Download Environmental Pollution

Environmental Pollution 146 (2007) 478e491
www.elsevier.com/locate/envpol
Prokaryotic life in a potash-polluted marsh with emphasis
on N-metabolizing microorganisms
Sascha Eilmus, Christopher Rösch, Hermann Bothe*
Botanical Institute, The University of Cologne, Gyrhofstrasse 15, D-50923 Köln, Germany
Received 27 April 2006; received in revised form 6 July 2006; accepted 10 July 2006
Characterization of a prokaryotic community of a potash marsh provided information on the occurrence
of many unusual prokaryotes and their horizontal distribution.
Abstract
Prokaryotic life along the salt gradient of the potash marsh resulting from mining waste at Schreyahn, Northern Germany, was screened for
the distribution of total prokaryote (assessed by the 16S rRNA gene) and of N2-fixing (nifH gene), denitrifying (nosZ ) and nitrifying (amoA)
microorganisms. Information on prokaryotes was retrieved from the different soil sites (a) by culturing in conventional media, (b) by isolating
the DNA, amplifying the target genes by PCR followed by sequencing, (c) by employing the recently developed computer program (TReFID
[Rösch, C., Bothe, H., 2005. Improved assessment of denitrifying, N2-fixing, and total-community bacteria by terminal restriction fragment
length polymorphism analysis using multiple restriction enzymes. Applied and Environmental Microbiology 71, 2026e2035]) based on tRFLP
data. New sequences were obtained as well as ones that were almost identical to those found at far distant locations. Whereas the distribution of
plants strictly follows the salt gradient, this is apparently not the case with prokaryotes. Bacteria of hypersaline areas coexist with salt-non-tolerant species. The recently developed TReFID program is successfully applied to characterize a prokaryote community structure.
Ó 2006 Elsevier Ltd. All rights reserved.
Keywords: Prokaryotic community analysis; Computer program for assessing biodiversity; Bacteria in saline soils; Denitrification; Dinitrogen fixation; Nitrification; Bacteria in potash mining waste
1. Introduction
In saline habitats, halophilic organisms occur which are
strictly dependent for their growth on a high salt concentration.
Others can resist salt stress and are confined to salt marshes due
to their low competitiveness elsewhere. This is true for both
microorganisms (Oren, 1999) and higher plants (Ellenberg,
1988). The latter show impressive belt formations dependent
on the soil salt concentration at all marshes throughout the
world. In Western and Continental Europe, Salicornia europaea
L. (glasswort or marsh samphire) can cope with the highest salt
concentration and often forms monocultures in high salt soils.
* Corresponding author. Tel.: þ49 221 470 2760; fax: þ49 221 470 5039.
E-mail address: [email protected] (H. Bothe).
0269-7491/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved.
doi:10.1016/j.envpol.2006.07.008
The next most tolerant belt is formed by Puccinellia spp., being
P. maritima (Huds.) Parl. (common salt marsh grass) on the
Atlantic coast, P. distans (Jacq.) Parl. (reflexed salt marsh grass)
on German inland salt marshes and P. limosa (Schur) E. Holmb
(swamp salt marsh grass) on the Hungarian plain. Soils with
lower salt contents are often dominated by Aster tripolium
L. (salt aster), which, however, shows a somewhat broader
range of distribution because it can thrive on wetter and drier
stands with higher or lower salt contents (Ellenberg, 1988).
As known in plant sociology, these belt formations are independent of the salt type, thus irrespective of NaCl, Na2SO4 or
K2CO3 dominating in soils. Due to the capacity of the ions
to bind water, salt marsh soils have an extremely negative
water potential, and halophytes have to endure extended
periods of drought. As noted early by botanists (Stocker,
1928), stress caused by drought rather than by the salt itself
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
479
and its type is the major cause of belt formation of halophytes in
salt marshes.
The characterization of prokaryotic life in hypersaline environments has recently been a centre of interest in microbial
ecology (Oren, 2002; Øvreås et al., 2003) and has revealed
a high diversity of organisms from various taxonomic affiliations (see Section 4). It has, however, not yet been examined
whether the distribution of prokaryotes follows that of plants
and is also dictated by the gradient in the salt concentration
(or better in the water potential) in salt marshes. The current
study aims at characterizing prokaryotic life in the soil around
a potash mine at Schreyahn, Wendland, in Northern Germany.
This heap originates from the residuals of below-ground mining performed between 1905 and 1926 (Horst and Redel,
1977). The soil surrounding this heap supports the typical
belt formation of plants dependent upon the salt concentration,
with a surprisingly high richness of different halophytes. Soil
samples were taken from the roots of the belt indicators
S. europaea, P. distans and A. tripolium, from the plant-free,
central area and from the heap itself. Prokaryotic life in the
samples was analysed by several methods. (a) Bacteria were
grown in conventional media, and their DNA was extracted
for PCR amplifications of the 16S rRNA gene (for total bacterial community) and of genes coding for characteristic
enzymes of the nitrogen cycle: nifH (nitrogenase reductase),
nosZ (N2O-reductase of denitrifiers) and amoA (ammonium
monooxygenase of nitrifiers). (b) DNA was extracted directly
from the soil samples for generating PCR-amplicons of the
above-mentioned target genes. This method provided a clone
library, and sequencing revealed information on new prokaryotes which grouped mainly next to uncultured microorganisms.
However, due to the high diversity of approximately 104 ribotypes (wdifferent bacteria) in soils (Torsvik et al., 1990),
such groups of independent sequences provided by methods
a and b do not permit, by any means, to comprehensively assess
the bacterial community structure. (c) DNA extracted from the
soil samples was, therefore, used to generate tRFLP profiles
for identifying prokaryotes utilizing the recently developed
TReFID program (Rösch and Bothe, 2005). By using up to 13
restriction enzymes, DNA fragments labelled with a fluorescence dye (tRFs) were generated from the soil sample. The
computer assignment tool TReFID screens for the presence of
a pattern specific for any bacterium among the current 22,145
entries in the TReFID database in the collection of the tRFs
of the soil. The search for organisms retrieved from the TReFID
database was then extended to all soil samples taken from the
zone indicator plants or from the bulk soil to assess the distribution of prokaryotes in dependence on the salt load.
the microbial community structure along a transect from lowest to highest
salt load. There was no litter or biofilm on top of the soil and no visible stratification in the upper 10 cm. From the samples taken, small stones and roots
were removed by hand, and otherwise the material was homogeneous enough
so that sieving was not necessary. Samples were brought to the Cologne laboratory in cooling boxes, thoroughly mixed and used for DNA extraction as soon
as possible. Storage of the samples at 4 C did not exceed one day. The pH
values and the electric conductivities of the samples from all sites other than
the heap were determined in aqueous extracts, using the Multi 430i electrode
of the Wissenschaftliche Technische Werkstätten company, D-82362 Weinheim, Germany. Since the heap consisted of pure salt, mainly K2CO3, its pH
and conductivity were not determined.
2. Materials and methods
PCR products from several independent experiments were separately purified with the MinElute gel extraction kit (Qiagen, Hilden, Germany) and
cloned using the pGEMT Easy vector system (Promega, Mannheim, Germany). Randomly chosen clones were sequenced with a BigDye terminator cycle sequencing kit version 1.1 (Applied Biosystems, Weiterstadt, Germany)
and an ABI 3100 automatic sequencer (Applied Biosystems). Raw sequences
were processed in BioEdit 5.09 and evaluated by BlastN, ClustalX alignments
and ChimeraCheck. The references for all these methods are given in (Rösch
and Bothe, 2005).
2.1. Soil sampling and soil parameters
Soil samples from the Schreyahn potash marsh (52 550 5300 N, 11 040 3600 E)
were taken from the upper 10 cm of the middle part of the A. tripolium,
P. distans or S. europaea vegetation zones (about 1 kg per zone which was
enough to represent each zone). Additionally, samples from the central, plant
free mud zone and from a potash heap were taken to obtain information on
2.2. Culture conditions for the growth of bacteria
from soil samples
To obtain bacterial isolates, an inoculating loop of the soil samples was
streaked on agar or Gelrite (Roth, Karlsruhe, Germany) plates containing
either LB or YEMþ media containing in g per litre: mannitol 8, glucose 2,
Bacto-Trypton 0.4 (Roth Roth), yeast-extract 0.4 (AppliChem, Darmstadt),
K2HPO4 0.5, MgSO4 $ 7H2O 0.4, NaCl 0.1, 1 ml trace element solution SL8
(Rösch, 2005). To selectively enrich halophilic, heterotrophic bacteria, plates
were supplemented with the following chemicals containing in g per lire: yeast
extract 5, Bacto Trypton 5, Naþ-glutamate 1, KCl 2, Naþ-citrate 3,
MgSO4 $ 7H2O 20, NaCl, variable, up to 180, FeCl2 $ 4H2O 0.036, and trace
elements SL8 (Pfennig and Trüper, 1981) 5 ml. Media were supplemented
with cycloheximide (1 mg/ml medium) to prevent growth of fungi or protozoa.
