* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Environmental Pollution
Survey
Document related concepts
Genome evolution wikipedia , lookup
Designer baby wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Pathogenomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
Microsatellite wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Helitron (biology) wikipedia , lookup
History of genetic engineering wikipedia , lookup
Transcript
Environmental Pollution 146 (2007) 478e491 www.elsevier.com/locate/envpol Prokaryotic life in a potash-polluted marsh with emphasis on N-metabolizing microorganisms Sascha Eilmus, Christopher Rösch, Hermann Bothe* Botanical Institute, The University of Cologne, Gyrhofstrasse 15, D-50923 Köln, Germany Received 27 April 2006; received in revised form 6 July 2006; accepted 10 July 2006 Characterization of a prokaryotic community of a potash marsh provided information on the occurrence of many unusual prokaryotes and their horizontal distribution. Abstract Prokaryotic life along the salt gradient of the potash marsh resulting from mining waste at Schreyahn, Northern Germany, was screened for the distribution of total prokaryote (assessed by the 16S rRNA gene) and of N2-fixing (nifH gene), denitrifying (nosZ ) and nitrifying (amoA) microorganisms. Information on prokaryotes was retrieved from the different soil sites (a) by culturing in conventional media, (b) by isolating the DNA, amplifying the target genes by PCR followed by sequencing, (c) by employing the recently developed computer program (TReFID [Rösch, C., Bothe, H., 2005. Improved assessment of denitrifying, N2-fixing, and total-community bacteria by terminal restriction fragment length polymorphism analysis using multiple restriction enzymes. Applied and Environmental Microbiology 71, 2026e2035]) based on tRFLP data. New sequences were obtained as well as ones that were almost identical to those found at far distant locations. Whereas the distribution of plants strictly follows the salt gradient, this is apparently not the case with prokaryotes. Bacteria of hypersaline areas coexist with salt-non-tolerant species. The recently developed TReFID program is successfully applied to characterize a prokaryote community structure. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Prokaryotic community analysis; Computer program for assessing biodiversity; Bacteria in saline soils; Denitrification; Dinitrogen fixation; Nitrification; Bacteria in potash mining waste 1. Introduction In saline habitats, halophilic organisms occur which are strictly dependent for their growth on a high salt concentration. Others can resist salt stress and are confined to salt marshes due to their low competitiveness elsewhere. This is true for both microorganisms (Oren, 1999) and higher plants (Ellenberg, 1988). The latter show impressive belt formations dependent on the soil salt concentration at all marshes throughout the world. In Western and Continental Europe, Salicornia europaea L. (glasswort or marsh samphire) can cope with the highest salt concentration and often forms monocultures in high salt soils. * Corresponding author. Tel.: þ49 221 470 2760; fax: þ49 221 470 5039. E-mail address: [email protected] (H. Bothe). 0269-7491/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.envpol.2006.07.008 The next most tolerant belt is formed by Puccinellia spp., being P. maritima (Huds.) Parl. (common salt marsh grass) on the Atlantic coast, P. distans (Jacq.) Parl. (reflexed salt marsh grass) on German inland salt marshes and P. limosa (Schur) E. Holmb (swamp salt marsh grass) on the Hungarian plain. Soils with lower salt contents are often dominated by Aster tripolium L. (salt aster), which, however, shows a somewhat broader range of distribution because it can thrive on wetter and drier stands with higher or lower salt contents (Ellenberg, 1988). As known in plant sociology, these belt formations are independent of the salt type, thus irrespective of NaCl, Na2SO4 or K2CO3 dominating in soils. Due to the capacity of the ions to bind water, salt marsh soils have an extremely negative water potential, and halophytes have to endure extended periods of drought. As noted early by botanists (Stocker, 1928), stress caused by drought rather than by the salt itself S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 479 and its type is the major cause of belt formation of halophytes in salt marshes. The characterization of prokaryotic life in hypersaline environments has recently been a centre of interest in microbial ecology (Oren, 2002; Øvreås et al., 2003) and has revealed a high diversity of organisms from various taxonomic affiliations (see Section 4). It has, however, not yet been examined whether the distribution of prokaryotes follows that of plants and is also dictated by the gradient in the salt concentration (or better in the water potential) in salt marshes. The