Download Hemophilia - Genomics Help

Hemophilia
Hemophilia A is an X-linked, recessive, bleeding disorder caused by a
deficiency in the activity of coagulation factor VIII. Factor VIII (F8) is
the protein product of the HEMA gene, located at map position Xq28.
Affected individuals have internal bleeding in joints and muscles, easy
bruising, and prolonged bleeding from wounds. It affects
approximately 1 in 10,000 males in most populations (a similar
number of females are carriers). There are about 17,000 people
presently living with hemophilia in the United States. There are no
national, regional or ethnic groups known to have increased incidence.
Hemophilia A is caused by hundreds of different heterogeneous
mutations in the HEMA gene (base changes, insertions, deletions,
inversions). This gene seems to be a hotspot for mutation.
Approximately 1 out of 5 cases of hemophilia A is the result of a new
mutation, rather than a mutant gene inherited from the parents. The
disease shows a range of severity, which may be linked to the specific
type of mutation inherited and its effect on the function of the factor
VIII protein. Carrier detection and prenatal diagnosis can be done by
sequencing of the entire HEMA gene, or by detection of specific
mutations known to exist in a family. Therapy for the disease requires
replacement of factor VIII by injection of purified protein derived from
human plasma or recombinant techniques.
Question: Hemophilia A is famous as a disease of the Royal families of
Europe in the 19th and 20th centuries. Since hemophilia A is on the X
chromosome, was there an increased risk of having a child with
hemophilia in a consanguineous (same family) marriage?
Will a father with the disease produce children who have it?
This pedigree was created by Janet Stein Carter, Clermont College,
University of Cincinnati, who retains copyright.
Gene Therapy
Patients with Hemophilia A now receive regular injections of purified
factor VIII protein, which enables them to live nearly normal lives.
However, this therapy is expensive, and carries substantial lifelong
risks of infection since the protein is generally purified from donated
human blood, and must be injected by the patient. A much more
radical approach, that could lead to a permanent cure for the disease,
is gene therapy. Adding a new copy of the HEMA gene into the liver
cells of the patient
The current work on gene therapy uses a virus as a “vector” to carry
theraputic genes into cells in the patient’s body. Adenovirus is often
chosen because it is non-lethal and can be easily manipulated using
biotechnology techniques. Adenovirus is efficient at infecting human
cells and can be grown in the laboratory.
Adenoviruses are non-enveloped viruses containing a linear double
stranded DNA genome. There are over 40 strains of adenovirus, most
of which cause benign respiratory tract infections in humans. The virus
does not normally integrate into the host genome, rather they
replicate as episomal elements in the nucleus of the host cell. As a
result, adenovirus is eliminated from the body of an infected person by
the immune system after a period of time, which may range from a
few days to a few months. After repeated exposure to adenovirus, a
person may develop enhanced immunity, which could prevent
repeated infection, or possibly lead to severe allergic reaction.
The wild type adenovirus genome is approximately 35 kb, of which up
to 30 kb can be replaced with foreign DNA. The most recent vectors
contain only the inverted terminal repeats (ITRs) and a packaging
sequence around the transgene, all of the necessary viral genes being
provided by a second “helper” virus.
A New Adenoviral Vector: Replacement of All Viral Coding Sequences with 28 kb of
DNA Independently Expressing both Full-Length Dystrophin and B-Galactosidase
S Kochanek, PR Clemens, K Mitani, H Chen, S Chan, and CT Caskey
Proc Natl Acad Sci U S A. 1996 June 11; 93(12): 5731–5736.
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=39129
Your Assignment:
Design a gene therapy vector that could be used to cure hemophilia A.
1) Locate the coding sequence of the human HEMA (F8) gene in an
online database of the human genome (UCSC Genome Browser)
2) Locate the sequence of an adenovirus that can be used for
human gene therapy
3) Design a cloning strategy using restriction enzymes and ligase
that would enable you to insert the HEMA gene into the
adenovirus vector.
1) Find the DNA (Nucleotide) sequence of the normal human HEMA
gene.
The easiest place to find a single standard sequence for the human
genome is the UCSC Genome Brower: http://genome.ucsc.edu/ (see
Genomes Tutorial).
Go to the Genome Browser home page and click on the link to
Genome Browser. Choose “human” from the genome pulldown
menu, and then type “HEMA” in the text box for position, then hit
the Submit button.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
The HEMA gene shows up under the “Known Genes” heading. Click on
it to go to the chromosome map.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Questions:
What chromosome is the HEMA (F8) gene on?
How long is this gene?
How many exons and introns does it have?
The factor VIII protein is 2351 amino acids long. What makes the
sequence on the chromosome so much longer?