Ammonium-oxidizing bacteria (AOB) were grown in liquid cultures kept in
the dark in a strictly inorganic medium containing in g per litre: (NH4)2SO4
0.5, MgSO4 $ 7H2O 0.04, CaCl2 $ 2H2O 0.04, K2HPO4 0.2, and the SL8 trace
elements 1 ml, and the liquid was then removed by centrifugation. For the
others, plates were incubated at 30 C until colonies were clearly visible by
eye. They were then suspended in distilled water and used directly for PCR
amplifications of the target gene segments described below.
2.3. Extraction of prokaryotic DNA and PCR amplifications
DNA of the soil samples was extracted with the UltraClean Soil DNA kit
from MoBio, Solana Beach, CA. The DNA preparation was used as a template
for amplifying the genes 16S rRNA (for assessing the total prokaryotic community), nifH (N2-fixing microorganisms), nosZ (denitrifiers) or amoA (nitrifiers). For the first three genes, the primers were exactly the same as those
used in the preceding publication (Rösch and Bothe, 2005). For amplifying
gene segments the primers taken were: amoA-1F/amoA-1R (Rotthauwe
et al., 1997) for amoA, AOB-F1: GGTGAGTAATGCATCGGAACG, AOBR1: TGGCAACCCTCTGTACGCG for 16S rRNA of AOB and 1A(F)/
1100A(R) (Lopez-Garcia et al., 2001) for Archaea 16S rRNA. Hot start
PCRs in a 25 ml volume utilized the MasterTaq kit (Eppendorf, Hamburg, Germany) followed by touch-down time programs of 40 cycles in a Personal
Cycler (Biometra, Göttingen, Germany). Annealing temperatures decreased
stepwise from 66 to 56 C for amplifying the 16S rRNA gene segment and
from 65 to 50 C for nifH, nosZ and amoA. All procedures were performed
according to Rösch and Bothe (2005) and Rösch (2005).
2.4. Construction and analysis of the clone library
from DNA of the environmental samples
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
480
Phylogenetic trees were constructed using the Neighbour Joining (PHYLO_WIN; Galtier et al., 1996) and Maximum Likelihood (DNAMLK from
the Phylip 3.63 software package; Felsenstein, 2004) methods. In the first
step, the BlastN results of all Schreyahn sequences served as reference sequences for the construction of preliminary Neighbour Joining trees. The
Maximum Likelihood trees (Figs. 1e4) were calculated with default
-0.034
0.1
parameters (DNAMLK, 10 replicate trees, the method finally provides the
most likely tree without bootstrap values) and represent refinements of the
former trees as the remaining reference sequences are the ones that allow
the best classification of the Schreyahn clones. In the case of the 16S
rDNA phylogram, reference sequences were deleted after the calculation to
ensure readability.
AY795723
AY795660
AY795681
AY795760
AY795761
AY795726
AY795645
AY795765
AY795759
AY795743
AY795636
AY795666
AY795711
AY795768
AY795764
AY795662
AY795730
AY795669
AY795766
AY795745
AY795758
AY795725
AY795689
AY795710
AY795692
AY795737
AY795740
AY795673
AY795728
AY795738
AY795656
AY795651
AY795722
AY795701
AY795731
AY795668
AY795628
AY795718
AY795719
AY795679
AY795712
AY795713
AY795695
AY795749
AY795744
AY795638
AY795646
AY795640
AY795724
AY795717
AY795754
AY795753
AY795696
AY795648
AY795633
AY795729
AY795650
AY795658
AY795654
AY795635
AY795698
DQ177841
DQ177854
DQ177857
DQ177848
DQ177856
DQ177865
DQ177863
DQ177842
DQ177866
DQ177860
DQ177868
DQ177862
Methylobacter
Alphaproteobacteria
Brevundimonas
Roseovarius
Sphingomonas
Hydrogenophaga
Betaproteobacteria
Halomonas
Gammaproteobacteria
Gemmatimonadetes
Nitrospira
Nitrospira
Streptomyces
Streptomyces
Streptomyces
Actinobacteria
Bacillus
Bacillus
Bacilli
Cyanobacteria
Bacteroidetes
Planctomycetacia
Halobacteria
(Euryarchaeota)
Fig. 1. Phylogram of the 16 S rRNA gene sequences retrieved from the potash marsh at Schreyahn. In total, 71 sequences were obtained by cloning and sequencing
the PCR products obtained from DNA either extracted directly from the soil or from cultured bacteria of soil samples. The phylogram (Maximum Likelihood tree)
refers to positions N64 to 618 in E. coli K12 rrsH (GenBank accession no. NC000913). Only the own sequences obtained are shown here.
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
481
Methylobacter vinelandii INMI 87 (AF484676)
0.1
Vibrio diazotrophicus ATCC33466 (AF111110)
Azotobacter chroococcum (M73020)
Azomonas agilis ATCC7494 (AF216883)
Klebsiella pneumoniae 342 (AY242355)
Schreyahn AY795616 Aster tripolium
Schreyahn AY795615 Puccinellia distans
Schreyahn AY795610 Salicornia europaea
Alcaligenes faecalis (X96609)
uncultured organism SE1 (AF414642)
Schreyahn AY795618 Salicornia europaea
Schreyahn AY795617 Salicornia europaea
Schreyahn AY795619 Salicornia europaea
Schreyahn AY795626 Salt mud
Schreyahn AY795623 Puccinellia distans
uncultured organism Sp1-1 (AY091856)
Mesorhizobium mediterraneum Rch-9865 (AJ457917)
Rhizobium gallicum R602sp (AF218126)
Sinorhizobium sp. GR-X8 (AF275670)
Sinorhizobium sp. Rch9868 (AJ457920)
Herbaspirillum seropedicae Z78 (Z54207)
Rhodobacter capsulatus (X63352)
Azospirillum brasilense (M64344)
uncultured organism G3 (AF216915)
Bradyrhizobium japonicum IAM 12608 (AB079619)
Schreyahn AY795627 Salicornia europaea
Frankia alni ArI3 (L41344)
Anabaena variabilis ATCC29413 (U89346)
Nostoc commune (L23514)
Fig. 2. Phylogram of nifH coding for dinitrogenase reductase retrieved from the potash marsh. The own sequences in this Maximum Likelihood tree are shown in
bold. The alignment refers to the positions N57 to 414 in Azotobacter vinelandii (M73020).
New sequences from Schreyahn were deposited in GenBank
(www.ncbi.nlm.nih.gov), accession numbers: 16S rRNA gene Bacteria:
AY795628 to AY795769; 16S rRNA gene Archaea: DQ177841 to
DQ177872; amoA: AY795796 to AY795821; nifH: AY795610 to AY795627;
nosZ: AY795770 to AY795795. Details on the origin of individual sequences
can be obtained from the sequence’s annotations in GenBank.
2.5. tRFLP analysis
For tRFLP experiments the PCR primers 63f (16S rRNA gene), nifH-F and
nosZ-R were labelled with the fluorescence dyes JOE, FAM and TAMRA,
respectively (MWG Biotech, Ebersberg, Germany). Otherwise PCR was performed as described for the construction of clone libraries. The labelled
PCR products were purified (QiaQuick spin columns, Qiagen, Hilden, Germany), partitioned and aliquots were subjected to restriction digests using
up to 13 enzymes in parallel. The restriction enzymes employed were AluI,
Bme1390I, Bsh1236I, BsuRI ( ¼ HaeIII), Cfr13I, Hin6I, HinfI, MboI, MspI,
RsaI, TaiI, TaqI and TasI (all Fermentas, St. Leon-Roth, Germany). Digests
were performed overnight in 100 ml volumes at the optimal enzymes’ temperature. The restriction fragments were precipitated and dissolved in 10 ml of
water. Prior to analysis on an ABI 377 Automatic Sequencer (Applied Biosystems), 2.5 ml of the fragment solution were mixed with 1.0 ml formamide
(deionized), 1.0 ml loading buffer (Applied Biosystems) and 0.5 ml GeneScan
500 ROX size standard (Applied Biosystems). Raw data were handled with the
GeneScan 3.1.2 software (Applied Biosystems).