current study aims at characterizing prokaryotic life in the soil around a potash mine at Schreyahn, Wendland, in Northern Germany. This heap originates from the residuals of below-ground mining performed between 1905 and 1926 (Horst and Redel, 1977). The soil surrounding this heap supports the typical belt formation of plants dependent upon the salt concentration, with a surprisingly high richness of different halophytes. Soil samples were taken from the roots of the belt indicators S. europaea, P. distans and A. tripolium, from the plant-free, central area and from the heap itself. Prokaryotic life in the samples was analysed by several methods. (a) Bacteria were grown in conventional media, and their DNA was extracted for PCR amplifications of the 16S rRNA gene (for total bacterial community) and of genes coding for characteristic enzymes of the nitrogen cycle: nifH (nitrogenase reductase), nosZ (N2O-reductase of denitrifiers) and amoA (ammonium monooxygenase of nitrifiers). (b) DNA was extracted directly from the soil samples for generating PCR-amplicons of the above-mentioned target genes. This method provided a clone library, and sequencing revealed information on new prokaryotes which grouped mainly next to uncultured microorganisms. However, due to the high diversity of approximately 104 ribotypes (wdifferent bacteria) in soils (Torsvik et al., 1990), such groups of independent sequences provided by methods a and b do not permit, by any means, to comprehensively assess the bacterial community structure. (c) DNA extracted from the soil samples was, therefore, used to generate tRFLP profiles for identifying prokaryotes utilizing the recently developed TReFID program (Rösch and Bothe, 2005). By using up to 13 restriction enzymes, DNA fragments labelled with a fluorescence dye (tRFs) were generated from the soil sample. The computer assignment tool TReFID screens for the presence of a pattern specific for any bacterium among the current 22,145 entries in the TReFID database in the collection of the tRFs of the soil. The search for organisms retrieved from the TReFID database was then extended to all soil samples taken from the zone indicator plants or from the bulk soil to assess the distribution of prokaryotes in dependence on the salt load. the microbial community structure along a transect from lowest to highest salt load. There was no litter or biofilm on top of the soil and no visible stratification in the upper 10 cm. From the samples taken, small stones and roots were removed by hand, and otherwise the material was homogeneous enough so that sieving was not necessary. Samples were brought to the Cologne laboratory in cooling boxes, thoroughly mixed and used for DNA extraction as soon as possible. Storage of the samples at 4 C did not exceed one day. The pH values and the electric conductivities of the samples from all sites other than the heap were determined in aqueous extracts, using the Multi 430i electrode of the Wissenschaftliche Technische Werkstätten company, D-82362 Weinheim, Germany. Since the heap consisted of pure salt, mainly K2CO3, its pH and conductivity were not determined. 2. Materials and methods PCR products from several independent experiments were separately purified with the MinElute gel extraction kit (Qiagen, Hilden, Germany) and cloned using the pGEMT Easy vector system (Promega, Mannheim, Germany). Randomly chosen clones were sequenced with a BigDye terminator cycle sequencing kit version 1.1 (Applied Biosystems, Weiterstadt, Germany) and an ABI 3100 automatic sequencer (Applied Biosystems). Raw sequences were processed in BioEdit 5.09 and evaluated by BlastN, ClustalX alignments and ChimeraCheck. The references for all these methods are given in (Rösch and Bothe, 2005). 2.1. Soil sampling and soil parameters Soil samples from the Schreyahn potash marsh (52 550 5300 N, 11 040 3600 E) were taken from the upper 10 cm of the middle part of the A. tripolium, P. distans or S. europaea vegetation zones (about 1 kg per zone which was enough to represent each zone). Additionally, samples from the central, plant free mud zone and from a potash heap were taken to obtain information on 2.2. Culture conditions for the growth of bacteria from soil samples To obtain bacterial isolates, an inoculating loop of the soil samples was streaked on agar or Gelrite (Roth, Karlsruhe, Germany) plates containing either LB or YEMþ media containing in g per litre: mannitol 8, glucose 2, Bacto-Trypton 0.4 (Roth Roth), yeast-extract 0.4 (AppliChem, Darmstadt), K2HPO4 0.5, MgSO4 $ 7H2O 0.4, NaCl 0.1, 1 ml trace element solution SL8 (Rösch, 2005). To selectively enrich halophilic, heterotrophic bacteria, plates were supplemented with the following chemicals containing in g per lire: yeast extract 5, Bacto Trypton 5, Naþ-glutamate 1, KCl 2, Naþ-citrate 3, MgSO4 $ 7H2O 20, NaCl, variable, up to 180, FeCl2 $ 4H2O 0.036, and trace elements SL8 (Pfennig and Trüper, 1981) 5 ml. Media were supplemented with cycloheximide (1 mg/ml medium) to prevent growth of fungi or protozoa. Ammonium-oxidizing bacteria (AOB) were grown in liquid cultures kept in the dark in a strictly inorganic medium containing in g per litre: (NH4)2SO4 0.5, MgSO4 $ 7H2O 0.04, CaCl2 $ 2H2O 0.04, K2HPO4 0.2, and the SL8 trace elements 1 ml, and the liquid was then removed by centrifugation. For the others, plates were incubated at 30 C until colonies were clearly visible by eye. They were then suspended in distilled water and used directly for PCR amplifications of the target gene segments described below. 