* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Supplementary Information (doc 884K)
Epigenetics in stem-cell differentiation wikipedia , lookup
X-inactivation wikipedia , lookup
Microevolution wikipedia , lookup
Gene nomenclature wikipedia , lookup
RNA interference wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Non-coding RNA wikipedia , lookup
Gene therapy wikipedia , lookup
Epitranscriptome wikipedia , lookup
Designer baby wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
RNA silencing wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Gene expression programming wikipedia , lookup
Gene expression profiling wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Primary transcript wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Supplementary methods Construction and production of LV-vectors expressing microRNAs targeting D2 or Gpr88 mRNA A set of pre-miRNAs, composed by four different double-stranded oligonucleotides for each gene, targeting the expression of D2 or Gpr88 (BLOCK-IT™ miR RNAi Select) were acquired from Invitrogen. Recombinant expression clones carrying the DNA sequence for stable RNA interference were produced using the Gateway® Technology (Invitrogen, France). Every pre-miRNA sequence was cloned into the pcDNATM 6.2-GW / EmGFP-miR expression vector in the 3’ untranslated region (3’UTR) of the Emerald Green Fluorescent Protein (EmGFP) between the stop codon and the polyadenylation signal under the drive of a RNA Polymerase II promoter, allowing for the simultaneous expression of the EmGFP and miRNA. The integrity of each construct was verified by sequencing and the EmGFP/pre-miRNAs expression cassettes were transferred to the pTRIP-ΔU3 vector under the control of the cytomegalovirus (CMV) promoter.1 The most effective among the four miRs in knocking down the expression of the target gene in primary neuronal cultures from rat striatum was selected and expressed under the drive of the ubiquitous phosphoglycerate kinase (PGK) promoter, which is well suited for long term expression of the transgene in neuronal cells.2 The gene targeting sequences of the selected miRs are as follows: miR-D2= 5’AAAGATGTCACAGTGAATCCT3’; miR-Gpr88= 5’AACAACACCAGACCCAAGGCG3’. High-titer stocks of LV-vectors were generated by calcium phosphate co-precipitation into HEK-293T cells as previously described.3, 4 The viral particles suspended in PBS buffer were stored in aliquots at -80 °C until use. The amount of p24 capsid protein was quantified by the HIV-1 p24 antigen ELISA (Beckman Coulter, France). The efficiency of the selected LV- miR-Gpr88 and LV-miR-D2 constructs driven by the PGK promoter was confirmed in vitro and these vectors were used for the subsequent brain injections. Negative controls were generated maintaining the same construct carrying either a miR without any known target into the rat genome (LV-miR-control) or the EmGFP alone (LV-EmGFP) under the drive of the PGK promoter. No significant differences in the targets expression were observed between these constructions that were, thus, interchangeably used and are collectively referred to as Control. Striatum primary neuronal cultures Primary neuronal cell cultures of striatum that endogenously express D2 and Gpr88 were prepared from rat embryos (Sprague-Dawley) as previously described.5 After 1 week, the cells were transduced with the LV-vectors targeting D2 or Gpr88 or the LV-miR-control vector. The medium was replaced with fresh medium (500 µl/well) 24 h later and cells (3x105 cells/target) were harvested four days after transduction. Total RNAs from striatal primary cultures were extracted using the RNeasy® Plus Mini Kit (Qiagen, Germany). First-strand cDNAs were generated from 100 ng of total RNA and Oligo (dT)20 primer with the SuperScript III First-strand Kit (Life Technologies, Carlsbad, CA) in a total volume of 20 µL. Laser Capture Microdissection Rat brain sections (10 µm thick) were used for the retrieval by LCM of EmGFP positive cell populations using the PixCell®IIe Arcturus® instrument: laser pulses of 7.5 μm diameters, pulse power 47 mW with 3.7 ms duration. A total of 10-16 consecutive slices were processed by LCM for each of the 3 experimental conditions (LV-miR-control, LV-miR-Gpr88 and LVmiR-D2) and the respective EmGFP-positive cell populations were pooled. Total RNAs were extracted (Qiagen Rneasy Micro Kit) from each pool stored in HS-CapSure tubes. After extraction qualities