The tRFLP analysis using multiple restriction enzymes was performed by
use of the TReFID program ( ¼ terminal restriction fragment identifying program; http://www.trefid.net) exactly as described in detail in the preceding
publication (Rösch and Bothe, 2005). The TReFID data base currently comprises 22,145 entries for the 16S rRNA gene, 1318 for nifH and 607 for nosZ.
A TReFID analysis resulted in a list of sequences representing organisms
occurring in the Schreyahn samples. These TReFID results were analysed on
the level of tRF patterns (see Rösch and Bothe, 2005), i.e. not on the basis of
single sequences, but on the basis of groups of sequences, which are indistinguishable regarding their tRF patterns. The latter generally concerns sequences
of closely related organisms, while unrelated organisms yield different tRF
patterns. Concerning the 16S rRNA gene, these sequences were taxonomically
classified (RDP II Classifier, http.//rdp.cme.msu.edu/classifier/classifier.jsp)
and analysed on the level of prokaryotic classes (refer to Fig. 5, for example).
For the Aster, Puccinellia and Salicornia samples, the proportions of tRF patterns occurring in any two or all three samples were determined by comparing
the TReFID result lists.
3. Results
3.1. Parameters of soil samples taken from the potash
marsh
The pH values of the soil samples from the Schreyahn
potash mine varied between 7.3 and 8.4 (Table 1). Since
the pH of the non-polluted soils in the vicinity of the
Schreyahn village was between 5 and 6, the high values
in the surrounds of the K2CO3 heap had presumably resulted from the out-washings of the salt by rainfall. Among
land plants, S. europaea is known to endure the highest salt
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
482
Schreyahn AY795795 Salicornia europaea
0.05
Schreyahn AY795794 Salicornia europaea
Schreyahn AY795772 Aster tripolium
Schreyahn AY795770 Aster tripolium
Schreyahn AY795776 Puccinellia distans
uncultured organism HJALFZG09 (AY259200)
uncultured organism CZ1496 (AY072231)
uncultured organism CZ1439 (AF315443)
Bradyrhizobium japonicum USDA 110 (AJ002531)
Schreyahn AY795773 Aster tripolium
Sinorhizobium meliloti JJ1c10 (U47133)
Ochrobactrum anthropi LMG 3331 (AY072229)
Achromobacter xylosoxidans NCIMB 11015 (AY072227)
Azospirillum liporerum Sp59b (AF361793)
Azospirillum halopraeferens Au4 (AF361794)
Azospirillum brasilense Sp7 (AF361791)
uncultured organism S321195A (AF016055)
Schreyahn AY795784 Puccinellia distans(6 sequences)
Pseudomonas stuzeri (M22628)
Schreyahn AY795777 Aster tripolium(2 sequences)
Pseudomonas stuzeri A15 (AF361795)
Pseudomonas aeruginosa DSM 50071 (X65277)
Pseudomonas fluorescens C7R12 (AF197468)
Pseudomonas sp. MT-1 (AB054991)
Pseudomonas denitrificans (AF016059)
Schreyahn AY795782 salt mud
Schreyahn AY795785 salt mud
Schreyahn AY795787 salt mud
Paracoccus denitrificans Pd1222 (AJ010260)
Achromobacter cycloclastes ATCC 21921 (AF047429)
Rhodobacter sphaeroides IL106 (AF125260)
Fig. 3. Phylogram of nosZ coding for nitrous oxide reductase of denitrification retrieved from the potash marsh. The alignment refers to the positions N1232 to
1889 in Paracoccus denitrificans (X74792).
loads (Ellenberg, 1988), indicated also at Schreyahn by the
high electric conductivity (EC) data (Table 1). Soils samples
taken from the roots of A. tripolium had higher EC values
than those from P. distans (Table 1), which is also occasionally found in soils of coastal NaCl marshes, although
the opposite is more frequent (not documented). In two independent determinations with standard deviations of less
than 10%, the number of bacterial colony forming units
on YEM þ Gelrite plates was roughly three times higher
0.1
at the roots of A. tripolium (1.3 106) than at those of
S. europaea (4.4 105), referred to g of soil.
3.2. 16S rRNA gene sequences retrieved from enrichment
cultures or by PCR amplifications of the DNA extracted
from the soil samples
The 16S rRNA gene sequences obtained for Archaea/Bacteria are listed in Fig. 1 and Table 2. Using the primers 1AF
Schreyahn AY795796 to
Schreyahn AY795819 (25 sequences)
S. europaea, salt mud and vegetation
free zone
Schreyahn AY795820 Aster tripolium
Nitrosospira multiformis (AF042171)
Nitrosospira briensis (U76553)
Nitrososvibrio tenuis (U76552)
Nitrosomonas sp. (AF327919)
Nitrosomonas sp. (AF327918)
Nitrosomonas sp. (AB031869)
Nitrosomonas europaea (L08050)
Nitrosococcus (AF153344)
Nitrosococcus (AF047705)
Fig. 4. Phylogram of amoA coding for ammonium monooxygenase of nitrification retrieved from the potash marsh. The alignment refers to the positions N344 to
825 in Nitrosomonas europaea (L08050).
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
483
Fig. 5. Percentage of prokaryotic classes in the total communities of five Schreyahn soil samples. DNA was isolated from soil surrounding S. europaea, A. tripolium
and P. distans as well as from the mud and heap. It was then subjected to tRFLP analysis using up to 13 restriction enzymes and fluorescence dyes (see Section 2).
The total 16S rDNA tRFLP patterns which were found in the TReFID data base were set to 100% in each case. Two independent PCR amplifications were performed with the DNA isolated from S. europaea and P. distans (experiments A and B).
and 1100 AR specifically designed for amplifying the 16S
rRNA gene of Archaea (Lopez-Garcia et al., 2001), altogether
32 sequences related to extreme halophilic and alkaliphilic
Archaea were obtained from the soil samples surrounding
A. tripolium, P. distans, S. europaea, the vegetation-free
zone and mud, but not from the heap. Sequences with close
homologies to the euryarchaeota Halorubrum (1 sequence),
Haloferax (2), Halosimplex (2), to the alkaliphilic Natronococcus (2) and Natronomonas (1) as well as to 24 other members
of the Halobacteriaceae with no affiliations to known genera
were retrieved. Seven other sequences were closely clustered
with each other but had no counterpart, not even on the genus
level, to deposits in GenBank. They did not cluster with the
uncultured monophyletic groups I and II of Archaea which
have been found in almost all marine samples so far analysed
(Munson et al., 1997). Remarkably, three sequences
Table 1
Parameters of the K2CO3 soil in Schreyahn/Wendland of Northern Germany
Soil sample
taken from
Roots of
Puccinellia distans
Roots of
Aster tripolium
Roots of Salicornia
europaea, outer zone
Roots of Salicornia
europaea, inner zone
Vegetation-free zone
Salt mud
No. of
determinations (n)
a
Average electric
conductivity
(mS/cm)a
Corresponding
to NaCl
salinity
pH value
6.2 0.3
0.4%
7.90 0.06
11.5 1.5
0.75%
7.77 0.06
17.2 2.3
1.1%
7.62 0.02
37.9 3.6
2.5%
7.68 0.01
29.1 0.9
82.1 4.9
4
1.9%
5.3%
7.37 0.04
8.42 0.02
3
Determination at 25 C. 1 mS/cm corresponds to about 0.065% salinity
(for NaCl; Marschner, 1986). The salinity in the North Atlantic is about
3.5%, for comparison. Standard deviations are given.
(DQ177842, DQ177853, DQ177856) of the Halobacteriaceae
but with no affiliations to genera were found in the soil samples taken from the roots of A. tripolium, this being the site
with a lower salt load.
The general primers of the 16S rRNA gene (27F/1495R)
enabled us to amplify several sequences of bacterial clones
from the Cytophaga-Flavobacterium-Bacteroides (CFB)
group, the gemmatimonadetes, two cyanobacteria (with
weak sequence homology to the Oscillatoria group) and
from the nitrite-oxidizing Nitrospira marina (one case, found
in a sample from A. tripolium).