2.3. Extraction of prokaryotic DNA and PCR amplifications DNA of the soil samples was extracted with the UltraClean Soil DNA kit from MoBio, Solana Beach, CA. The DNA preparation was used as a template for amplifying the genes 16S rRNA (for assessing the total prokaryotic community), nifH (N2-fixing microorganisms), nosZ (denitrifiers) or amoA (nitrifiers). For the first three genes, the primers were exactly the same as those used in the preceding publication (Rösch and Bothe, 2005). For amplifying gene segments the primers taken were: amoA-1F/amoA-1R (Rotthauwe et al., 1997) for amoA, AOB-F1: GGTGAGTAATGCATCGGAACG, AOBR1: TGGCAACCCTCTGTACGCG for 16S rRNA of AOB and 1A(F)/ 1100A(R) (Lopez-Garcia et al., 2001) for Archaea 16S rRNA. Hot start PCRs in a 25 ml volume utilized the MasterTaq kit (Eppendorf, Hamburg, Germany) followed by touch-down time programs of 40 cycles in a Personal Cycler (Biometra, Göttingen, Germany). Annealing temperatures decreased stepwise from 66 to 56 C for amplifying the 16S rRNA gene segment and from 65 to 50 C for nifH, nosZ and amoA. All procedures were performed according to Rösch and Bothe (2005) and Rösch (2005). 2.4. Construction and analysis of the clone library from DNA of the environmental samples S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 480 Phylogenetic trees were constructed using the Neighbour Joining (PHYLO_WIN; Galtier et al., 1996) and Maximum Likelihood (DNAMLK from the Phylip 3.63 software package; Felsenstein, 2004) methods. In the first step, the BlastN results of all Schreyahn sequences served as reference sequences for the construction of preliminary Neighbour Joining trees. The Maximum Likelihood trees (Figs. 1e4) were calculated with default -0.034 0.1 parameters (DNAMLK, 10 replicate trees, the method finally provides the most likely tree without bootstrap values) and represent refinements of the former trees as the remaining reference sequences are the ones that allow the best classification of the Schreyahn clones. In the case of the 16S rDNA phylogram, reference sequences were deleted after the calculation to ensure readability. AY795723 AY795660 AY795681 AY795760 AY795761 AY795726 AY795645 AY795765 AY795759 AY795743 AY795636 AY795666 AY795711 AY795768 AY795764 AY795662 AY795730 AY795669 AY795766 AY795745 AY795758 AY795725 AY795689 AY795710 AY795692 AY795737 AY795740 AY795673 AY795728 AY795738 AY795656 AY795651 AY795722 AY795701 AY795731 AY795668 AY795628 AY795718 AY795719 AY795679 AY795712 AY795713 AY795695 AY795749 AY795744 AY795638 AY795646 AY795640 AY795724 AY795717 AY795754 AY795753 AY795696 AY795648 AY795633 AY795729 AY795650 AY795658 AY795654 AY795635 AY795698 DQ177841 DQ177854 DQ177857 DQ177848 DQ177856 DQ177865 DQ177863 DQ177842 DQ177866 DQ177860 DQ177868 DQ177862 Methylobacter Alphaproteobacteria Brevundimonas Roseovarius Sphingomonas Hydrogenophaga Betaproteobacteria Halomonas Gammaproteobacteria Gemmatimonadetes Nitrospira Nitrospira Streptomyces Streptomyces Streptomyces Actinobacteria Bacillus Bacillus Bacilli Cyanobacteria Bacteroidetes Planctomycetacia Halobacteria (Euryarchaeota) Fig. 1. Phylogram of the 16 S rRNA gene sequences retrieved from the potash marsh at Schreyahn. In total, 71 sequences were obtained by cloning and sequencing the PCR products obtained from DNA either extracted directly from the soil or from cultured bacteria of soil samples. The phylogram (Maximum Likelihood tree) refers to positions N64 to 618 in E. coli K12 rrsH (GenBank accession no. NC000913). Only the own sequences obtained are shown here. S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 481 Methylobacter vinelandii INMI 87 (AF484676) 0.1 Vibrio diazotrophicus ATCC33466 (AF111110) Azotobacter chroococcum (M73020) Azomonas agilis ATCC7494 (AF216883) Klebsiella pneumoniae 342 (AY242355) Schreyahn AY795616 Aster tripolium Schreyahn AY795615 Puccinellia distans Schreyahn AY795610 Salicornia europaea Alcaligenes faecalis (X96609) uncultured organism SE1 (AF414642) Schreyahn AY795618 Salicornia europaea Schreyahn AY795617 Salicornia europaea Schreyahn AY795619 Salicornia europaea Schreyahn AY795626 Salt mud Schreyahn AY795623 Puccinellia distans uncultured organism Sp1-1 (AY091856) Mesorhizobium mediterraneum Rch-9865 (AJ457917) Rhizobium gallicum