Download HONORS BIOLOGY FINAL EXAM STUDY GUIDE 2010

HONORS BIOLOGY FINAL EXAM STUDY GUIDE
2010-2011
Use the following practice questions to help you prepare for our final exam.
These questions DO NOT cover ALL of the content that you may be expected to know for the final;
rather they represent a series of the types of questions you might be expected to answer.
Cell Division and DNA:
1. A cell with 64 chromosomes undergoes meiotic division. What is the chromosome number in the daughter cell?
2.
Overexposure to certain chemicals and UV light causes body cells to divide uncontrollably. What type of cell
division is this, and what health problem results from this uncontrolled cell division?
3. Identify and explain THREE ways that meiosis and sexual reproduction increase genetic diversity, and explain
why mitosis does not.
4. If an organism has 80 chromosomes, how would non-disjunction affect the resulting daughter cells during
meiosis? Provide a specific example of a human genetic disorder resulting from non-disjunction.
5. Dr. Goldin cuts her big toe. What cellular division process would be used to repair the damage? What other cells
in her body would have the same chromosome number?
6. What does it mean to be “haploid”? What cells in a human are haploid?
7. What does it mean to be diploid? What cells in a human are diploid?
8. An organism has 64 TOTAL chromosomes. What is the haploid number? What is its diploid number?
9. Exposure to cigarette smoke has caused a mutation in the lung of a human. Would this mutation be passed on to
the human’s offspring? Why or why not?
10. Write the appropriate term to match with the statement
a. May contain the bases adenine, thymine cytosine or guanine
b. May contain the base uracil
c. Responsible for adding bases to DNA strand during replication
d. Process by which DNA strand is turned into mRNA message
e. Carries amino acid to ribosomes for assembly
11. Using your knowledge of protein synthesis and the Universal Table of the Genetic Code, determine the protein
amino acid sequence that would result from the following DNA sequence:
TACCGACTCGGACTATGCAACATT
12. At right is a DNA molecule. LABEL this structure to indicate its structural components. Use the following terms:
deoxyribose sugar, phosphate, nitrogen base, nucleotide, hydrogen bond. Write in the complementary base
sequence present on the second strand.
13. Explain how this molecule of DNA replicates.
14. If the bases in DNA are the same in all organisms, what accounts for the large diversity of life on the planet?
Genetics:
15. In dogs, droopy tongue is dominant over straight tongue and round eyes are dominant over oval eyes. If a dog
with straight tongue and round eyes (heterozygous) mates with a dog heterozygous for both traits, predict the
phenotypic ratios for the resulting offspring.
16. Flower color in snapdragons is inherited in a incomplete dominant fashion. If two pink colored flowers are
crossed, what are the genotypic and phenotypic ratios of the offspring?
17. A child with blood type 0 (whose mother was blood type 0) is mixed up at the hospital. What are the possible
genotypes of the father?
18. In a population of individuals. Hemophilia occurs more frequently in males than in females. Why?
19. Colorblindness is an X-linked (sex-linked) trait. What kind of gametes can a colorblind male produce? A
colorblind female?
20. A colorblind male is crossed with a normal (non-carrier female), what is the probability that their female children
will be colorblind?
21. An organism has the genotype AABBcc. What type of gametes can it produce?
22. In humans blonde hair is recessive to brown and widows peak is dominant to no widow’s peak. Construct a
dihybrid cross to show the offspring that would result from a cross between two heterozygous brown haired,
heterozygous widow’s peak individuals. What is the phenotypic ratio for this cross?
23. Identify the possible inheritance patterns for the traits depicted in the following pedigrees. Explain how you
arrived at your conclusions using evidence from each pedigree.
A
B
C
24. Identify the abnormalities in each of the following karyotypes.
Evolution:
25. Explain the difference analogous and homologous structures. If two animals have analogous structures, what
does that imply about their ancestry? What if two animals have homologous structures?
26. Human fetuses in the first few weeks of development are very similar to pig fetuses. What type of evidence for
evolution is this?
27. Deep sea fishes have bone structures that allow them to resist the extreme pressures of the depths. This is an
example of what?