Nineteen sequences (mostly from the vegetation free zone)
detected were closely related to a-proteobacteria, among
which the phototrophs Rhodovulum and Roseovarius of the
Rhodobacteriaceae prevailed. Remarkably, the genus Loktanella, which was first described in 2004 in biofilms of Antarctic lakes (Van Trappen et al., 2004), was identified several
times both in clones after growth in AOB medium and in
DNA sequences from soil samples of Schreyahn.
Sequences related to b-proteobacteria were rare (12
sequences: AY795684 to AY795692, AY795706, AY795710,
AY79572). They were mainly obtained with AOB SSU
primers and formed a distinct own group related to noncultured bacteria of which only sequences have been deposited
as yet (for example AF358001). In contrast, g-proteobacteria
sequences occurred more abundantly, with some clustering
with the genus Halomonas of saline habitats, but with the
major part being unknown, having some relatedness
(<95% homology) to Fe- and S-oxidizing bacteria. Whereas
d-proteobacteria related to marine members of the Myxococcales could be retrieved, no sequence originated from
Acidobacteria.
Finally, Gram-positive bacteria, most of them related to the
Bacillus macroides group, could be detected in enrichment
cultures. When the media were supplemented with NaCl, the
484
Table 2
Sum of the 16S rRNA gene sequences retrieved from soil DNA or from isolates of the Schreyahn potash marsh
Prokaryotic group
Aster tripolium
Salicornia europaea
Vegetation-free zone
Mud
16SrRNA
nifH
nosZ
amoA
16SrRNA
nifH
nosZ
amoA
16SrRNA
nifH
nosZ
amoA
16SrRNA
nifH
nosZ
amoA
16SrRNA
nifH
nosZ
amoA
24
3
5
9
0
57
8
5
5
1
48
5
6
5
8
48
6
0
0
10
11
10
7
4
0
2
1
1
2
2
6
11
2
4
1
11
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
Total
Archaea (32)
Halorubrum (1)
Haloferax (2)
Halosimplex (2)
Natronococcus (2)
Natronomonas (1)
Other
Halobacteriaceae (24)
Planctomycetacia
CFB-group
Gemmatimonadetes
Actinobacteria
Streptomyces (3)
Cyanobacteria
Bacilli
Bacillus (1)
Halobacillus (1)
Nitrospira
Nitrospira (1)
a-Proteobacteria
Methylobacterium (1)
Sphingomonas (1)
Roseovarius (1)
Antarctobacter
(1; 92% sequence
homology)
Loktanella
(2; 97% sequence
homology)
Other
Rhodobacteriaceae (2)
Brevundimonas (2)
Rhizobiaceae (16)
b-Proteobacteria
Hydrogenophaga (1)
g-Proteobacteria
Halomonas (2)
Ectothiorhodospirillaceae (2)
d-Proteobacteria
Non-identified sequences
Puccinellia
2
2
1
4
2
1
1
1
6
1
10
1
11
8
27
1
8
10
1
6
1
10
2
2
2
1
18
3
4
3
The number in parentheses indicates how often the prokaryotic group was found.
5
6
5
2
2
4
1
7
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
sequences retrieved were closely related to Halobacillus
salinus, H. locisalis and H. trueperi. Of the Gram-positive bacteria only one sequence showed a higher divergence (3.9%)
from all the other Halobacillus sequences retrieved and thus
stood apart. Actinobacteria with affiliations next to Streptomyces lavendulae, S. maritima and S. griseus were also found.
Cyanobacteria were apparently not dominant in Schreyahn,
and no mats with typical cyanobacteria were detected. This
may explain why only two sequences related to the Oscillatoriales were retrieved.
3.3. Functional gene sequences retrieved from
enrichment cultures or by PCR amplifications
of the DNA extracted from the soil samples
Regarding the nifH sequences obtained from soil DNA
(Fig. 2), one of these clustered next to Bradyrhizobium japonicum and another one to Klebsiella pneumoniae. The other sequences fell into two separate groups with no affiliations to
deposits in GenBank. Group 1 consisted of 10 distinct entries,
and group 2 of 6. Several of these sequences were retrieved
more than once (Fig. 2; AY795610: 5 times; AY795626: 3;
AY795623: 4).
The amplified nosZ sequences (Fig. 3) clustered next to
Pseudomonas, rhizobia or to a group of uncultured bacteria
(Scala and Kerkhof, 1998; Rösch et al., 2002). However, all
sequences from Schreyahn represent novel nosZ lineages not
found in present in databanks.
Altogether 32 sequences for amoA, from the soil of S. europaea, A. tripolium, the vegetation-free zone and the salt heap,
showed divergences of less than 2% from each other, and all
might have originated from a non-described b-proteobacterium. On 449 bp which could be exploited because of the overlaps in both entries, these sequences were 98.2% homologous
to the deposits AY353051 and AY353054 (Francis et al.,
2003), In addition, a single sequence (from the A. tripolium
soil) of a separate branch, was obtained which showed weak
homology to the AF489631 deposit of a marine bacterium
(Nicolaisen and Ramsing, 2002).
3.4. Putative classifications of the organisms retrieved
from the different soil samples by using the newly
developed TReFID databank
To get an estimate on the quantitative distribution of prokaryotes in the soil samples selected at Schreyahn, all
22,145 16S rRNA gene tRF (terminal restriction fragments)
in the TReFID databank were screened for their occurrence
in the sum of tRFs generated from the soil DNA using the algorithm described (Rösch and Bothe, 2005). From one sample
to the next, the total number of tRF patterns retrieved was
rather different (e.g. 400 and 727 for P. distans and 98 or
1440 for S. europaea), but the relative distribution of the different prokaryotic groups was remarkably similar irrespectively from which zones the soil samples were selected
(Fig. 5). The percentage of a-proteobacteria was always
very high, followed by the g-proteobacteria. In contrast, the
485
relative amounts of b-proteobacteria and Acidobacteria were
low. In all samples the percentage of bacteria with only
sequence deposits in GenBank but with no affiliations to
known bacterial classes was under 10% and thus relatively
low. Even at the sites of the highest salt load (heap, mud),
a- and g-proteobacteria were major constituents of the tRF
patterns retrieved. Gram-positive bacteria (bacilli) were not
detected in the TReFID analyses of any of the soil samples examined. The abundance of different bacterial groups probably
decreased with the increase in the salt load, suggested by the
cfu determinations. The number of samples analysed does
not permit any such conclusion from the TReFID analyses.
The distribution pattern just described is a special feature of
the Schreyahn soil (Table 3). The high percentage of a-proteobacteria and to some extent also of g-proteobacteria was not
reported in 14 publications on non-saline sites which were
examined (the references are given in the legend to Table 3),
and particularly not in the forest soil examined by us by comparable methodology (Rösch et al., 2002). Deposits of aproteobacteria are not overrepresented in the TReFID databank or GenBank. Table 3 also indicates that Acidobacteria
which are common in most other soils occur only in low percentages in the Schreyahn samples. Thus the TReFID program
allows us to assess the relative distribution of a prokaryotic
group in an environmental sample.
Analysis of the TReFID results enabled us to determine the
percentage of prokaryotes which could be retrieved from the
samples taken from any two plants or even from all three
plants (Fig. 6). Among the 1639 unique tRF patterns found
in total by use of the TReFID program, 50% came from
S. europaea, 22% from P. distans, 13% from A. tripolium
and 5% from soil surrounding all three plants. These were almost exclusively a- and g-proteobacteria with, in addition,
some unclassified bacteria. The overlap between sequences retrieved from soils surrounding S. europaea (sites of the highest
salt load) and P. distans (lowest salt load) was 22% with again
a high percentage of common a-proteobacteria. Similar high
values were determined for the other two plant combinations
(A. tripolium and S. europaea or A. tripolium and P. distans,
respectively). This might indicate that the distribution of prokaryotes does not follow so strictly the salt content as in the
case of the plants. Sequences of true halophilic bacteria like
Halomonas (AY795740) or Nitrospira marina (AY795679)
were retrieved from soil samples taken from all three plants.
It is also noteworthy that up to 50% of the sequences, which
were obtained by us by cloning and sequencing of PCR products of Schreyahn soil samples and which then had been deposited into the TReFID databank, were retrieved in the tRF
analysis of Schreyahn soil samples using the TReFID data
basis and its algorithm.
