Download CST Review Sheet 2 DNA and RNA 1. The unit to the right which

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Genomics wikipedia , lookup

Y chromosome wikipedia , lookup

Genetic engineering wikipedia , lookup

Genomic library wikipedia , lookup

Genome (book) wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Cancer epigenetics wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Molecular cloning wikipedia , lookup

Epigenomics wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Non-coding DNA wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

Primary transcript wikipedia , lookup

Genealogical DNA test wikipedia , lookup

DNA vaccination wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Replisome wikipedia , lookup

DNA supercoil wikipedia , lookup

NEDD9 wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Genomic imprinting wikipedia , lookup

Mutagen wikipedia , lookup

SNP genotyping wikipedia , lookup

Genetic drift wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Hardy–Weinberg principle wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Point mutation wikipedia , lookup

Gene wikipedia , lookup

Helitron (biology) wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Ploidy wikipedia , lookup

Neocentromere wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Designer baby wikipedia , lookup

Deoxyribozyme wikipedia , lookup

History of genetic engineering wikipedia , lookup

X-inactivation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Karyotype wikipedia , lookup

Meiosis wikipedia , lookup

Chromosome wikipedia , lookup

Polyploid wikipedia , lookup

Microevolution wikipedia , lookup

Dominance (genetics) wikipedia , lookup

Transcript
CST Review Sheet 2
DNA and RNA
1. The unit to the right which connects together to other similar units
to make DNA is called a __nucleotide________________
2. Label its three parts to the right. 1. Phosphate, deoxyribose sugar, base
3. What types of bonds hold together DNA?
a. hydrogen b. molecular c. covalent d. hydrogen and covalent
4. DNA replication results in two DNA molecules
a. each with two new strands
c. one with two new strands and the other with two original strands
b. each with two original strands d. each with one new strand and one original strand
5. Write the complimentary DNA strand ACCATAGATACT
TGGTATCTATGA
6. Which information was most important to the development of genetic engineering techniques?
A the observation of nondominant alleles B the discovery of lethal genes
C the formulation of Punnett squares
D the structure of a DNA molecule
Protein Synthesis
1. Fill in the blanks with the correct organelles: Protein synthesis starts in the NUCLEUS, then moves into the
CYTOPLASM and ends on a RIBOSOME.
2. Label the picture
TRANSCRIPTION
TRANSLATION
3. a. Transcribe this DNA: GGACTAGAATCCATC
CCUGAUCUUAGGUAG
b. How many codons are there? _5
4. Translate this mRNA:
AUGCAGAUCACCGGAUAGUAA
MET/START-
5. Make the protein this DNA codes for: TACCCATGATAGGACCAGATT
AUGGGUACUAUCCUGGUCUAA
MET/START-
6. 5' ATCAGCGCTGGC 3'
The above sequence of DNA is part of a gene. How many amino acids are coded for by this segment?
a. 4 b. 8 c. 12 d. 20
Meiosis
1. A chromosome is made of DNA wrapped tightly around histone proteins
2. How many chromosomes does a human gamete contain? ___23___
How many chromosomes does a human body cell contain? __46____
3. What two chromosomes do you need to be female? _XX_______
What two chromosomes do you need to be male? __XY______
4. What are homologous chromosomes? Chromosomes that are the same, size, shape, with genes in the same place
5. The diagram to the right shows a cellular process that occurs in organisms.
This process is known as A meiosis. B mitosis. C endocytosis. D phagocytosis.
6. Which of the following statements correctly describes meiosis?
A Cells divide only once during meiosis.
B Meiosis does not occur in reproductive cells.
C The cells produced at the end of meiosis are genetically identical to the parent cell.
D The cells produced at the end of meiosis contain half the number of chromosomes as the parent cell.
7. Which of the following best describes meiosis?
A It is carried out in all tissues that require cell replacement.
B It occurs only in cells in the reproductive structures of the organism.
C It happens in all tissues except the brain and spinal cord.
D It is the first stage of mitosis.
8. Based only on the sex chromosomes in typical human egg and sperm cells at fertilization, the probability of producing
a female is
A 25%. B 50% C 75%
D 90%.
9. When sperm and egg join together in fertilization it forms what is called a Zygote.
Genetics
1. What does heterozygous mean? Different alleles
What does homozygous mean? Two of the same alleles, either 2 recessive or 2 dominant
2. What is the law of segregation? Homologous chromosomes will separate into different sperm or egg at the
end of meiosis.
3. What is the law of independent assortment? Homologous pairs separate randomly
4. In flowers, blue flower petals are dominant to red flower petals.
What are the possible phenotypes for the following flowers with these genotypes?
BB Blue Bb Blue bb____Red
5. What is the phenotype of a heterozygous person if T is tall and t is short? Tall
6. In humans, big ears are dominant to small ears. B=_Big ears
What are the genotypes for a person with big ears? BB,Bb
What is the genotype for a person with small ears? bb
b=Small ears
7. In dogs, short hair (H) is dominant to long hair (h). If a heterozygous short hair dog is crossed with a long
hair dog, what percentage of the offspring will have long hair. Hhx hh = 50% chance
8. In certain breeds of dogs, deafness is due to a recessive allele (d) of a particular gene, and normal hearing is
due to its dominant allele (D). What percentage of the offspring of a normal heterozygous (Dd) dog and a deaf
dog (dd) would be expected to have normal hearing? A 0% B 25% C 50% D 100%
9. In fruit flies, the gene for red eyes (R) is dominant and the gene for sepia eyes (r) is recessive. What are the
possible combinations of genes in the offspring of two red-eyed heterozygous flies (Rr)? Do a punnett square
for Rr x Rr
A RR only B rr only C Rr and rr only D RR, Rr, and rr only
10. If a human baby boy inherits a recessive allele from his mother, in which circumstance would he most
likely show the trait coded for by the recessive allele?
A The baby inherits the dominant allele from his father.
B The allele is on an autosomal chromosome and the baby is a twin.
C The allele is on the X chromosome. D The allele is on the Y chromosome.
11. A healthy individual is a carrier of a lethal allele but is unaffected by it. What is the probable genotype of
this individual?
A two dominant normal alleles
C one recessive lethal allele and one dominant normal allele
B one recessive lethal allele and one dominant lethal allele
D one dominant lethal allele and one recessive normal allele