mundo RR, Barillas-Mury C, et al. Catalase from the white shrimp
Penaeus (Litopenaeus) vannamei: molecular cloning and protein detection.
Comp Biochem Physiol Part B 2004;138:331e7.
[66] Fita I, Silva AM, Murthy MRN, Rossmann MG. The refined structure of beef
liver catalase at 2.5 Å resolution. Acta Cryst 1986;B42:497e515.
[67] Berthet S, Nykyri LM, Bravo J, Mate MJ, Berthet-colominas C, Alzari PM, et al.
Crystallization and preliminary structural analysis of catalase A from
Saccharomyces cerevisiae. Protein Sci 1997;6:481e3.
[68] Prohaszka Z, Fust G. Immunological aspects of heat-shock proteins-the
optimum stress of life. Mol Immunol 2004;41:29e44.
[69] Dong CW, Zhang YB, Zhang QY, Gui JF. Differential expression of three Paralichthys olivaceus Hsp40 genes in responses to virus infection and heat shock.
Fish Shellfish Immunol 2006;21:146e58.
[70] Huang PY, Kang ST, Chen WY, Hsu TC, Lo CF, Liu KF, et al. Identification of the
small heat shock protein, HSP21, of shrimp Penaeus monodon and the gene
expression of HSP21 is inactivated after white spot syndrome virus (WSSV)
infection. Fish Shellfish Immunol 2008;25:250e7.
[71] Levine A, Tenhaken R, Dixon R, Lamb C. H2O2 from the oxidative burst
orchestrates the plant hypersensitive disease resistance response. Cell 1994;
79:583e93.
[72] Lambert C, Soudant P, Choquet G, Paillard C. Measurement of Crassostrea gigas
hemocyte oxidative metabolism by flow cytometry and the inhibiting
capacity of pathogenic vibrios. Fish Shellfish Immunol 2003;15:225e40.
[73] Liu C, Tseng M, Cheng W. Identification and cloning of the antioxidant
enzyme, glutathione peroxidase, of white shrimp, Litopenaeus vannamei, and
its expression following Vibrio alginolyticus infection. Fish Shellfish Immunol
2007;23:34e45.
[74] Hass A, Brehum K, Kreft J, Goeble W. Cloning, characterization and expression
of Escherichia coli of a gene encoding Listeria seeligeri catalase, a bacterial
enzyme highly homologous to mammalian catalases. J Bacteriol 1991;173:
5159e67.
[75] Murthy MRN, Reid TJ, Sicignano A, Tanaka N, Rossmann MG. Structure of beef
liver catalase. J Mol Biol 1981;152:465e99.