The finding that the distribution of bacteria in the
Schreyahn potash marsh did not so strictly follow the salt
content was even more evident when the same analysis
was applied to the two genes nifH (Table 4) and nosZ (Table 5). However, the entries for nifH (1318) and nosZ (607)
in the TReFID database are low compared to those for the
16S rRNA gene (22,145). In the case of nifH, the number of
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
486
Table 3
Relative abundance (in %) of bacterial groups commonly detected in soil microbial communities and in Schreyahn
Group name
rDNA dataa
Schreyahn assessed
by TreFIDb
Total bacterial sequences
in TReFID (%)c
Sequences deposited
in GenBank (%)d
Proteobacteria
a-Subdivision
b-Subdivision
g-Subdivision
d-Subdivision
Acidobacteria
Verrucomicrobia
Bacteroidetes
Actinobacteria
Firmicutes
Planctomycetes
Cyanobacteria
Chlorobi
Aquificae
Nitrospira
10 14
46
5 11
12
32 23
55
66
7 13
10 14
12
11
<<1
<<1
01
63.7 9.0
2.2 2.8
16.2 8.0
0.3 0.3
1.0 0.9
0 0.0
1.5 1.0
1.9 3.0
1.0 1.3
0.3 0.3
1.0 1.1
0.6 0.6
0.3 0.4
0.3 0.5
9.5
8.3
11.7
1.0
2.4
0.6
9.3
7.9
9.0
1.7
5.0
0.3
0.5
0.4
8.8
5.9
13.7
2.4
0.7
0.4
3.9
10.1
10.0
0.7
2.9
0.2
0.3
0.2
For comparison see also the recently published review by Janssen (2006). The table contains standard deviations.
a
Data from Borneman et al., 1996; Borneman and Triplett, 1997; Kuske et al., 1997; Dunbar et al., 1999, 2002; McCaig et al., 1999; Nogales et al., 2001;
Axelrood et al., 2002a,b; Krave et al., 2002; Rösch et al., 2002; Joseph et al., 2003; Liles et al., 2003; Demba Diallo et al., 2004.
b
Aster, Puccinellia (2) and Salicornia (2) samples, thus altogether 5 samples.
c
21,534 entries in TReFID database.
d
150,706 entries in GenBank as of February 2005.
unidentified bacteria with only sequence deposits (Table 4)
amounted to over 50% in all soil samples taken from the
different sites in Schreyahn (Table 4). Known halophilic
N2-fixing bacteria could not be identified here. Somewhat
to our surprise, the Schreyahn samples contained a significant portion of bacteria, which we recently identified by
cloning and sequencing, from a non-saline forest soil in
the vicinity of Cologne, some 400 km away from Schreyahn
(Rösch, 2005; Rösch and Bothe, to be published). These sequences deposited in GenBank were not related to those of
known, cultured N2-fixing bacteria and could, therefore, not
be affiliated. Among these, a sequence (termed OTU
30 ¼ operational taxonomic unit 30) in the phylogenetic
analysis, occurred everywhere in the Schreyahn soil samples
analysed, and OTU 24 and 29 were found at almost all sites
(Table 4).
Due to the limited numbers of entries for nosZ in TReFID,
only few sequences of this gene could be retrieved from the
tRFs obtained from DNA isolated from soil surrounding the
different plants at Schreyahn (Table 5). The number of tRF
patterns corresponding to unidentified organisms (where only
sequences have been deposited in the databanks) was between
10 and 38% and thus not as high as those containing nifH.
Some sequences closely matched those of well-characterized
bacterial genera (Ochrobactrum, Achromobacter, etc). The detection of the halophilic Azospirillum halopraeferens in three
soil samples (from A. tripolium, P. distans and the heap)
was particularly noteworthy. Sequences related to deposits obtained from DNA of the Cologne forest soil were also obtained
in the analysis of nosZ. Also with this gene, several bacteria
were retrieved in the soil sample that had been found in the
clone library and deposited in TReFID beforehand. Similar
to other bacteria the distribution of those with nosZ also
seemed independent of the salt gradient, in clear contrast to
the plant sociological behaviour.
4. Discussion
Most alkaliphilic sites are confined to dry areas with high
evaporation rates and have pH values around 10 (Sorokin and
Kuenen, 2005) and organisms that colonize such sites must be
Fig. 6. Intersecting set of prokaryotes referred to the 16S rRNA gene that were
retrieved from soils surrounding S. europaea, A. tripolium and P. distans.
100% refers to the sum of the sequences retrieved from the soil samples in total by using the TReFID database.
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
487
Table 4
Pattern in the nifH distribution in soil samples taken at Schreyahn
Prokaryotic group
A. tripolium
A. tripolium
P. distans
S. europaea
S. europaea
Mud
Heap
Total tRF patterns
retrieved in TReFID ( ¼ 100%)
Unidentified sequences
(sequence deposits only
available in the databanks)
Beijerinckia
Treponema
Methylocystis (-sinus)
Methylothermobacter
Methylobacter
Methylomonas
Methylobrevibacter
Methylosarcina
Rhizobiaceae
Klebsiella
Burkholderia
Spirochaeta
Vibrio
Desulfovibrio
Rhodobacteriaceae
Cyanobacteria
Dünnwald
OTU 05
OTU 06
OTU 08
OTU 10
OTU 11
OTU 15
OTU 24
OTU 29
OTU 30
OTU 33
53
76
94
23
174
54
10
51% (27)
66% (50)
79% (74)
53% (12)
79% (136)
77% (42)
60% (6)
2% (1)
1% (1)
1% (1)
3% (3)
2% (1)
2% (1)
1%
1%
1%
1%
1% (1)
1% (1)
(1)
(1)
(1)
(1)
1% (1)
1% (1)
3% (5)
4% (3)
2% (1)
2% (1)
1% (1)
1% (1)
4% (2)
2% (2)
2% (1)
2% (1)
8% (6)
3% (2)
8% (2)
1% (1)
1% (1)
1% (1)
2%
2%
2%
2%
(1)
(1)
(1)
(1)
10% (1)
2% (1)
1% (1)
1% (1)
4% (2)
1% (1)
2% (1)
4% (1)
1% (1)
2%
2%
8%
15%
(1)
(1)
(4)
(8)
3% (2)
8% (6)
adapted to these harsh conditions. In contrast, the Schreyahn salt
marsh is located in the temperate zone, with generally non-limiting rain supply during the year. The dominating salt is K2CO3,
the pH value is only around 8.0, and the different plants serve as
indicators of the horizontal salt gradient in the soil. To our
knowledge, a similar site has not yet been analysed for its
1%
2%
1%
1%
(1)
(2)
(1)
(1)
1% (1)
4% (1)
31% (7)
11% (27)
2% (1)
9% (5)
20% (2)
10% (1)
prokaryotic community structure. Schreyahn offers the perspective that extremely and moderately halophilic prokaryotes could
live here side by side, and that new groups of organisms, specifically adapted to the different K2CO3 loads in the soil could be
detected. Indeed, several new and unexpected disclosures arose
from the present study.
Table 5
Pattern in the nosZ distribution in soil samples taken at Schreyahn
Prokaryotic group
A. tripolium
P. distans
S. europaea
Heap
Total tRF patterns
retrieved in TReFID ( ¼ 100%)
Unidentified sequences
(sequence deposits only
available in the databanks)
Ochrobactrum
Achromobacter
Azospirillum halopraeferens
Paracoccus
Pseudomonas
Schreyahn nosZ
sequence from the
own clone library
Dünnwald
nosOTU 14
nosOTU 37
nosOTU 43
38
27
11
10
29% (11)
2.5% (1)
5%
5%
10.5%
26%
(2)
(2)
(4)
(10)
10.5% (4)
2.5% (1)
25% (7)
9% (1)
4% (1)
4% (1)
4% (1)
10% (2)
27% (9)
14% (4)
4% (1)
4% (1)
64% (7)
10%
10%
10%
50%
(1)
(1)
(1)
(5)
18% (2)
9% (1)
10% (1)
10% (1)
488
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
First of all, the Schreyahn soil harbours halophilic Archaea
like Halorubrum, Halogeometricum or alkaliphilic ones such
as Natronococcus and Natronomonas which are known to
live in hypersaline NaCl or soda environments (Burns et al.,
2004a,b; Sörensen et al., 2005). In Schreyahn, however, the
salt load does not exceed 20%, even in the brine of the mud.