were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies, USA); RNA integrity number (RIN) was > 8 for each pool. Aliquots of 10 ng of RNA were amplified using ExpressArt mRNA linear amplification Nano kit (Amp Tec- Exilone, France) according to the manufacturer’s protocol. Reverse transcription of 1 μg amplified cRNA was carried-out with an iScript cDNA Synthesis Kit (Bio-Rad, France). D2 and Gpr88 transcript quantification assays cDNAs synthetized from cell cultures or LCM samples were used for quantitative RT-PCR analysis using the Light Cycler 480 System (Roche, Switzerland) and TaqMan QuantiFast Probe Assays (Qiagen, Germany) for D2, Gpr88 and Cyclophilin as endogenous control (D2 Probe Assay: Rn_Drd2_FAM_1; Gpr88 Probe Assay: Rn_Gpr88_FAM_1 and Cyclophilin Probe Assay: Rn_Ppia_MAX_2). Relative gene expression values were obtained using the 2−ΔΔCt method from the data normalized with the Cyclophilin. In situ hybridization To generate the Gpr88 riboprobe, total RNA was extracted from rat striatum and reverse transcribed using SuperScript™ III Reverse Transcriptase (Life Technologies, Carlsbad, CA). Primer pairs used to amplify Gpr88 cDNAs corresponding to a 1 000 bp fragment (nucleotides 135–1134) were as follows: forward primer, 5’GCAGCCTACCGCTTGACTTTTTCTCC; reverse primer, 5’GTCAAGCGGGTCAGCGTGCT. The resulting Gpr88 PCR fragment was subcloned into pGEM-T Easy vector (Promega, Madison, WI), sequenced to confirm identity and used as a probe for in situ hybridization assay. The eGFP and Gad67 sense and antisense riboprobes were transcribed from the pGEM®-T easy vector as previously described.1, 6 All plasmids (1 µg/probe) were linearized and used as templates for the synthesis by T3, T7 or SP6 RNA polymerase (Promega, Madison, WI) of sense or anti-sense riboprobes, labeled with digoxygenin-11-UTP (Roche, Switzerland). Brain sections 10 µm-thick were processed for in situ hybridization as previously described.7 Microscopic images were acquired with a fluorescence microscope Leica DM5000 B (Leica, Wetzlar, Germany) and digitized using a Leica DFC300 FX Digital Color Camera. Double labeling Immunohistochemistry for D2, NeuN, and GFP in the rat brain Rats were transcardially perfused with 0.1M phosphate-buffered saline (PBS) followed by ice-cold 1% paraformaldehyde (PFA; in 0.1M PBS). Thereafter, brains were removed and left overnight in 1% PFA solution, 2 days in a 20% sucrose solution (in 0.1M PBS) and then rapidly frozen in isopentane (-45 °C). All samples were stored at -80 °C. Two different methods were used for double immunostainings: a sequential detection of D2 receptor using the tyramide amplification protocol followed by a standard EmGFP labeling; or a simultaneous double staining of NeuN and EmGFP. Stainings were performed on 14 µm frozen brain sections collected from a cryostat. For D2 and EmGFP double labeling, sections were placed in 10mM citrate buffer pH 6 and micro-waved at 700W for 2.5 min for antigen retrieval. Endogenous activity was blocked by incubation in 2% H2O2 for 30 min maximum at room temperature (RT). After rinsing in PBSTriton wash buffer (0.1M PBS, 0.2% Triton X-100) for three times, sections were incubated in TNB Blocking Buffer (0.1M TRIS-HCl, pH 7.5, 0.15M NaCl, 0.5% Blocking Reagent; Perkin Elmer, Whaltam, Mass.) for 45 min. Afterwards, the primary antibody diluted in TNB blocking buffer (rabbit antisera against Dopamine receptor D2; Merck Millipore, Billerica, Mass., 1:500) was applied overnight at 4 °C. After rinsing in PBS-Tween wash buffer (0.1M PBS, 0.05% (v/v) Tween 20) four times, the sections were incubated with the secondary antibody diluted in TNB blocking buffer (biotinylated donkey anti-rabbit IgG; GE Healthcare, Buckingameshire, UK, 1:200) for 1 hour at RT. After rinsing in PBS-Tween wash buffer four times, sections were incubated in streptavidin peroxydase complex diluted in TNB blocking buffer (TSA™ Fluorescence Systems; Perkin Elmer, Whaltam, Mass., 1:150) for 30 min at RT. Subsequently, sections were rinsed in PBS Tween wash buffer three times again, and then incubated in tetramethyl rhodamine tyramide solution (TSA™ Fluorescence Systems; Perkin Elmer, Whaltam, Mass., 1:300) for 10 min at RT. After rinsing in PBS Tween wash buffer three times, sections were incubated in PBS Tween blocking solution (0.1M PBS, 0.05% (v/v) Tween 20, 10% normal goat serum) for 1 hour at RT. Then, the second primary antibody (rabbit anti-GFP