Download Practical II - Faculty Websites

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Nucleic acid analogue wikipedia, lookup

Deoxyribozyme wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

Replisome wikipedia, lookup

Cre-Lox recombination wikipedia, lookup

Gel electrophoresis of nucleic acids wikipedia, lookup

Microevolution wikipedia, lookup

Site-specific recombinase technology wikipedia, lookup

History of genetic engineering wikipedia, lookup

Therapeutic gene modulation wikipedia, lookup

Helitron (biology) wikipedia, lookup

Non-coding DNA wikipedia, lookup

Epigenomics wikipedia, lookup

DNA vaccination wikipedia, lookup

Genomics wikipedia, lookup

Extrachromosomal DNA wikipedia, lookup

Cell-free fetal DNA wikipedia, lookup

DNA supercoil wikipedia, lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia, lookup

Metagenomics wikipedia, lookup

Genomic library wikipedia, lookup

United Kingdom National DNA Database wikipedia, lookup

DNA polymerase wikipedia, lookup

Microsatellite wikipedia, lookup

Genealogical DNA test wikipedia, lookup

Bisulfite sequencing wikipedia, lookup

Molecular cloning wikipedia, lookup

Nucleic acid double helix wikipedia, lookup

DNA damage theory of aging wikipedia, lookup

SNP genotyping wikipedia, lookup

Plasmid wikipedia, lookup

Transcript
Dharshani Nanayakkara
Fall 2005 – BIOL 251 Lab Sec. 7, 8, & 9
Page 1 of 4
NOTE: THIS IS FROM LAST SEMESTER!!! POSTED IT ONLINE BECAUSE THERE
ARE SOME GOOD QUESTIONS…SOME OF THE QUESTIONS ARE 251 SPECIFIC,
SOME 351 SPECIFIC!!
BIOL 251 Lab Practicum II – Study Guide
REVIEW DAY/OPEN LAB – Friday, December 2, 2005
8.30 a.m. to 4.30 p.m.
I will be there from 2.30 – 4.30 p.m.
Please utilize this time to review all the demos.
***Make sure to record results of your conjugation and food
microbiology plates.
There are 3 additional study guides on the class website (http://www.unlv.edu/staff/wmojica/). I
strongly recommend that you study these thoroughly. It might be helpful to refer to these study
guides while looking at the demos.
 Practical II General Review Guide
 Practical II Tests
 Study Photos for Practical II
Review the lab manual, lab handouts, quizzes and the lab reports, especially the review
questions!!!
The following questions cover only the following exercises:
 Polymerase Chain Reaction (study the PCR Handout)
 Bacterial Conjugation
 Food Microbiology
***You may check your answers with me during the open lab.
1. (351) Polymerase chain reaction is a method used to amplify a specific DNA sequence in
vitro by repeated cycles of synthesis. Each PCR “cycle’ involves 3 steps. Complete the
following table with information pertinent to each step.
What Happens
Temperature
Time
Step 1
Step 2
Step 3
2. (351) What are the three items that should be added in excess at the start of the PCR process?
i.
ii.
Dharshani Nanayakkara
Fall 2005 – BIOL 251 Lab Sec. 7, 8, & 9
Page 2 of 4
iii.
3. (351) Why is a primer needed at each “end” of the DNA to be amplified?
4. (351) Suppose that you want to amplify the following DNA sequence using PCR. First, you
have to prepare two oligonucleotide primers – reverse and forward. If you have all the
necessary raw material, including all four dNTPs, what would be your two primers?
5’
3’
AAGTCCACCGTTAAGCGCCTAAATCCGCCCTAAATGCTTAAG
TTCAGGTGGCAATTCGCGGATTTAGGCGGGATTTACGAATTC
3’
5’
5. (351) Why is PCR usually performed with Taq (Thermus aquaticus) DNA polymerase?
6. (351) What other reagents are necessary for PCR and why?
7. (351) What are some applications of PCR?
8. (351) What is the most common way of seeing the results of a PCR?