The electric conductivity measurements can only be roughly
converted to salt concentrations but the maximal EC value
of 82 mS/cm measured in the mud corresponds to approximately 5.3% NaCl (Table 1). Since closely related taxa can
be halophilic or not, the organism behind a new sequence retrieved from an environmental sample cannot, in most cases,
be assigned to being halophilic, although affiliation to a known
taxon is frequently possible by comparison with the databank
entries. As with the Archaea, also with the Bacteria, some
clearly halophilic species such as Halobacillus sp. with almost
identical sequences to H. locisalis of a saltern at the Yellow
Sea in Korea (Yeon, submission AY190534 to GenBank,
2004) and Loktanella found in brines of the Vestfold Hill region (Van Trappen et al., 2004) in a coastal, ice-free area in
East Antarctica (Ventosa and Nieto, 1998) were detected. Other
true halophilic genera or species to be mentioned here were
Streptomyces with a sequence closely related to that from
S. maritima, Nitrospira (close to N. marina), Halomonas (two
sequence deposits, with almost 100% similarity to H. cupida)
or Sphingomonas with close relatedness to Sphingomonas sp.
(AF235131) and S. faenia (AJ429239).
Azospirillum halopraeferans was retrieved several times in
Schreyahn but is generally not mentioned in reports on bacteria in hypersaline environments. A. halopraeferans requires
0.25% NaCl for good growth (Reinhold et al., 1987). Remarkably, the distribution of halophilic Archaea and Bacteria unlikely followed the salt gradient in the soil, since several of
them (Halomonas AY795741, Nitrospira AY795679, Haloarchaea DQ177853, DQ177856 and DQ177842, for example)
were retrieved from samples taken from the roots of P. distans,
the area with the lowest salt load examined as well as in soils
of higher salt content. However, growth of many salt resistant
prokaryotes (e.g. the Halobacteriaceae) is strictly dependent
on a much higher salt load than around the roots of P. distans
(Ventosa and Nieto, 1998; Oren, 1999). This could mean that
microsites with high salt concentrations exist at sites like around
P. distans and, conversely, salt-intolerant species may occupy
non-loaded microsites in high salt sites. Such microsites should,
however, not affect the belt formations of the halophytes. Alternatively, it may be suggested that the extremely salt resistant
prokaryotes may remain dormant when the salt concentration
in the soil is too low and may resume life activity when the
salt concentration in the soil rises during drought periods. These
inland salt marshes with their own ecology offer fascinating
perspectives not only with respect to their plant distribution
but also in their community of prokaryotes and their adaptation
mechanisms.
The recently discovered Salinibacter ruber (Anton et al.,
2002) which has now been detected in several hypersaline waters (Benlloch et al., 2002; Øvreås et al., 2003; Pašić et al.,
2005) was, however, not in the list of the Schreyahn bacteria.
Since its 16S rDNA sequence was deposited in the TReFID
bank, it might have been retrieved if occurring abundantly at
Schreyahn. Other members of the Sphingobacteriaceae with
clear sequence divergence from S. ruber were detected.
Like salt tolerant and resistant species, non-tolerant prokaryotes occurred also at all sites in Schreyahn. Somewhat surprisingly, several sequences were detected which we recently
found in a totally different, sandy, non-saline soil of a mixed
fir-oak-hornbeam wood in the Rhine valley close to Cologne
(Rösch, 2005; Rösch and Bothe, to be published). Others
found in Schreyahn such as Bacillus macroides or Brevundimonas apparently were non-halophilic; these were also
retrieved from all sites with the exception of the heap.
With respect to the nitrogen cycle, the demonstration of
16S rRNA gene sequences coding for planctomycetes is noteworthy because these bacteria possibly perform the anammox
reaction which is a topic of current interest (Dalsgaard et al.,
2003; Kuypers et al., 2003). Sequences of planctomycetes
were retrieved from a hypersaline environment, the stromatolites of the Hamelin pool, Shark Bay in Western Australia
(Burns et al., 2004a,b), but the Schreyahn sequences are at
best distantly related to those from Australia and all others
of the databanks.
The nitrifiers are other constituents of the N cycle that have
recently been reported to operate in saline areas (Sorokin and
Kuenen, 2005). One sequence of amoA retrieved several times
from Schreyahn was totally unrelated to that of marine Nitrosococcus or Nitrosomonas halophila Nm1 (Sorokin et al.,
2001) as well as to those of terrestric (Nitrosospira and others)
ammonia oxidizing bacteria. However, it shows only 1.8% sequence divergence from those obtained from marine sediments
of the Chesapeake Bay on the Eastern coast of the United
States (Francis et al., 2003). These bacteria may represent
a novel group of nitrifiers which needs laboratory cultivation
prior to elucidate its properties. Soda lakes are known to harbour bacteria participating in the sulphur cycle (Sorokin and
Kuenen, 2005). In line with this, Thiothrix was retrieved several times in the 16S rRNA TReFID analysis of samples from
Schreyahn.
Many new sequences closely matched those of as yet uncultured bacteria where only sequence deposits are available in
the databanks. This was particularly evident in the case of
nifH despite the fact that this gene has been characterized
from many known N2-fixing bacteria. Nitrogenase occurrence
in bacteria has been extensively studied in diverse environments by the use of this gene (Zehr et al., 2003), but studies
like the current one reveal that a number of diazotrophs not
yet described may exist in nature. This also follows from other
recent studies (Knauth et al., 2005).
The observation that bacteria occur in Schreyahn which
have only recently been isolated from far away areas like Vestfold in the Antarctic or Korea may be surprising at first glance,
particularly since the Schreyahn salt marsh and the other 100
or so potash mines in Northern Germany are relatively young
historically. Prokaryotes may be propagated by wind over long
distances and within a short time scale to result in a cosmopolitan distribution. Due to the rather limited knowledge about
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
such a distribution, prokaryotes detected in exotic places may
in reality have a wider occurrence than sometimes assumed.
The high species richness of halophytes in Schreyahn is
more surprising. It is assumed but not proven that these plants
are propagated by migrating birds which could also be the
cause for the prokaryote distribution, but also further, unresolved factors may play a role in radiation.
The proportion of sequences that could not be affiliated
with databank (GenBank) entries was below 10% for all genes
employed. Among these, endemic species may occur, although
endemism for bacteria is disputed or rare (Donachie et al.,
2004). Also with respect to plants, the unusual habitat of the
potash mines in Northern Germany possesses the common halophytes of salt marshes with the notable exception of Hymenolobus procumbens (Brassicaceae) which is almost exclusively
restricted to potash locations (Haeupler and Muer, 2000).
Culturing approaches or sequencing of PCR-products of extracted DNA generally permit to characterize only a small percentage of the bacteria of a soil (only ‘‘a needle in the
haystack’’, generally below 1% of the total community under
investigation) and are not successful for identifying dominant
bacterial species in saline environments (Buchan et al., 2003).
Computer-based algorithms (Kent et al., 2003) have recently
been developed to assess the biodiversity of the bacterial life
in environmental samples without the need to sequence clone
libraries or isolate strains. The TReFID program (Rösch and
Bothe, 2005) has now been employed to compare the relative
abundance of prokaryotes at sites of different salt contents in
the soil with some remarkable results. First of all, with the
exception of the heap, the intersecting set of prokaryotes
that occurred at all Schreyahn sites (or jointly at the site of
the highest and lowest salt load) was high. The distribution
of either halophilic or non-salt prokaryotes apparently does
not follow the salt gradient as already suggested from the
data of the clone library. It shows that a- and likely also
g-proteobacteria thrive abundantly in Schreyahn soils which
is in agreement with reports from other saline habitats
(Benlloch et al., 2002; Buchan et al., 2003). Among the aproteobacteria, members of the Rhodobacteriaceae play a dominant role at hypersaline sites (Øvreås et al., 2003; Fourcans
et al., 2004) and also at Schreyahn. In contrast, Acidobacteria,
which occur almost everywhere in soils, amounted to less than
1% of the sum of bacteria retrieved and were thus rare in
Schreyahn. These statements are based on 1639 16S rRNA
tRF patterns of the TReFID databank which were found in
the Schreyahn soil samples. However, the confidence in the
statement of the present study should be taken as akin to predictions before human elections. Claims will be safer, the
more sequences are deposited that can be exploited for such
algorithms as used here.