IgG; Life Technologies, Carlsbad, CA, 1/500 in PBS Tween containing 2% normal goat serum) was applied overnight at 4°C. After washing in PBS Tween wash buffer four times, brain sections were treated for 1 hour with the secondary antibody (fluorescein isothiocyanate labeled goat anti-rabbit IgG, Life Technologies, Carlsbad, CA, 1/2 000 in PBS Tween containing 2% normal goat serum) at RT. For the simultaneous detection of NeuN and EmGFP, standard immunohistochemical method, as described above for the labeling of EmGFP, was performed. The following primary antibodies were utilized: mouse monoclonal anti-Neuronal nuclei IgG (Merck Millipore, Billerica, Mass., 1:500) and rabbit anti-GFP IgG (Life Technologies, Carlsbad, CA, 1/500). This was followed by two secondary antibodies: far-red fluorescent dye labeled goat antimouse IgG (Life Technologies, Carlsbad, CA, 1/2 000) and fluorescein isothiocyanate labeled goat anti-rabbit IgG (Life Technologies, Carlsbad, CA, 1/2 000). Finally, after washing in PBS Tween wash buffer four times both D2/EmGFP and NeuN/EmGFP slides, sections were stained with 4’,6-diamidino-2-phenylindole (DAPI) for 10 min to counterstain cell chromatin. Sections were rinsed in PBS three times again, and then mounted using Fluorescent Mounting Medium (Dako Cytomation; Dako, Glostrup, Denmark). Fluorescent staining was visualized using a fluorescence microscope Leica DM5000 B (Leica, Wetzlar, Germany) and digitized using a Leica DFC300 FX Digital Color Camera. Social novelty discrimination task Adult rats were individually housed for 2 days before testing while juveniles (3 weeks old, 45-50 g on arrival) were group-housed. The experimental protocol was implemented according to previous studies.8, 9 Briefly, a juvenile (F, familiar) was placed into the adult home cage for a first presentation period (P1) of 30 min. The time spent by the adult investigating the juvenile (anogenital sniffing, pursuing, allogrooming) was measured manually for the first 5 min. At the end of P1, a second juvenile (N, novel) was introduced in the cage together with the adult and the familiar juvenile, and the times spent by the adult investigating each juvenile were measured independently for 5 min (presentation period P2). The discrimination ratio was calculated as the time spent in P2 by the adult with the novel juvenile over the familiar juvenile. This test allows for measuring a spontaneous social interaction (total time spent with both juveniles) as well as social discrimination (more interaction time normally devoted to the novel conspecific). Supplementary Figures Supplementary Fig. 1: Gene expression KD efficiency in vitro in primary cultures of rat striatal neurons. Relative expression ninety-sixty hours following transduction of (a) D2 (0.34 ± 0.11) in LV-miR-D2 and (b) Gpr88 (0.24 ± 0.16) in LV-miR-Gpr88 transduced cells as compared to the respective expression set to 1 in LV-miR-control transduced cells. Quantification of mRNA levels was performed by RT-qPCR. All values were normalized to Cyclophilin as endogenous control and represent mean ± SEM of three technical replicates per condition. Supplementary Fig. 2: Immunohistochemical analysis of the LV-miR-D2 injection in the NAcc. Representative coronal rat brain sections showing: D2 (a), Neuronal Nuclei (NeuN) (d) and EmGFP (b and e) proteins visualized by immunohistochemistry staining. Doublelabelings (merge, yellow) are depicted in the corresponding right column. The upper panels show the D2 expression knock-down in the EmGFP-positive region (a, b, c). Infusion of the LV-miR-D2 in the NAcc does not induce neuronal cytotoxicity as shown by co-localization between most EmGFP-positive and NeuN-positive cells in the middle panels (d, e, f). The bottom panels represents the inset’s magnification (g, h, i). Scale bar = 100 µm (upper panels: 10x magnification) and 25 µm (middle panels: 20x magnification). AC, Anterior Commissure. Supplementary Table 1: TaqMan® Gene Expression Assays for Duplex RT-qPCR analysis (gene target: FAM dye; endogenous control (Ppia): VIC dye) supplied by Applied Biosystems, USA. Receptors Intracellular signaling molecules Gene Name Gene Symbol Assay ID G-protein coupled receptor 88 Gpr88 Rn02133938_s1 Dopamine receptor D2 Drd2 Rn00561126_m1 Dopamine receptor D1 Drd1 Rn03062203_s1 Dopamine receptor D3 Drd3 Rn00567568_m1 Adenosine A2a receptor Adora2a Rn00583935_m1 Regulator of G-protein signaling 19 Rgs19 Rn00572243_m1 