R602sp (AF218126) Sinorhizobium sp. GR-X8 (AF275670) Sinorhizobium sp. Rch9868 (AJ457920) Herbaspirillum seropedicae Z78 (Z54207) Rhodobacter capsulatus (X63352) Azospirillum brasilense (M64344) uncultured organism G3 (AF216915) Bradyrhizobium japonicum IAM 12608 (AB079619) Schreyahn AY795627 Salicornia europaea Frankia alni ArI3 (L41344) Anabaena variabilis ATCC29413 (U89346) Nostoc commune (L23514) Fig. 2. Phylogram of nifH coding for dinitrogenase reductase retrieved from the potash marsh. The own sequences in this Maximum Likelihood tree are shown in bold. The alignment refers to the positions N57 to 414 in Azotobacter vinelandii (M73020). New sequences from Schreyahn were deposited in GenBank (www.ncbi.nlm.nih.gov), accession numbers: 16S rRNA gene Bacteria: AY795628 to AY795769; 16S rRNA gene Archaea: DQ177841 to DQ177872; amoA: AY795796 to AY795821; nifH: AY795610 to AY795627; nosZ: AY795770 to AY795795. Details on the origin of individual sequences can be obtained from the sequence’s annotations in GenBank. 2.5. tRFLP analysis For tRFLP experiments the PCR primers 63f (16S rRNA gene), nifH-F and nosZ-R were labelled with the fluorescence dyes JOE, FAM and TAMRA, respectively (MWG Biotech, Ebersberg, Germany). Otherwise PCR was performed as described for the construction of clone libraries. The labelled PCR products were purified (QiaQuick spin columns, Qiagen, Hilden, Germany), partitioned and aliquots were subjected to restriction digests using up to 13 enzymes in parallel. The restriction enzymes employed were AluI, Bme1390I, Bsh1236I, BsuRI ( ¼ HaeIII), Cfr13I, Hin6I, HinfI, MboI, MspI, RsaI, TaiI, TaqI and TasI (all Fermentas, St. Leon-Roth, Germany). Digests were performed overnight in 100 ml volumes at the optimal enzymes’ temperature. The restriction fragments were precipitated and dissolved in 10 ml of water. Prior to analysis on an ABI 377 Automatic Sequencer (Applied Biosystems), 2.5 ml of the fragment solution were mixed with 1.0 ml formamide (deionized), 1.0 ml loading buffer (Applied Biosystems) and 0.5 ml GeneScan 500 ROX size standard (Applied Biosystems). Raw data were handled with the GeneScan 3.1.2 software (Applied Biosystems). The tRFLP analysis using multiple restriction enzymes was performed by use of the TReFID program ( ¼ terminal restriction fragment identifying program; http://www.trefid.net) exactly as described in detail in the preceding publication (Rösch and Bothe, 2005). The TReFID data base currently comprises 22,145 entries for the 16S rRNA gene, 1318 for nifH and 607 for nosZ. A TReFID analysis resulted in a list of sequences representing organisms occurring in the Schreyahn samples. These TReFID results were analysed on the level of tRF patterns (see Rösch and Bothe, 2005), i.e. not on the basis of single sequences, but on the basis of groups of sequences, which are indistinguishable regarding their tRF patterns. The latter generally concerns sequences of closely related organisms, while unrelated organisms yield different tRF patterns. Concerning the 16S rRNA gene, these sequences were taxonomically classified (RDP II Classifier, http.//rdp.cme.msu.edu/classifier/classifier.jsp) and analysed on the level of prokaryotic classes (refer to Fig. 5, for example). For the Aster, Puccinellia and Salicornia samples, the proportions of tRF patterns occurring in any two or all three samples were determined by comparing the TReFID result lists. 3. Results 3.1. Parameters of soil samples taken from the potash marsh The pH values of the soil samples from the Schreyahn potash mine varied between 7.3 and 8.4 (Table 1). Since the pH of the non-polluted soils in the vicinity of the Schreyahn village was between 5 and 6, the high values in the surrounds of the K2CO3 heap had presumably resulted from the out-washings of the salt by rainfall. Among land plants, S. europaea is known to endure the highest salt S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 482 Schreyahn AY795795 Salicornia europaea 0.05 Schreyahn AY795794 Salicornia europaea Schreyahn AY795772 Aster tripolium Schreyahn AY795770 Aster tripolium Schreyahn AY795776 Puccinellia distans uncultured organism HJALFZG09 (AY259200) uncultured organism CZ1496 (AY072231) uncultured organism CZ1439 (AF315443) Bradyrhizobium japonicum USDA 110 (AJ002531) Schreyahn AY795773 Aster tripolium Sinorhizobium meliloti JJ1c10 (U47133) Ochrobactrum anthropi LMG 3331 (AY072229) Achromobacter xylosoxidans NCIMB 11015 (AY072227) Azospirillum liporerum Sp59b (AF361793) Azospirillum halopraeferens Au4 (AF361794) Azospirillum brasilense Sp7 (AF361791) uncultured organism S321195A (AF016055) Schreyahn AY795784 Puccinellia distans(6 sequences) Pseudomonas stuzeri (M22628) Schreyahn AY795777 Aster tripolium(2 sequences) Pseudomonas stuzeri A15 (AF361795) Pseudomonas aeruginosa DSM 50071 (X65277) Pseudomonas fluorescens C7R12 (AF197468) Pseudomonas sp. MT-1 (AB054991) Pseudomonas