For the evaluation of the data obtained, gene amplifications
by PCR seem to be most critical. It was stated already years
ago (Polz and Cavanaugh, 1998) that different target genes
cannot be amplified to the same extent from one PCR to the
next. Purity of the DNA extracted and exact standardization
of the PCR protocol as well as of the amount of DNA subjected to tRFLP analysis seem to be crucial. As an extreme
489
example, 1440 tRF patterns were retrieved from the DNA
taken from the roots of S. europaea in the first PCR whereas
only 98 could be analysed at the next. In tRFLP, the heights
and the areas of the peaks can hardly be exploited to determine
the relative abundance of one single species (species evenness)
in a sample. As regards species richness, a tRFLP peak size
may be just above the threshold value with DNA from one
sample but so low in the next that the bacterium behind it is
dismissed. DNA of particularly rare and thus low-density bacteria may not be well amplified. The Gram-positive bacilli
were well represented in the current clone library but were almost absent in the tRF patterns from the TReFID program.
Bacilli may well be overrepresented in culturing approaches,
a possibility which has also been noted by others (Felske
et al., 1999; Buckley and Schmidt, 2002).
Thus the present study showed that the TReFID program
can be successfully employed to give a gross analysis of the
prokaryotic community structure in different environmental
samples based on the entries in the databank. However, biases
with the PCR amplifications must be addressed to be more
quantitative, and the databases particularly for the functional
genes like nifH or nosZ have to be enlarged to obtain more
reliable data.
5. Conclusions
Approaches based on culturing of bacteria or on sequencing
of PCR-products of DNA from small clone libraries yield data
of relatively few bacteria of a soil community due to its extreme species richness. In spite of this, the molecular analysis
of bacteria occurring at the polluted site resulting potash mining provided information on a lot of new, not yet deposited sequences but also on some bacteria that had been described to
occur at far distant locations.
The recently developed TReFID algorithm for identifying
prokaryotes in an environmental sample can be applied successfully to characterize a prokaryotic community with confidence. Whereas the distribution of plants at such a potash
polluted sitedsimilar as in a NaCl marshdstrictly follows
the salt gradient in the soil, all the evidence obtained thus
far indicated that this is not the case for prokaryotes. Microorganisms of hypersaline areas coexist with salt-non-tolerant
species at different concentrations of potash in the soil.
Sequences obtained for amoA of ammonium monooxygenase from nitrifying bacteria, for nosZ of nitrous oxide reductase
of denitrifying microorganisms and for nifH of nitrogenase of
nitrogen-fixing bacteria were repeatedly retrieved. This might
indicate that all these reactions of the nitrogen cycle could
play an ecological role in this polluted environment.
Acknowledgements
The authors are indebted to Dr M.G. Yates, formerly at the
Unit of Nitrogen Fixation in Brighton, UK, for carefully commenting and improving the English. The excellent technical
expertise of Mirela Stecki and Karin Otto is also gratefully
acknowledged.
490
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
References
Anton, J., Oren, A., Benlloch, S., Rodriguez-Valera, F., Amann, R., RosselloMora, R., 2002. Salinobacter ruber gen. nov., sp. nov., a novel, extremely
halophilic member of the bacteria from saltern crystallizer ponds. International Journal of Systematic and Evolutionary Microbiology 52, 485e491.
Axelrood, P.E., Chow, M.L., Arnold, C.S., Lu, K., McDermott, J.M.,
Davies, J., 2002a. Cultivation-dependent characterization of bacterial
diversity from British Columbia forest soils subjected to disturbance.
Canadian Journal of Microbiology 48, 643e654.
Axelrood, P.E., Chow, M.L., Radomski, C.C., McDermott, J.M., Davies, J.,
2002b. Molecular characterization of bacterial diversity from British Columbia forest soils subjected to disturbance. Canadian Journal of Microbiology 48, 655e674.
Benlloch, S., Lopez-Lopez, A., Casamayor, E.O., Øvreås, L., Goddard, V.,
Daae, F.L., Smerdon, G., Massana, R., Joint, I., Thingstad, F., PedrosAlio, C., Rodriguez-Valera, F., 2002. Prokaryotic genetic diversity
throughout the salinity gradient of a coastal salar saltern. Environmental
Microbiology 4, 349e360.
Borneman, J., Triplett, E.W., 1997. Molecular microbial diversity in soils from
eastern Amazonia: evidence for unusual microorganisms and microbial
population shifts associated with deforestation. Applied and Environmental Microbiology 63, 2647e2653.
Borneman, J., Skroch, P.W., O’Sullivan, K.M., Palus, J.A., Rumjanek, N.G.,
Jansen, J.L., Nienhuis, J., Triplett, E.W., 1996. Molecular microbial diversity of an agricultural soil in Wisconsin. Applied and Environmental
Microbiology 62, 1935e1943.
Buchan, A., Newell, S., Butler, M., Biers, E., Hollibaugh, J., Moran, M., 2003.
Dynamics of bacterial and fungal communities on decaying salt marsh
grass. Applied and Environmental Microbiology 69, 6676e6687.
Buckley, D.H., Schmidt, T.M., 2002. Exploring the Biodiversity of SoildA
Microbial Rain Forest. In: Stanley, J.T., Reysenbach, A.-L. (Eds.), Biodiversity and Microbial Life. Wiley-Liss, New York, pp. 183e208.
Burns, D.G., Camakaris, H.M., Janssen, P.H., Dyall-Smith, M.L., 2004a. Combined use of cultivation-dependent and cultivation-independent methods
indicates that members of most haloarchaeal groups in an Australian crystallizer pond are cultivable. Applied and Environmental Microbiology 70,
5258e5265.
Burns, B.P., Goh, F., Allen, M., Neilan, B.A., 2004b. Microbial diversity of extant stromatolites in the hypersaline marine environment of Shark Bay,
Australia. Environmental Microbiology 6, 1096e1101.
Dalsgaard, T., Canfield, D.E., Petersen, J., Thamdrup, B., Acuna-Gonzalez, J.,
2003. N2 production by the anammox reaction in the anoxic water column
of Golfo Dulce, Costa Rica. Nature 422, 606e608.
Demba Diallo, M., Martens, M., Vloemans, N., Cousin, S., Vandekerckhove,
T.T.M., Neyra, M., de Lajudie, P., Willems, A., Gillis, M., Vyverman, W.,
Van der Gucht, K., 2004. Phylogenetic analysis of partial bacterial 16S
rDNA sequences of tropical grass pasture soil under Acacia tortilis
subsp. raddiana in Senegal. Systematic and Applied Microbiology 27,
238e252.
Donachie, S.P., Hou, S., Lee, K.S., Riley, C.W., Pikina, A., Belisle, C.,
Kempe, S., Gregory, T., Bossuyt, A., Boerema, J., Liu, J., Freitas, T.A.,
Malahoff, A., Alam, M., 2004. The Hawaiian archipelago: a microbial
diversity hotspot. Microbial Ecology 48 (4), 509e520.
Dunbar, J., Takala, S., Barns, S.M., Davis, J.A., Kuske, C.R., 1999. Levels of
bacterial community diversity in four arid soils compared by cultivation
and 16S rRNA gene cloning. Applied and Environmental Microbiology
65, 1662e1669.
Dunbar, J., Barns, S.M., Ticknor, L.O., Kuske, C.R., 2002. Empirical and theoretical bacterial diversity in four Arizona soils. Applied and Environmental Microbiology 68, 3035e3045.
Ellenberg, H., 1988. Vegetation Ecology of Central Europe. Cambridge University Press, Cambridge, New York.
Felsenstein, J., 2004. PHYLIP: Phylogeny Inference Package.
Felske, A., Wolterink, A., van Lis, R., de Vos, W.M., Akkermans, A.D.L.,
1999. Searching for predominant soil bacteria: 16S rDNA cloning versus
strain cultivation. FEMS Microbiology Ecology 30, 137e145.
Fourcans, A., De Oteyza, T.G., Wieland, A., Sole, A., Diestra, E., Van
Bleijswijk, J., Grimalt, J.O., Kühl, M., Esteve, I., Muyzer, G.,
Caumette, P., Duran, R., 2004. Characterization of functional bacterial
groups in a hypersaline microbial mat community (Salins-de-Giraud, Cammargue, France). FEMS Microbiology Ecology 51, 55e70.
Francis, L.A., O’Mullan, G.D., Ward, B.B., 2003. Diversity of amoA genes
across environmental gradients in Chesapeake Bay sediments. Geobiology
1, 129e140.
Galtier, N., Gouy, M., Gautier, C., 1996. SeaView and Phylo_win, two graphic
tools for sequence alignment and molecular phylogeny. Computer Applications in Biosciences 12, 543e548.
Haeupler, H., Muer, T., 2000. Bildatlas der Farn- und Blütenpflanzen Deutschlands. Eugen Ulmer, Stuttgart.
