Download Supplementary Information (doc 884K)

Supplementary methods
Construction and production of LV-vectors expressing microRNAs targeting D2 or
Gpr88 mRNA
A set of pre-miRNAs, composed by four different double-stranded oligonucleotides for each
gene, targeting the expression of D2 or Gpr88 (BLOCK-IT™ miR RNAi Select) were
acquired from Invitrogen.
Recombinant expression clones carrying the DNA sequence for stable RNA interference were
produced using the Gateway® Technology (Invitrogen, France). Every pre-miRNA sequence
was cloned into the pcDNATM 6.2-GW / EmGFP-miR expression vector in the 3’ untranslated
region (3’UTR) of the Emerald Green Fluorescent Protein (EmGFP) between the stop codon
and the polyadenylation signal under the drive of a RNA Polymerase II promoter, allowing
for the simultaneous expression of the EmGFP and miRNA. The integrity of each construct
was verified by sequencing and the EmGFP/pre-miRNAs expression cassettes were
transferred to the pTRIP-ΔU3 vector under the control of the cytomegalovirus (CMV)
promoter.1 The most effective among the four miRs in knocking down the expression of the
target gene in primary neuronal cultures from rat striatum was selected and expressed under
the drive of the ubiquitous phosphoglycerate kinase (PGK) promoter, which is well suited for
long term expression of the transgene in neuronal cells.2 The gene targeting sequences of the
selected miRs are as follows:
miR-D2= 5’AAAGATGTCACAGTGAATCCT3’;
miR-Gpr88= 5’AACAACACCAGACCCAAGGCG3’.
High-titer stocks of LV-vectors were generated by calcium phosphate co-precipitation into
HEK-293T cells as previously described.3, 4 The viral particles suspended in PBS buffer were
stored in aliquots at -80 °C until use. The amount of p24 capsid protein was quantified by the
HIV-1 p24 antigen ELISA (Beckman Coulter, France). The efficiency of the selected LV-
miR-Gpr88 and LV-miR-D2 constructs driven by the PGK promoter was confirmed in vitro
and these vectors were used for the subsequent brain injections. Negative controls were
generated maintaining the same construct carrying either a miR without any known target into
the rat genome (LV-miR-control) or the EmGFP alone (LV-EmGFP) under the drive of the
PGK promoter. No significant differences in the targets expression were observed between
these constructions that were, thus, interchangeably used and are collectively referred to as
Control.
Striatum primary neuronal cultures
Primary neuronal cell cultures of striatum that endogenously express D2 and Gpr88 were
prepared from rat embryos (Sprague-Dawley) as previously described.5 After 1 week, the
cells were transduced with the LV-vectors targeting D2 or Gpr88 or the LV-miR-control
vector. The medium was replaced with fresh medium (500 µl/well) 24 h later and cells (3x105
cells/target) were harvested four days after transduction. Total RNAs from striatal primary
cultures were extracted using the RNeasy® Plus Mini Kit (Qiagen, Germany). First-strand
cDNAs were generated from 100 ng of total RNA and Oligo (dT)20 primer with the
SuperScript III First-strand Kit (Life Technologies, Carlsbad, CA) in a total volume of 20 µL.
Laser Capture Microdissection
Rat brain sections (10 µm thick) were used for the retrieval by LCM of EmGFP positive cell
populations using the PixCell®IIe Arcturus® instrument: laser pulses of 7.5 μm diameters,
pulse power 47 mW with 3.7 ms duration. A total of 10-16 consecutive slices were processed
by LCM for each of the 3 experimental conditions (LV-miR-control, LV-miR-Gpr88 and LVmiR-D2) and the respective EmGFP-positive cell populations were pooled. Total RNAs were
extracted (Qiagen Rneasy Micro Kit) from each pool stored in HS-CapSure tubes. After
extraction qualities were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies,
USA); RNA integrity number (RIN) was > 8 for each pool. Aliquots of 10 ng of RNA were
amplified using ExpressArt mRNA linear amplification Nano kit (Amp Tec- Exilone, France)
according to the manufacturer’s protocol. Reverse transcription of 1 μg amplified cRNA was
carried-out with an iScript cDNA Synthesis Kit (Bio-Rad, France).
D2 and Gpr88 transcript quantification assays
cDNAs synthetized from cell cultures or LCM samples were used for quantitative RT-PCR
analysis using the Light Cycler 480 System (Roche, Switzerland) and TaqMan QuantiFast
Probe Assays (Qiagen, Germany) for D2, Gpr88 and Cyclophilin as endogenous control (D2
Probe Assay: Rn_Drd2_FAM_1; Gpr88 Probe Assay: Rn_Gpr88_FAM_1 and Cyclophilin
Probe Assay: Rn_Ppia_MAX_2). Relative gene expression values were obtained using the
2−ΔΔCt method from the data normalized with the Cyclophilin.