9. (351) Gel electrophoresis is a powerful tool for the separation of macromolecules. Once
electric current is applied, what characteristics determine the rate of migration of a DNA
molecule?
10. (351) The following figure shows an agarose gel. Three fragments of DNA (A, B, and C)
have been loaded into wells toward the top of the gel, and the positive pole of the electric
field is at the bottom. The sizes of the three DNA fragments are indicated below.
(a) After a defined period of migration time, where will you see the three DNA
fragments?
_
DNA Fragment
A
B
C
Size (kb)
4000
500
1800
Dharshani Nanayakkara
Fall 2005 – BIOL 251 Lab Sec. 7, 8, & 9
Page 3 of 4
+
(b) What dye is usually used to stain the above gel and what would you do to get an
image of the DNA bands?
11. (251) Define bacterial conjugation. What are the three steps that conjugation depends on?
12. (251) What are the most important characteristics of conjugative plasmids?
13.
(251) In what region of the conjugative plasmid are the genes that control conjugation
contained, and what are these genes responsible for?
14.
(251) Suppose that you are asked to perform a conjugation experiment using the following
bacterial strains:
Donor – Escherichia coli
Kanamycin resistant (Kmr), streptomycin sensitive (Sms), gentamicin resistant
(Gmr) – the kanamycin and streptomycin genes are located on a conjugative
plasmid and the gentamicin gene is located on the bacterial chromosome.
Recipient – Pseudomonas fluorescens
Kanamycin sensitive (Kms), streptomycin resistant (Smr), gentamicin sensitive
(Gms)
(a)
What would be the first step in your conjugation experiment? Explain why you would
perform this step?
(b)
Suppose that you plated the donor strain in the following selective media plates. In
which plate(s) will it grow?
Km+Sm
(c)
Km+Gm
Km+Sm+Gm
Suppose that you plated the recipient strain in the following selective media plates. In
which plate(s) will it grow?
Sm+ Gm
Km+Sm
Km+Sm+Gm
Dharshani Nanayakkara
Fall 2005 – BIOL 251 Lab Sec. 7, 8, & 9
(d)
After mixing the donor and recipient strains, you provided sufficient time for the
mating cells to make contact. After that, you plated this culture in the following
selective media plates. In which plate(s) will the exconjugant strain grow?
Km+Sm+Gm
(e)
Sm
Km+Sm
Using the data in the following table, calculate the frequency of conjugation between
these two strains.
Exconjugants
Recipients
15.
Page 4 of 4
Dilution Factor
10-4
10-7
CFU
103
221
CFU/ml
1.03 x 106
2.21 x 109
(251) In a conjugation experiment, the following results were obtained. Calculate the
frequency of conjugation.
Exconjugants
Recipients
Dilution Factor
10-4
10-6
CFU
87
198
CFU/ml
16.
(Both) Does a heterotrophic plate count of a food sample accurately reflect the total
amount of bacteria present in that sample? Why?
17.
(Both) What is the difference between food poisoning and food intoxication?
18.
(Both) What is a coliform? Give some examples.
19.
(Both) (a) List a few genera of bacteria, molds, and yeasts that are associated with foods.
(b) List a few bacterial species that you don’t want to find in your food.
20.
(Both) Suppose that you wanted to determine the number of viable bacteria in a raw
hamburger. You performed a heterotrophic plate count of your food sample as outlined in
Figure 50.1 in your lab manual. If 180 colonies were counted from a 10-5 dilution of a 25-
Dharshani Nanayakkara
Fall 2005 – BIOL 251 Lab Sec. 7, 8, & 9
Page 5 of 4
gram sample and 1 ml was plated, calculate the number of bacteria per gram of your raw
hamburger. If your friend were to eat a hamburger that is in the same packet from which
you obtained the above sample, would you let him/her eat it?