Protein phosphatase 1, regulatory Ppp1r1b (inhibitor) subunit 1B Rn01452984_m1 Neuromodulator Dysbindin domain containing 1 Rn01432426_m1 Endogenous control Peptidylprolyl (cyclophilin A) isomerase Dbndd1 A Ppia Rn00690933_m1 Supplementary Table 2: Effects of the LV-vectors on total interaction time (s) with juveniles during the social novelty discrimination test in adult rats (PND 67) neonatally treated with saline or PCP Neonatal teatment (PND 7,9,11) LV-injection (PND 50) Drug Saline PCP (10mg/Kg; s.c.) Interaction time (N) P1 (s) P2 (s) Total (P1+P2) Control (12) 131.8 9.00 117.6 9.3 249.3 16.3 miR-D2 (13) 140.5 11.5 113.1 11.3 253.5 20.6 miR-Gpr88 (12) 142.2 14.4 97.9 13.8 240.1 27.7 Control (12) 135.7 14.7 94.3 12.2 230.0 25.7 miR-D2 (12) 129.3 16.1 106.3 14.4 235.6 30.4 miR-Gpr88 (21) 147.3 5.0 102.6 9.0 249.9 12.5 N = number of rats per group; P1 = interaction time with one juvenile in the initial 5’ of the 30’ first presentation period P2 = interaction time with two juveniles (familial and novel) in the 5’ second presentation period Data represents mean ± SEM. Supplementary Table 3: Results of RT-qPCR in Nacc samples for selected genes coding for molecules pertaining to the D2 receptor signaling complex. The threshold cycle values are reported only for the genes showing a significant difference after D2-KD or Gpr88-KD as compared to the respective Control in at least one experimental condition. TaqMan gene expression Assays were performed in a duplex reaction with the probe for the targeted gene and the probe for the endogenous control (Ppia gene coding for Cyclophilin A). Cyclo= Cyclophilin A (endogenous control). * P< 0.05 as compare dto the respective Control Neonatal treatment Saline Control D2-KD PCP Gpr88-KD Control D2-KD Gpr88-KD Genes Target Cyclo Target Cyclo Target Cyclo Target Cyclo Target Cyclo Target Cyclo Drd2 (D2) 24.54 21.16 25.25* 21.12 25.14 21.36 24.67 21.18 24.78 21.00 23.51 21.00 Gpr88 24.18 21.24 24.66* 21.18 24.86* 21.43 24.43 21.21 24.37 21.07 24.38 21.07 Ppp1r1b (DARPP-32) 21.66 21.03 22.25* 21.02 22.33* 21.23 21.88 21.01 21.92 20.92 21.71 20.85 Adora A2a (Adenosine A2a) 24.41 21.24 24.93* 21.16 24.59 21.22 24.54 21.08 24.46 21.05 24.99 21.41 Supplementary References 1. Castaing M, Guerci A, Mallet J, Czernichow P, Ravassard P, Scharfmann R. Efficient restricted gene expression in beta cells by lentivirus-mediated gene transfer into pancreatic stem/progenitor cells. Diabetologia 2005; 48: 709-719. 2. de Almeida LP, Zala D, Aebischer P, Deglon N. Neuroprotective effect of a CNTFexpressing lentiviral vector in the quinolinic acid rat model of Huntington's disease. Neurobiol Dis 2001; 8: 433-446. 3. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nature biotechnology 1997; 15: 871875. 4. Zennou V, Serguera C, Sarkis C, Colin P, Perret E, Mallet J et al. The HIV-1 DNA flap stimulates HIV vector-mediated cell transduction in the brain. Nat Biotechnol 2001; 19: 446-450. 5. Bilang-Bleuel A, Revah F, Colin P, Locquet I, Robert JJ, Mallet J et al. Intrastriatal injection of an adenoviral vector expressing glial-cell-line-derived neurotrophic factor prevents dopaminergic neuron degeneration and behavioral impairment in a rat model of Parkinson disease. Proceedings of the National Academy of Sciences of the United States of America 1997; 94: 8818-8823. 6. Kiefer H, Chatail-Hermitte F, Ravassard P, Bayard E, Brunet I, Mallet J. ZENON, a novel POZ Kruppel-like DNA binding protein associated with differentiation and/or survival of late postmitotic neurons. Mol Cell Biol 2005; 25: 1713-1729. 7. Agulhon C, Rostaing P, Ravassard P, Sagne C, Triller A, Giros B. Lysosomal amino acid transporter LYAAT-1 in the rat central nervous system: an in situ hybridization and immunohistochemical study. J Comp Neurol 2003; 462: 71-89. 8. Watson DJ, Loiseau F, Ingallinesi M, Millan MJ, Marsden CA, Fone KC. Selective blockade of dopamine D3 receptors enhances while D2 receptor antagonism impairs social novelty discrimination and novel object recognition in rats: a key role for the prefrontal cortex. Neuropsychopharmacology 2012; 37: 770-786. 9. Terranova JP, Chabot C, Barnouin MC, Perrault G, Depoortere R, Griebel G et al. SSR181507, a dopamine D(2) receptor antagonist and 5-HT(1A) receptor agonist, alleviates disturbances of novelty discrimination in a social context in rats, a putative model of selective attention deficit. Psychopharmacology (Berl) 2005; 181: 134-144.