In situ hybridization
To generate the Gpr88 riboprobe, total RNA was extracted from rat striatum and reverse
transcribed using SuperScript™ III Reverse Transcriptase (Life Technologies, Carlsbad, CA).
Primer pairs used to amplify Gpr88 cDNAs corresponding to a 1 000 bp fragment
(nucleotides 135–1134) were as follows:
forward primer, 5’GCAGCCTACCGCTTGACTTTTTCTCC;
reverse primer, 5’GTCAAGCGGGTCAGCGTGCT.
The resulting Gpr88 PCR fragment was subcloned into pGEM-T Easy vector (Promega,
Madison, WI), sequenced to confirm identity and used as a probe for in situ hybridization
assay. The eGFP and Gad67 sense and antisense riboprobes were transcribed from the
pGEM®-T easy vector as previously described.1, 6 All plasmids (1 µg/probe) were linearized
and used as templates for the synthesis by T3, T7 or SP6 RNA polymerase (Promega,
Madison, WI) of sense or anti-sense riboprobes, labeled with digoxygenin-11-UTP (Roche,
Switzerland). Brain sections 10 µm-thick were processed for in situ hybridization as
previously described.7 Microscopic images were acquired with a fluorescence microscope
Leica DM5000 B (Leica, Wetzlar, Germany) and digitized using a Leica DFC300 FX Digital
Color Camera.
Double labeling Immunohistochemistry for D2, NeuN, and GFP in the rat brain
Rats were transcardially perfused with 0.1M phosphate-buffered saline (PBS) followed by
ice-cold 1% paraformaldehyde (PFA; in 0.1M PBS). Thereafter, brains were removed and left
overnight in 1% PFA solution, 2 days in a 20% sucrose solution (in 0.1M PBS) and then
rapidly frozen in isopentane (-45 °C). All samples were stored at -80 °C.
Two different methods were used for double immunostainings: a sequential detection of D2
receptor using the tyramide amplification protocol followed by a standard EmGFP labeling;
or a simultaneous double staining of NeuN and EmGFP. Stainings were performed on 14 µm
frozen brain sections collected from a cryostat.
For D2 and EmGFP double labeling, sections were placed in 10mM citrate buffer pH 6 and
micro-waved at 700W for 2.5 min for antigen retrieval. Endogenous activity was blocked by
incubation in 2% H2O2 for 30 min maximum at room temperature (RT). After rinsing in PBSTriton wash buffer (0.1M PBS, 0.2% Triton X-100) for three times, sections were incubated
in TNB Blocking Buffer (0.1M TRIS-HCl, pH 7.5, 0.15M NaCl, 0.5% Blocking Reagent;
Perkin Elmer, Whaltam, Mass.) for 45 min. Afterwards, the primary antibody diluted in TNB
blocking buffer (rabbit antisera against Dopamine receptor D2; Merck Millipore, Billerica,
Mass., 1:500) was applied overnight at 4 °C. After rinsing in PBS-Tween wash buffer (0.1M
PBS, 0.05% (v/v) Tween 20) four times, the sections were incubated with the secondary
antibody diluted in TNB blocking buffer (biotinylated donkey anti-rabbit IgG; GE Healthcare,
Buckingameshire, UK, 1:200) for 1 hour at RT. After rinsing in PBS-Tween wash buffer four
times, sections were incubated in streptavidin peroxydase complex diluted in TNB blocking
buffer (TSA™ Fluorescence Systems; Perkin Elmer, Whaltam, Mass., 1:150) for 30 min at
RT. Subsequently, sections were rinsed in PBS Tween wash buffer three times again, and then
incubated in tetramethyl rhodamine tyramide solution (TSA™ Fluorescence Systems; Perkin
Elmer, Whaltam, Mass., 1:300) for 10 min at RT. After rinsing in PBS Tween wash buffer
three times, sections were incubated in PBS Tween blocking solution (0.1M PBS, 0.05% (v/v)
Tween 20, 10% normal goat serum) for 1 hour at RT. Then, the second primary antibody
(rabbit anti-GFP IgG; Life Technologies, Carlsbad, CA, 1/500 in PBS Tween containing 2%
normal goat serum) was applied overnight at 4°C. After washing in PBS Tween wash buffer
four times, brain sections were treated for 1 hour with the secondary antibody (fluorescein
isothiocyanate labeled goat anti-rabbit IgG, Life Technologies, Carlsbad, CA, 1/2 000 in PBS
Tween containing 2% normal goat serum) at RT.
For the simultaneous detection of NeuN and EmGFP, standard immunohistochemical method,
as described above for the labeling of EmGFP, was performed. The following primary
antibodies were utilized: mouse monoclonal anti-Neuronal nuclei IgG (Merck Millipore,
Billerica, Mass., 1:500) and rabbit anti-GFP IgG (Life Technologies, Carlsbad, CA, 1/500).