28. Give an example of a homology with bat wing
29. A small population of fish live in a grey bottom pond. Two phenotypes exist, a dark brown variation, and a grey
variation. Cats enter the environment. And begin hunting the fish. Over time what will likely happen to the
population of fish? Explain WHAT, WHY and HOW
30. In terms of reproductive success, how would you define “survival of the fittest?”
31. Explain why Dr. Goldin cannot evolve.
32. Tentacles have evolved in both sea anemones and octopi, even though the species are distantly related. This is
an example of:
33. A population of mice is separated by a flood, for 10,000 years. After the 10,000 years the river dries up and the
populations come into contact with each other. However they do not interbreed. Why?
34.
Biotechnology:
35. What is a plasmid? Why are they important to Recombinant DNA technology?
36. Explain the idea of recombinant DNA technology and how it works. Be sure to include the following terms: gene
of interest, restriction enzymes, plasmid, ligase.
37. Define transformation. How might it be helpful when talking about recombinant DNA?
38. Dolly the sheep is a reproductive clone. What does that mean?
39. What are three PROS and three CONS to the use of transgenic (genetically modified) crops?
40. What is PCR? When and why is it used?
41. What is the purpose of gel electrophoresis?
42. Explain the role or function of each of the following in gel
electrophoresis:
a) Electric current
b) Agarose gel
c) Well
43. Label the positive (+) and negative (-) ends of the gel to
the right.
44. If A is a sample taken from the crime scene, which lane
represents the suspect who was at the crime scene?
45. Which bands are the largest? HOW DO YOU KNOW?
46. Which bands are the smallest? HOW DO YOU KNOW?
Global Interdependence:
47. DRAW the CARBON CYCLE.
a) How does carbon enter a deer’s body?
b) Identify two ways this element can leave the deer’s body
c) How have humans altered the cycling of carbon?
d) How has that alteration impacted our environment?
e) What can we do to minimize the impact of human activities on the
cycling a carbon
48. DRAW the NITROGEN CYCLE.
a) Nitrogen is required for the synthesis of which organic compounds?
b) Explain how atmospheric nitrogen makes its way into a mammal.
c) Explain how the nitrogen in organisms is converted back into atmospheric nitrogen.
d) Why do farmers frequently include legumes as part of a crop rotation?
e) Why do farmers frequently use commercial fertilizers to increase the yield of their crops?
f) What negative impacts can the use of fertilizers have on our environment and WHY?
49. DDT is an insecticide that often washes into rivers due to runoff. In a water environment with plankton, which
are consumed by small fish, which are consumed by Tuna, which species would be the most harmful to humans?
Why?
50. What is a “Brownfield Site”? What are some contaminants frequently found at such sites?
Populations:
51. What is a population? Provide a DEFINITION and an EXAMPLE.
52. Why is “all of the organisms in a forest” NOT considered a population?
53. What is an ecosystem? Provide a DEFINITION and an EXAMPLE.
54. DESCRIBE some biotic factors that might impact an ecosystem. Provide a DEFINITION and EXAMPLES.
55. DESCRIBE some abiotic factors that might impact an ecosystem. Provide a DEFINITION and EXAMPLES.
56. Locusts experience large population booms followed by large crashes in numbers. Their growth relies on factors
such as rainfall and temperature. DRAW what such a population curve might look like. LABEL your curve to
indicate WHAT FACTORS are impacting the population WHEN.
57. DESCRIBE some density-dependent factors that impact a population. Provide a DEFINITION and EXAMPLES.
58. DESCRIBE some density-independent factors that impact a population. Provide a DEFINITION and EXAMPLES.
59. Many individuals died in Europe during the outbreak of the Bubonic Plague. Part of the reason so many died,
was due to the fact that people lived in close contact with each other. Would this be an example of a density
dependent, or density independent factor?
60. What are “limiting factors” and how do they relate to “carrying capacity”?
61. Draw an exponential growth curve. What letter does it look like?
62. Draw a logistic growth curve. What letter does it look like?
63. Which type of growth curve has the human population shown to date? WHY?
64. Consider the population pyramid (age structure diagram) below.
a) What type of population growth is occurring in the country depicted below? How can you tell?
b) What factors may be influencing the type of growth experienced by this population?