denitrificans (AF016059) Schreyahn AY795782 salt mud Schreyahn AY795785 salt mud Schreyahn AY795787 salt mud Paracoccus denitrificans Pd1222 (AJ010260) Achromobacter cycloclastes ATCC 21921 (AF047429) Rhodobacter sphaeroides IL106 (AF125260) Fig. 3. Phylogram of nosZ coding for nitrous oxide reductase of denitrification retrieved from the potash marsh. The alignment refers to the positions N1232 to 1889 in Paracoccus denitrificans (X74792). loads (Ellenberg, 1988), indicated also at Schreyahn by the high electric conductivity (EC) data (Table 1). Soils samples taken from the roots of A. tripolium had higher EC values than those from P. distans (Table 1), which is also occasionally found in soils of coastal NaCl marshes, although the opposite is more frequent (not documented). In two independent determinations with standard deviations of less than 10%, the number of bacterial colony forming units on YEM þ Gelrite plates was roughly three times higher 0.1 at the roots of A. tripolium (1.3 106) than at those of S. europaea (4.4 105), referred to g of soil. 3.2. 16S rRNA gene sequences retrieved from enrichment cultures or by PCR amplifications of the DNA extracted from the soil samples The 16S rRNA gene sequences obtained for Archaea/Bacteria are listed in Fig. 1 and Table 2. Using the primers 1AF Schreyahn AY795796 to Schreyahn AY795819 (25 sequences) S. europaea, salt mud and vegetation free zone Schreyahn AY795820 Aster tripolium Nitrosospira multiformis (AF042171) Nitrosospira briensis (U76553) Nitrososvibrio tenuis (U76552) Nitrosomonas sp. (AF327919) Nitrosomonas sp. (AF327918) Nitrosomonas sp. (AB031869) Nitrosomonas europaea (L08050) Nitrosococcus (AF153344) Nitrosococcus (AF047705) Fig. 4. Phylogram of amoA coding for ammonium monooxygenase of nitrification retrieved from the potash marsh. The alignment refers to the positions N344 to 825 in Nitrosomonas europaea (L08050). S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 483 Fig. 5. Percentage of prokaryotic classes in the total communities of five Schreyahn soil samples. DNA was isolated from soil surrounding S. europaea, A. tripolium and P. distans as well as from the mud and heap. It was then subjected to tRFLP analysis using up to 13 restriction enzymes and fluorescence dyes (see Section 2). The total 16S rDNA tRFLP patterns which were found in the TReFID data base were set to 100% in each case. Two independent PCR amplifications were performed with the DNA isolated from S. europaea and P. distans (experiments A and B). and 1100 AR specifically designed for amplifying the 16S rRNA gene of Archaea (Lopez-Garcia et al., 2001), altogether 32 sequences related to extreme halophilic and alkaliphilic Archaea were obtained from the soil samples surrounding A. tripolium, P. distans, S. europaea, the vegetation-free zone and mud, but not from the heap. Sequences with close homologies to the euryarchaeota Halorubrum (1 sequence), Haloferax (2), Halosimplex (2), to the alkaliphilic Natronococcus (2) and Natronomonas (1) as well as to 24 other members of the Halobacteriaceae with no affiliations to known genera were retrieved. Seven other sequences were closely clustered with each other but had no counterpart, not even on the genus level, to deposits in GenBank. They did not cluster with the uncultured monophyletic groups I and II of Archaea which have been found in almost all marine samples so far analysed (Munson et al., 1997). Remarkably, three sequences Table 1 Parameters of the K2CO3 soil in Schreyahn/Wendland of Northern Germany Soil sample taken from Roots of Puccinellia distans Roots of Aster tripolium Roots of Salicornia europaea, outer zone Roots of Salicornia europaea, inner zone Vegetation-free zone Salt mud No. of determinations (n) a Average electric conductivity (mS/cm)a Corresponding to NaCl salinity pH value 6.2 0.3 0.4% 7.90 0.06 11.5 1.5 0.75% 7.77 0.06 17.2 2.3 1.1% 7.62 0.02 37.9 3.6 2.5% 7.68 0.01 29.1 0.9 82.1 4.9 4 1.9% 5.3% 7.37 0.04 8.42 0.02 3 Determination at 25 C. 1 mS/cm corresponds to about 0.065% salinity (for NaCl; Marschner, 1986). The salinity in the North Atlantic is about 3.5%, for comparison. Standard deviations are given. (DQ177842, DQ177853, DQ177856) of the Halobacteriaceae but with no affiliations to genera were found in the soil samples taken from the roots of A. tripolium, this being the site with a lower salt load. The general primers of the 16S rRNA gene (27F/1495R) enabled us to amplify several sequences of bacterial clones from the Cytophaga-Flavobacterium-Bacteroides (CFB) group, the gemmatimonadetes, two cyanobacteria (with weak sequence homology to the Oscillatoria group) and from the nitrite-oxidizing Nitrospira marina (one case, found in a sample from A. tripolium). Nineteen sequences (mostly from the vegetation free zone) detected were closely related to a-proteobacteria, among which the phototrophs Rhodovulum and Roseovarius of