This was followed by two secondary antibodies: far-red fluorescent dye labeled goat antimouse IgG (Life Technologies, Carlsbad, CA, 1/2 000) and fluorescein isothiocyanate labeled
goat anti-rabbit IgG (Life Technologies, Carlsbad, CA, 1/2 000).
Finally, after washing in PBS Tween wash buffer four times both D2/EmGFP and
NeuN/EmGFP slides, sections were stained with 4’,6-diamidino-2-phenylindole (DAPI) for
10 min to counterstain cell chromatin. Sections were rinsed in PBS three times again, and then
mounted using Fluorescent Mounting Medium (Dako Cytomation; Dako, Glostrup,
Denmark). Fluorescent staining was visualized using a fluorescence microscope Leica
DM5000 B (Leica, Wetzlar, Germany) and digitized using a Leica DFC300 FX Digital Color
Camera.
Social novelty discrimination task
Adult rats were individually housed for 2 days before testing while juveniles (3 weeks old,
45-50 g on arrival) were group-housed. The experimental protocol was implemented
according to previous studies.8,
9
Briefly, a juvenile (F, familiar) was placed into the adult
home cage for a first presentation period (P1) of 30 min. The time spent by the adult
investigating the juvenile (anogenital sniffing, pursuing, allogrooming) was measured
manually for the first 5 min. At the end of P1, a second juvenile (N, novel) was introduced in
the cage together with the adult and the familiar juvenile, and the times spent by the adult
investigating each juvenile were measured independently for 5 min (presentation period P2).
The discrimination ratio was calculated as the time spent in P2 by the adult with the novel
juvenile over the familiar juvenile. This test allows for measuring a spontaneous social
interaction (total time spent with both juveniles) as well as social discrimination (more
interaction time normally devoted to the novel conspecific).
Supplementary Figures
Supplementary Fig. 1: Gene expression KD efficiency in vitro in primary cultures of rat
striatal neurons. Relative expression ninety-sixty hours following transduction of (a) D2
(0.34 ± 0.11) in LV-miR-D2 and (b) Gpr88 (0.24 ± 0.16) in LV-miR-Gpr88 transduced cells
as compared to the respective expression set to 1 in LV-miR-control transduced cells.
Quantification of mRNA levels was performed by RT-qPCR. All values were normalized to
Cyclophilin as endogenous control and represent mean ± SEM of three technical replicates
per condition.
Supplementary Fig. 2: Immunohistochemical analysis of the LV-miR-D2 injection in the
NAcc. Representative coronal rat brain sections showing: D2 (a), Neuronal Nuclei (NeuN) (d)
and EmGFP (b and e) proteins visualized by immunohistochemistry staining. Doublelabelings (merge, yellow) are depicted in the corresponding right column. The upper panels
show the D2 expression knock-down in the EmGFP-positive region (a, b, c). Infusion of the
LV-miR-D2 in the NAcc does not induce neuronal cytotoxicity as shown by co-localization
between most EmGFP-positive and NeuN-positive cells in the middle panels (d, e, f). The
bottom panels represents the inset’s magnification (g, h, i). Scale bar = 100 µm (upper panels:
10x magnification) and 25 µm (middle panels: 20x magnification). AC, Anterior
Commissure.
Supplementary Table 1: TaqMan® Gene Expression Assays for Duplex RT-qPCR
analysis (gene target: FAM dye; endogenous control (Ppia): VIC dye) supplied by Applied
Biosystems, USA.
Receptors
Intracellular
signaling
molecules
Gene Name
Gene Symbol
Assay ID
G-protein coupled receptor 88
Gpr88
Rn02133938_s1
Dopamine receptor D2
Drd2
Rn00561126_m1
Dopamine receptor D1
Drd1
Rn03062203_s1
Dopamine receptor D3
Drd3
Rn00567568_m1
Adenosine A2a receptor
Adora2a
Rn00583935_m1
Regulator of G-protein signaling 19
Rgs19
Rn00572243_m1
Protein phosphatase 1, regulatory Ppp1r1b
(inhibitor) subunit 1B
Rn01452984_m1
Neuromodulator
Dysbindin domain containing 1
Rn01432426_m1
Endogenous
control
Peptidylprolyl
(cyclophilin A)
isomerase
Dbndd1
A Ppia
Rn00690933_m1
Supplementary Table 2: Effects of the LV-vectors on total interaction time (s) with
juveniles during the social novelty discrimination test in adult rats (PND 67) neonatally
treated with saline or PCP
Neonatal teatment
(PND 7,9,11)
LV-injection
(PND 50)
Drug
Saline
PCP (10mg/Kg; s.c.)