The adenovirus vector can only hold 30 kb (30,000 base pairs) of
inserted DNA, so we can’t use the full genomic segment in our
engineered gene therapy virus. We need to use the protein coding
parts of the gene (the exons) plus some of the upstream sequence
(the promoter) and some downstream sequence. Fortunately, the
Genome Browser makes it quite easy to get exactly the sequence that
is needed. On the RefSeq Gene page, scroll down to the “Links to
Sequence” section and click on the link for “Genomic Sequence from
assembly.”
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Now there are a number of options to set up exactly what sequence
you want to retrieve from the database. Check the box for
“Promoter/Upstream by 1000 bases” and uncheck the box for
“Introns” (this will remove all introns from the sequence that is
retrieved). We also want to add 500 bases past the end of the gene,
so check the box for “Downstream by 100 bases.” Also, make sure
that under “Sequence Formatting Options,” the button is set to “Exons
in upper case, everything else in lower case.” Then hit the “submit”
button. You will get a screen full of DNA sequence. Save this sequence
to a word processing file. Note that the first 1000 bases are in lower
case, then several thousand uppercase bases, and finally 1000 bases
in lowercase at the end. It is within these two lowercase sections that
you wish to find restriction enzyme recognition sites.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
>hg16_refGene_NM_000132 range=chrX:152532711-152674280 5'pad=0 3'pad=0
revComp=TRUE strand=caccatggctacattctgatgtaaagagatatatcctatacctgggccaa
atgtaaacagcctggcaaaagtgttaggttaaaaacaaaacaaaataaat
aaatgaataaatgccaggtggttatgagtgctattgagaaaaatgaagcc
aagagggatatcagtgatgcaggtgggggtaaagagcttacaacataaat
gtggtgttccatatttaaacctcattcaacagggaagattggagctgaaa
tgtgaaggagttgtgggagtggaactacgtggaaatctgggggaaaggtg
ttttgggtaaaagaaatagcaagtgttgaggtccaggggcatgagtgtgc
ttgatattttagggaagagtaaggagaccagtataaccagagtgagatga
gactacagaggtcaggagaaagggcatgcagaccatgtgggatgctctag
gacctaggccatggtaaagatgtagggttttaccctgatggaggtcagaa
gccattgaaggattctgagaagaggagtgacaggactcgctttatagttt
taaattataactataaattatagtttttaaaacaatagttgcctaacctc
atgttatatgtaaaactacagttttaaaaactataaattcctcatactgg
cagcagtgtgaggggcaagggcaaaagcagagagactaacaggttgctgg
ttactcttgctagtgcaagtgaattctagaatcttcgacaacatccagaa
cttctcttgctgctgccactcaggaagagggttggagtaggctaggaata
ggagcacaaattaaagctcctgttcactttgacttctccatccctctcct
cctttccttaaaggttctgattaaagcagacttatgcccctactgctctc
agaagtgaatgggttaagtttagcagcctcccttttgctacttcagttct
tcctgtggctgcttcccactgataaaaaggaagcaatcctatcggttact
GCTTAGTGCTGAGCACATCCAGTGGGTAAAGTTCCTTAAAATGCTCTGCA
AAGAAATTGGGACTTTTCATTAAATCAGAAATTTTACTTTTTTCCCCTCC
TGGGAGCTAAAGATATTTTAGAGAAGAATTAACCTTTTGCTTCTCCAGTT
GAACATTTGTAGCAATAAGTCATGCAAATAGAGCTCTCCACCTGCTTCTT
TCTGTGCCTTTTGCGATTCTGCTTTAGTGCCACCAGAAGATACTACCTGG
GTGCAGTGGAACTGTCATGGGACTATATGCAAAGTGATCTCGGTGAGCTG
CCTGTGGACGCAAGATTTCCTCCTAGAGTGCCAAAATCTTTTCCATTCAA
CACCTCAGTCGTGTACAAAAAGACTCTGTTTGTAGAATTCACGGATCACC
TTTTCAACATCGCTAAGCCAAGGCCACCCTGGATGGGTCTGCTAGGTCCT
ACCATCCAGGCTGAGGTTTATGATACAGTGGTCATTACACTTAAGAACAT
GGCTTCCCATCCTGTCAGTCTTCATGCTGTTGGTGTATCCTACTGGAAAG
CTTCTGAGGGAGCTGAATATGATGATCAGACCAGTCAAAGGGAGAAAGAA
GATGATAAAGTCTTCCCTGGTGGAAGCCATACATATGTCTGGCAGGTCCT
GAAAGAGAATGGTCCAATGGCCTCTGACCCACTGTGCCTTACCTACTCAT
ATCTTTCTCATGTGGACCTGGTAAAAGACTTGAATTCAGGCCTCATTGGA
GCCCTACTAGTATGTAGAGAAGGGAGTCTGGCCAAGGAAAAGACACAGAC
CTTGCACAAATTTATACTACTTTTTGCTGTATTTGATGAAGGGAAAAGTT
GGCACTCAGAAACAAAGAACTCCTTGATGCAGGATAGGGATGCTGCATCT
.
.