the Rhodobacteriaceae prevailed. Remarkably, the genus Loktanella, which was first described in 2004 in biofilms of Antarctic lakes (Van Trappen et al., 2004), was identified several times both in clones after growth in AOB medium and in DNA sequences from soil samples of Schreyahn. Sequences related to b-proteobacteria were rare (12 sequences: AY795684 to AY795692, AY795706, AY795710, AY79572). They were mainly obtained with AOB SSU primers and formed a distinct own group related to noncultured bacteria of which only sequences have been deposited as yet (for example AF358001). In contrast, g-proteobacteria sequences occurred more abundantly, with some clustering with the genus Halomonas of saline habitats, but with the major part being unknown, having some relatedness (<95% homology) to Fe- and S-oxidizing bacteria. Whereas d-proteobacteria related to marine members of the Myxococcales could be retrieved, no sequence originated from Acidobacteria. Finally, Gram-positive bacteria, most of them related to the Bacillus macroides group, could be detected in enrichment cultures. When the media were supplemented with NaCl, the 484 Table 2 Sum of the 16S rRNA gene sequences retrieved from soil DNA or from isolates of the Schreyahn potash marsh Prokaryotic group Aster tripolium Salicornia europaea Vegetation-free zone Mud 16SrRNA nifH nosZ amoA 16SrRNA nifH nosZ amoA 16SrRNA nifH nosZ amoA 16SrRNA nifH nosZ amoA 16SrRNA nifH nosZ amoA 24 3 5 9 0 57 8 5 5 1 48 5 6 5 8 48 6 0 0 10 11 10 7 4 0 2 1 1 2 2 6 11 2 4 1 11 S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 Total Archaea (32) Halorubrum (1) Haloferax (2) Halosimplex (2) Natronococcus (2) Natronomonas (1) Other Halobacteriaceae (24) Planctomycetacia CFB-group Gemmatimonadetes Actinobacteria Streptomyces (3) Cyanobacteria Bacilli Bacillus (1) Halobacillus (1) Nitrospira Nitrospira (1) a-Proteobacteria Methylobacterium (1) Sphingomonas (1) Roseovarius (1) Antarctobacter (1; 92% sequence homology) Loktanella (2; 97% sequence homology) Other Rhodobacteriaceae (2) Brevundimonas (2) Rhizobiaceae (16) b-Proteobacteria Hydrogenophaga (1) g-Proteobacteria Halomonas (2) Ectothiorhodospirillaceae (2) d-Proteobacteria Non-identified sequences Puccinellia 2 2 1 4 2 1 1 1 6 1 10 1 11 8 27 1 8 10 1 6 1 10 2 2 2 1 18 3 4 3 The number in parentheses indicates how often the prokaryotic group was found. 5 6 5 2 2 4 1 7 S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 sequences retrieved were closely related to Halobacillus salinus, H. locisalis and H. trueperi. Of the Gram-positive bacteria only one sequence showed a higher divergence (3.9%) from all the other Halobacillus sequences retrieved and thus stood apart. Actinobacteria with affiliations next to Streptomyces lavendulae, S. maritima and S. griseus were also found. Cyanobacteria were apparently not dominant in Schreyahn, and no mats with typical cyanobacteria were detected. This may explain why only two sequences related to the Oscillatoriales were retrieved. 3.3. Functional gene sequences retrieved from enrichment cultures or by PCR amplifications of the DNA extracted from the soil samples Regarding the nifH sequences obtained from soil DNA (Fig. 2), one of these clustered next to Bradyrhizobium japonicum and another one to Klebsiella pneumoniae. The other sequences fell into two separate groups with no affiliations to deposits in GenBank. Group 1 consisted of 10 distinct entries, and group 2 of 6. Several of these sequences were retrieved more than once (Fig. 2; AY795610: 5 times; AY795626: 3; AY795623: 4). The amplified nosZ sequences (Fig. 3) clustered next to Pseudomonas, rhizobia or to a group of uncultured bacteria (Scala and Kerkhof, 1998; Rösch et al., 2002). However, all sequences from Schreyahn represent novel nosZ lineages not found in present in databanks. Altogether 32 sequences for amoA, from the soil of S. europaea, A. tripolium, the vegetation-free zone and the salt heap, showed divergences of less than 2% from each other, and all might have originated from a non-described b-proteobacterium. On 449 bp which could be exploited because of the overlaps in both entries, these sequences were 98.2% homologous to the deposits AY353051 and AY353054 (Francis et al., 2003), In addition, a single sequence (from the A. tripolium soil) of a separate branch, was obtained which showed weak homology to the AF489631 deposit of a marine bacterium (Nicolaisen and Ramsing, 2002). 