Interaction time
(N)
P1 (s)
P2 (s)
Total (P1+P2)
Control
(12)
131.8 9.00
117.6 9.3
249.3 16.3
miR-D2
(13)
140.5 11.5
113.1 11.3
253.5 20.6
miR-Gpr88
(12)
142.2 14.4
97.9 13.8
240.1 27.7
Control
(12)
135.7 14.7
94.3 12.2
230.0 25.7
miR-D2
(12)
129.3 16.1
106.3 14.4
235.6 30.4
miR-Gpr88
(21)
147.3 5.0
102.6 9.0
249.9 12.5
N = number of rats per group;
P1 = interaction time with one juvenile in the initial 5’ of the 30’ first presentation period
P2 = interaction time with two juveniles (familial and novel) in the 5’ second presentation
period
Data represents mean ± SEM.
Supplementary Table 3: Results of RT-qPCR in Nacc samples for selected genes coding for molecules pertaining to the D2 receptor signaling
complex. The threshold cycle values are reported only for the genes showing a significant difference after D2-KD or Gpr88-KD as compared to
the respective Control in at least one experimental condition. TaqMan gene expression Assays were performed in a duplex reaction with the
probe for the targeted gene and the probe for the endogenous control (Ppia gene coding for Cyclophilin A).
Cyclo= Cyclophilin A (endogenous control).
* P< 0.05 as compare dto the respective Control
Neonatal treatment
Saline
Control
D2-KD
PCP
Gpr88-KD
Control
D2-KD
Gpr88-KD
Genes
Target Cyclo Target Cyclo Target Cyclo Target Cyclo Target Cyclo Target Cyclo
Drd2 (D2)
24.54
21.16 25.25* 21.12
25.14
21.36
24.67
21.18
24.78
21.00
23.51
21.00
Gpr88
24.18
21.24 24.66* 21.18 24.86* 21.43
24.43
21.21
24.37
21.07
24.38
21.07
Ppp1r1b (DARPP-32)
21.66
21.03 22.25* 21.02 22.33* 21.23
21.88
21.01
21.92
20.92
21.71
20.85
Adora A2a (Adenosine A2a)
24.41
21.24 24.93* 21.16
24.59
21.22
24.54
21.08
24.46
21.05
24.99
21.41
Supplementary References
1.
Castaing M, Guerci A, Mallet J, Czernichow P, Ravassard P, Scharfmann R. Efficient
restricted gene expression in beta cells by lentivirus-mediated gene transfer into
pancreatic stem/progenitor cells. Diabetologia 2005; 48: 709-719.
2.
de Almeida LP, Zala D, Aebischer P, Deglon N. Neuroprotective effect of a CNTFexpressing lentiviral vector in the quinolinic acid rat model of Huntington's disease.
Neurobiol Dis 2001; 8: 433-446.
3.
Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral
vector achieves efficient gene delivery in vivo. Nature biotechnology 1997; 15: 871875.
4.
Zennou V, Serguera C, Sarkis C, Colin P, Perret E, Mallet J et al. The HIV-1 DNA
flap stimulates HIV vector-mediated cell transduction in the brain. Nat Biotechnol
2001; 19: 446-450.
5.
Bilang-Bleuel A, Revah F, Colin P, Locquet I, Robert JJ, Mallet J et al. Intrastriatal
injection of an adenoviral vector expressing glial-cell-line-derived neurotrophic factor
prevents dopaminergic neuron degeneration and behavioral impairment in a rat model
of Parkinson disease. Proceedings of the National Academy of Sciences of the United
States of America 1997; 94: 8818-8823.
6.
Kiefer H, Chatail-Hermitte F, Ravassard P, Bayard E, Brunet I, Mallet J. ZENON, a
novel POZ Kruppel-like DNA binding protein associated with differentiation and/or
survival of late postmitotic neurons. Mol Cell Biol 2005; 25: 1713-1729.
7.
Agulhon C, Rostaing P, Ravassard P, Sagne C, Triller A, Giros B. Lysosomal amino
acid transporter LYAAT-1 in the rat central nervous system: an in situ hybridization
and immunohistochemical study. J Comp Neurol 2003; 462: 71-89.
8.
Watson DJ, Loiseau F, Ingallinesi M, Millan MJ, Marsden CA, Fone KC. Selective
blockade of dopamine D3 receptors enhances while D2 receptor antagonism impairs
social novelty discrimination and novel object recognition in rats: a key role for the
prefrontal cortex. Neuropsychopharmacology 2012; 37: 770-786.
9.
Terranova JP, Chabot C, Barnouin MC, Perrault G, Depoortere R, Griebel G et al.
SSR181507, a dopamine D(2) receptor antagonist and 5-HT(1A) receptor agonist,
alleviates disturbances of novelty discrimination in a social context in rats, a putative
model of selective attention deficit. Psychopharmacology (Berl) 2005; 181: 134-144.