. (~9,000 bases)
.
.
taaaacaaataggggcactgaatagcaagatggacactctagaaaaccaa
attagtgagttagaaaaccagattaaattgaactcagagtaaaaatgata
taattcatgagagtctgaataaaataaatcagaaatggag
2) Download from GenBank (the NCBI website) the sequence of an
adenovirus vector used in recent gene therapy work.
Stratagene, a private company that provides supplies to biological
researchers, sells an adenovirus vector that has been specially
designed for easy cloning, called AdEasy. You can look it up in
GenBank and directly download the sequence (AF334399).
Just go to the GenBank website: http://www.ncbi.nlm.nih.gov/,
Set the Search pulldown menu to “Nucleotide” and type in “AdEasy” in
the Search text box at the top of the page.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Change the “Display” pulldown menu to FASTA and hit the Display button.
Copy the AF334399 sequence to a text file on your computer.
3) Find restriction sites that can be used to clone the HEMA gene into
the AdEasy virus
Strategene has made Adenovirus cloning experiments quite easy by
creating a Multiple Cloning Site (MCS) in their AdEasy vector. This is a
short stretch of DNA sequence that contains several restriction enzyme
sites, which do not occur anywhere else in the vector (unique sites).
So if you cut the vector with any one of these enzymes (or any
combination of two of them), the vector will open up and you can
attach another DNA fragment to the sticky ends. [This may seem like
cheating, but this is the way that almost all molecular biologists
actually work.]
So your job becomes relatively simple – find a restriction site at each
end of the HEMA gene that is compatible with a site in the MCS of the
AdEasy vector. However, you need to find an enzyme that cuts the
HEMA gene only once, in the desired location, and nowhere else, since
you can’t clone the gene if it is cut into bits. The enzyme sites in the
MCS are: Kpn I, Not I, Xho I, Xba I, Eco RV, Hind III, Sal I, and Bgl II.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Also, each of these enzymes produces a sticky end that is compatible
with sticky ends produced by several other enzymes. New England
Biolabs (a commercial producer of restriction enzymes) has created a
nice table of compatible sticky ends on their website:
http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/
compatible_cohesive_overhangs.asp
For example, XbaI ends are compatible with ends cut by Avr II, Nhe I,
Spe I, and Sty I. Also, note that EcoRV produces a “blunt end” with no
sticky overhang. Any blunt end can be joined to any other blunt end.
So any two enzymes that produce blunt ends are compatible. These
are not included in the NEB table of compatible cohesive ends, but
they are listed here: http://rebase.neb.com/cgi-bin/bluntlist
Use the NEBCutter restriction enzyme tool to find restriction sites that
are near the ends of the DNA fragment containing the coding sequence
for the HEMA gene. Paste the entire sequence into the text box on the
NEBcutter web page, then hit the submit button.
http://tools.neb.com/NEBcutter2/
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
Look for enzyme sites near the ends of the sequence. We want to
include most of the 1000 bases of upstream sequence, since this has
the promoter, and at least 500 bp of downstream sequence as a
“terminator” in the sequence that is inserted into the virus vector.
We want to find restriction enzymes that are compatible with the
cloning sites in the adenovirus vector. Also, we want enzymes that cut
at the ends, but not anywhere else in the HEMA sequence – its no
good if we cut our gene into bits when we are trying to clone it into the
vector. The results display in the NEB cutter has an option to show a
list of “1 cutters.” These are enzymes that cut the sequence only one
time.
QuickTime™ and a
TIFF (LZW) decompressor
are needed to see this picture.
You can work backward from the enzymes listed as 1 cutters. Find
enzymes that cut near the ends, check if they are on the list of
enzymes in the MCS, or if they form sticky ends compatible with an
enzyme in the MCS. If you click on each enzyme in the NEBcutter
display, it will take you to a page that shows what type of sticky end it
produces and a list of other enzymes that create compatible ends.
Remember to also check for enzymes that make blunt ends that can
be joined with the Eco RV site in the AdEasy vector.
If you can’t find a suitable enzyme site at one end of the HEMA gene,
go back to the Genome Browser and extend the sequence by adding
more bases to the Upstream or Downstream ends.
Questions
1) What enzymes did you use to cut the HEMA gene? Where do
these enzymes cut? Show a map of your sequence with the
enzyme sites that you will use for cloning.
2) How long is the fragment you will be inserting into the vector?
3) Some researchers have found that the Adenovirus vector
works best if it has exactly 30 kb inserted. How might you
increase the size of the inserted fragment to 30 kb? What are
the risks of this plan?
4) Once you have cut and ligated the HEMA gene into the
AdEasy vector, how will you test this construct before you
inject it into humans?
5) This engineered adenovirus is supposed to produce
coagulation factor VIII. What cells in the human body normally
produce this protein? Design a hypothetical experiment to test
the ability of your gene therapy vector to produce factor 8 in
these cells.