3.4. Putative classifications of the organisms retrieved from the different soil samples by using the newly developed TReFID databank To get an estimate on the quantitative distribution of prokaryotes in the soil samples selected at Schreyahn, all 22,145 16S rRNA gene tRF (terminal restriction fragments) in the TReFID databank were screened for their occurrence in the sum of tRFs generated from the soil DNA using the algorithm described (Rösch and Bothe, 2005). From one sample to the next, the total number of tRF patterns retrieved was rather different (e.g. 400 and 727 for P. distans and 98 or 1440 for S. europaea), but the relative distribution of the different prokaryotic groups was remarkably similar irrespectively from which zones the soil samples were selected (Fig. 5). The percentage of a-proteobacteria was always very high, followed by the g-proteobacteria. In contrast, the 485 relative amounts of b-proteobacteria and Acidobacteria were low. In all samples the percentage of bacteria with only sequence deposits in GenBank but with no affiliations to known bacterial classes was under 10% and thus relatively low. Even at the sites of the highest salt load (heap, mud), a- and g-proteobacteria were major constituents of the tRF patterns retrieved. Gram-positive bacteria (bacilli) were not detected in the TReFID analyses of any of the soil samples examined. The abundance of different bacterial groups probably decreased with the increase in the salt load, suggested by the cfu determinations. The number of samples analysed does not permit any such conclusion from the TReFID analyses. The distribution pattern just described is a special feature of the Schreyahn soil (Table 3). The high percentage of a-proteobacteria and to some extent also of g-proteobacteria was not reported in 14 publications on non-saline sites which were examined (the references are given in the legend to Table 3), and particularly not in the forest soil examined by us by comparable methodology (Rösch et al., 2002). Deposits of aproteobacteria are not overrepresented in the TReFID databank or GenBank. Table 3 also indicates that Acidobacteria which are common in most other soils occur only in low percentages in the Schreyahn samples. Thus the TReFID program allows us to assess the relative distribution of a prokaryotic group in an environmental sample. Analysis of the TReFID results enabled us to determine the percentage of prokaryotes which could be retrieved from the samples taken from any two plants or even from all three plants (Fig. 6). Among the 1639 unique tRF patterns found in total by use of the TReFID program, 50% came from S. europaea, 22% from P. distans, 13% from A. tripolium and 5% from soil surrounding all three plants. These were almost exclusively a- and g-proteobacteria with, in addition, some unclassified bacteria. The overlap between sequences retrieved from soils surrounding S. europaea (sites of the highest salt load) and P. distans (lowest salt load) was 22% with again a high percentage of common a-proteobacteria. Similar high values were determined for the other two plant combinations (A. tripolium and S. europaea or A. tripolium and P. distans, respectively). This might indicate that the distribution of prokaryotes does not follow so strictly the salt content as in the case of the plants. Sequences of true halophilic bacteria like Halomonas (AY795740) or Nitrospira marina (AY795679) were retrieved from soil samples taken from all three plants. It is also noteworthy that up to 50% of the sequences, which were obtained by us by cloning and sequencing of PCR products of Schreyahn soil samples and which then had been deposited into the TReFID databank, were retrieved in the tRF analysis of Schreyahn soil samples using the TReFID data basis and its algorithm. The finding that the distribution of bacteria in the Schreyahn potash marsh did not so strictly follow the salt content was even more evident when the same analysis was applied to the two genes nifH (Table 4) and nosZ (Table 5). However, the entries for nifH (1318) and nosZ (607) in the TReFID database are low compared to those for the 16S rRNA gene (22,145). In the case of nifH, the number of S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 486 Table 3 Relative abundance (in %) of bacterial groups commonly detected in soil microbial communities and in Schreyahn Group name rDNA dataa Schreyahn assessed by TreFIDb Total bacterial sequences in TReFID (%)c Sequences deposited in GenBank (%)d Proteobacteria a-Subdivision b-Subdivision g-Subdivision d-Subdivision Acidobacteria Verrucomicrobia Bacteroidetes Actinobacteria Firmicutes Planctomycetes Cyanobacteria Chlorobi Aquificae Nitrospira 10 14 46 5 11 12 32 23 55 66 7 13 10 14 12 11 <<1 <<1 01 63.7 9.0 2.2 2.8 16.2 8.0 0.3 0.3 1.0 0.9 0 0.0 1.5 1.0 1.9 3.0 1.0 1.3 0.3 0.3 1.0 1.1 0.6 0.6 0.3 0.4 0.3 0.5 9.5 8.3 11.7 1.0 2.4 0.6 9.3 7.9 9.0 1.7 5.0 0.3 0.5 0.4 8.8 5.9 13.7 2.4 0.7 0.4 3.9 10.1 10.0 0.7 2.9 0.2 0.3 0.2 For comparison see also the recently published review by Janssen (2006). The table contains standard deviations. a Data from Borneman et al., 1996; Borneman and Triplett, 1997; Kuske et al., 1997; Dunbar et al., 1999, 2002; McCaig et al., 1999; Nogales et al., 2001; Axelrood et al., 2002a,b; Krave et al., 2002; Rösch et al., 2002; Joseph et al., 2003; Liles et al., 2003; Demba Diallo et al., 2004. b