Horst, K., Redel, I., 1977. Salzpflanzen und salzliebende Pflanzengesellschaften bei Schreyahn - ein schutzwürdiges Refugium im Hannoverschen
Wendland. Jahresheft des Heimatlichen Arbeitskreises Lüchow-Dannenberg 6, 25e35.
Janssen, P.H., 2006. Identifying the dominant soil bacterial taxa in libraries of
16S rRNA and 16S rRNA genes. Applied and Environmental Microbiology 72, 1719e1728.
Joseph, S.J., Hugenholtz, P., Sangwan, P., Osborne, C.A., Janssen, P.H., 2003.
Laboratory cultivation of widespread and previously uncultured soil bacteria. Applied and Environmental Microbiology 69, 7210e7215.
Kent, A.D., Smith, D.J., Benson, B.J., Triplett, E.W., 2003. Web-based phylogenetic assignment tool for analysis of terminal restriction fragment length
polymorphism profiles of microbial communities. Applied and Environmental Microbiology 69, 6768e6776.
Knauth, S., Hurek, T., Brar, D., Reinhold-Hurek, B., 2005. Influence of different cultivars on expression of nifH gene pools in roots of maize. Environmental Microbiology 7, 1725e1731.
Krave, A.S., Lin, B., Braster, M., Laverman, A.M., van Straalen, N.M.,
Röling, W.F., van Verseveld, H.W., 2002. Stratification and seasonal
stability of diverse bacterial communities in a Pinus merkusii (pine)
forest soil in central Java, Indonesia. Environmental Microbiology 4,
361e373.
Kuske, C.R., Barns, S.M., Busch, J.D., 1997. Diverse uncultivated bacterial
groups from soils of the arid southwestern United States that are present
in many geographic regions. Applied and Environmental Microbiology
63, 3614e3621.
Kuypers, M.M., Sliekers, A.O., Lavik, G., Schmid, M., Jörgensen, B.B.,
Kuenen, J.G., Damsté, J.S.S., Strous, M., Jetten, M.S.M., 2003. Anaerobic
ammonium oxidation by anammox bacteria in the Black Sea. Nature 422,
608e611.
Liles, M.R., Manske, B.F., Bintrim, S.B., Handelsman, J., Goodman, R.M.,
2003. A Census of rRNA Genes and Linked Genomic Sequences within
a Soil Metagenomic Library. Applied and Environmental Microbiology
69, 2684e2691.
Lopez-Garcia, P., López-López, A., Moreira, D., Ródriguez-Valera, F., 2001.
Diversity of free-living prokaryotes from a deep-sea site at the Antarctic
polar front. FEMS Microbiology and Ecology 36, 193e202.
Marschner, H., 1986. Mineral Nutrition in Higher Plants. Academic Press,
London.
McCaig, A.E., Glover, L.A., Prosser, J.L., 1999. Molecular analysis of
bacterial community structure and diversity in unimproved and improved
upland grass pastures. Applied and Environmental Microbiology 65,
1721e1730.
Munson, M.A., Nedwell, D.B., Embley, T.M., 1997. Phylogenetic Diversity of
Archaea in Sediment Samples from Coastal Salt Marsh. Applied and
Environmental Microbiology 63, 4729e4733.
Nicolaisen, M.H., Ramsing, N.B., 2002. DGGE approaches to study the diversity of AOB. Journal of Microbiology Methods 50, 189e203.
Nogales, B., Moore, E.R., Llobet-Brossa, E., Rossello-Mora, R., Amann, R.,
Timmis, K.N., 2001. Combined use of 16S ribosomal DNA and 16S
rRNA to study the bacterial community of polychlorinated biphenylpolluted soil. Applied and Environmental Microbiology 67, 1874e1884.
Oren, A., 1999. Bioenergetic aspects of halophilism. Microbial Molecular
Biology Reviews 63, 334e348.
S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491
Oren, A., 2002. Diversity of halophilic microorganisms; environments, phylogeny, physiology and applications. Industrial Microbiology and Biotechnology 28, 53e63.
Øvreås, L., Daae, F.L., Torsvik, V., Rodriguez-Valera, F., 2003. Characterisation of microbial diversity in hypersaline environments by melting profiles
and reassociation kinetics in combination with terminal restriction fragment length polymorphism (T-RFLP). Microbial Ecology 46, 291e301.
Pašić, L., Bartual, S.G., Ulrih, N.P., Grabmar, M., Herzog Velikonja, B.H.,
2005. Diversity of halophilic archaea in the crystallizers of an Adriatic
solar saltern. FEMS Microbiology and Ecology 54, 491e498.
Pfennig, N., Trüper, H.G., 1981. Isolation of members of the families Chromatiaceae and Chlorobiaceae. In: Starr, M.P., Stolp, H., Trüper, H.G.,
Balows, A., Schlegel, H.G. (Eds.), The Prokaryotes. Springer, Berlin Heidelberg New York, pp. 279e289.
Polz, M.F., Cavanaugh, C.M., 1998. Bias in template-to-product ratios in
multitemplate PCR. Applied and Environmental Microbiology 64 (10),
3724e3730.
Reinhold, B., Hurek, T., Fendrik, I., Pot, B., Gillis, M., Kertsers, K.,
Thielemans, D., De Ley, J., 1987. Azospirillum halopraeferans sp. nov.,
a nitrogen fixing organism associated with roots of Kallar grass (Leptochloa fusca (L. Kunth)). International Journal of Systematic Bacteriology
37, 43e51.
Rösch, C., 2005. Entwicklung eines Datenbank-gestützten Computerprogramms zur taxonomischen Identifizierung von mikrobiellen Populationen
auf molekularer Basis. Thesis. University of Cologne, Cologne.
Rösch, C., Bothe, H., 2005. Improved assessment of denitrifying, N2-fixing,
and total-community bacteria by terminal restriction fragment length polymorphism analysis using multiple restriction enzymes. Applied and Environmental Microbiology 71, 2026e2035.
Rösch, C., Mergel, A., Bothe, H., 2002. Biodiversity of denitrifying and dinitrogen-fixing bacteria in an acid forest soil. Applied and Environmental
Microbiology 68, 3818e3829.
491
Rotthauwe, J.H., Witzel, K.P., Liesack, W., 1997. The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale
analysis of natural ammonia-oxidizing populations. Applied and Environmental Microbiology 63, 4704e4712.
Scala, D.J., Kerkhof, L.J., 1998. Nitrous oxide reductase (nosZ ) gene-specific
PCR primers for detection of denitrifiers and three nosZ genes from marine
sediments. FEMS Microbiology Letters 162, 61e68.
Sörensen, K.B., Canfield, D.E., Teske, A.P., Oren, A., 2005. Community composition of a hypersaline endoevaporite microbial mat. Applied and Environmental Microbiology 71, 7325e7365.
Sorokin, D.Y., Kuenen, J.G., 2005. Chemolithotrophic haloalkaliphiles from
soda lakes. FEMS Microbiology and Ecology 52, 287e295.
Sorokin, D.Y., Tourova, T.P., Schmid, M., Wagner, M., Koops, H.-J.,
Kuenen, J.G., Jetten, M., 2001. Isolation and properties of obligately
chemolithoautotrophic and extremely alkali-tolerant ammonia-oxidizing
bacteria from Mongolian soda lakes. Archives of Microbiology 176,
170e177.
Stocker, O., 1928. Das Halophytenproblem. In: v.Frisch, K., Goldschmidt, R.,
Ruhland, W., Winterstein, H. (Eds.), Ergebnisse der Biologie. Verlag von
Julius Springer, Berlin, pp. 266e353.
Torsvik, V., Goksøyr, J., Daae, F.L., 1990. High diversity in DNA of soil bacteria. Applied and Environmental Microbiology 56, 782e787.
Van Trappen, S., Mergaert, J., Swings, J., 2004. Loktanella fryxellensis gen.
nov. sp. nov., Loktanella vestfoldensis sp. nov. and Loktanella salsilacus
sp. nov., new members of the Roseobacter clade, isolated from microbial
mats in Antarctic lakes. International Journal of Systematic and Evolutionary Microbiology 54, 1263e1269.
Ventosa, A., Nieto, J.J., 1998. Biology of moderately halophilic aerobic bacteria. Microbiology Molecular Biology Reviews 62, 504e544.
Zehr, J.P., Jenkins, B.D., Short, S.M., Steward, G.F., 2003. Nitrogenase gene
diversity and microbial community structure: a cross-system comparison.
Environmental Microbiology 5, 539e554.