Aster, Puccinellia (2) and Salicornia (2) samples, thus altogether 5 samples. c 21,534 entries in TReFID database. d 150,706 entries in GenBank as of February 2005. unidentified bacteria with only sequence deposits (Table 4) amounted to over 50% in all soil samples taken from the different sites in Schreyahn (Table 4). Known halophilic N2-fixing bacteria could not be identified here. Somewhat to our surprise, the Schreyahn samples contained a significant portion of bacteria, which we recently identified by cloning and sequencing, from a non-saline forest soil in the vicinity of Cologne, some 400 km away from Schreyahn (Rösch, 2005; Rösch and Bothe, to be published). These sequences deposited in GenBank were not related to those of known, cultured N2-fixing bacteria and could, therefore, not be affiliated. Among these, a sequence (termed OTU 30 ¼ operational taxonomic unit 30) in the phylogenetic analysis, occurred everywhere in the Schreyahn soil samples analysed, and OTU 24 and 29 were found at almost all sites (Table 4). Due to the limited numbers of entries for nosZ in TReFID, only few sequences of this gene could be retrieved from the tRFs obtained from DNA isolated from soil surrounding the different plants at Schreyahn (Table 5). The number of tRF patterns corresponding to unidentified organisms (where only sequences have been deposited in the databanks) was between 10 and 38% and thus not as high as those containing nifH. Some sequences closely matched those of well-characterized bacterial genera (Ochrobactrum, Achromobacter, etc). The detection of the halophilic Azospirillum halopraeferens in three soil samples (from A. tripolium, P. distans and the heap) was particularly noteworthy. Sequences related to deposits obtained from DNA of the Cologne forest soil were also obtained in the analysis of nosZ. Also with this gene, several bacteria were retrieved in the soil sample that had been found in the clone library and deposited in TReFID beforehand. Similar to other bacteria the distribution of those with nosZ also seemed independent of the salt gradient, in clear contrast to the plant sociological behaviour. 4. Discussion Most alkaliphilic sites are confined to dry areas with high evaporation rates and have pH values around 10 (Sorokin and Kuenen, 2005) and organisms that colonize such sites must be Fig. 6. Intersecting set of prokaryotes referred to the 16S rRNA gene that were retrieved from soils surrounding S. europaea, A. tripolium and P. distans. 100% refers to the sum of the sequences retrieved from the soil samples in total by using the TReFID database. S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 487 Table 4 Pattern in the nifH distribution in soil samples taken at Schreyahn Prokaryotic group A. tripolium A. tripolium P. distans S. europaea S. europaea Mud Heap Total tRF patterns retrieved in TReFID ( ¼ 100%) Unidentified sequences (sequence deposits only available in the databanks) Beijerinckia Treponema Methylocystis (-sinus) Methylothermobacter Methylobacter Methylomonas Methylobrevibacter Methylosarcina Rhizobiaceae Klebsiella Burkholderia Spirochaeta Vibrio Desulfovibrio Rhodobacteriaceae Cyanobacteria Dünnwald OTU 05 OTU 06 OTU 08 OTU 10 OTU 11 OTU 15 OTU 24 OTU 29 OTU 30 OTU 33 53 76 94 23 174 54 10 51% (27) 66% (50) 79% (74) 53% (12) 79% (136) 77% (42) 60% (6) 2% (1) 1% (1) 1% (1) 3% (3) 2% (1) 2% (1) 1% 1% 1% 1% 1% (1) 1% (1) (1) (1) (1) (1) 1% (1) 1% (1) 3% (5) 4% (3) 2% (1) 2% (1) 1% (1) 1% (1) 4% (2) 2% (2) 2% (1) 2% (1) 8% (6) 3% (2) 8% (2) 1% (1) 1% (1) 1% (1) 2% 2% 2% 2% (1) (1) (1) (1) 10% (1) 2% (1) 1% (1) 1% (1) 4% (2) 1% (1) 2% (1) 4% (1) 1% (1) 2% 2% 8% 15% (1) (1) (4) (8) 3% (2) 8% (6) adapted to these harsh conditions. In contrast, the Schreyahn salt marsh is located in the temperate zone, with generally non-limiting rain supply during the year. The dominating salt is K2CO3, the pH value is only around 8.0, and the different plants serve as indicators of the horizontal salt gradient in the soil. To our knowledge, a similar site has not yet been analysed for its 1% 2% 1% 1% (1) (2) (1) (1) 1% (1) 4% (1) 31% (7) 11% (27) 2% (1) 9% (5) 20% (2) 10% (1) prokaryotic community structure. Schreyahn offers the perspective that extremely and moderately halophilic prokaryotes could live here side by side, and that new groups of organisms, specifically adapted to the different K2CO3 loads in the soil could be detected. Indeed, several new and unexpected disclosures arose from the present study. Table 5 Pattern in the nosZ distribution in soil samples taken at Schreyahn Prokaryotic group A. tripolium P. distans S. europaea Heap Total tRF patterns retrieved in TReFID ( ¼ 100%) Unidentified sequences (sequence deposits only available in the databanks) Ochrobactrum Achromobacter Azospirillum halopraeferens Paracoccus Pseudomonas Schreyahn nosZ sequence from the own clone library Dünnwald nosOTU 14 nosOTU 37 nosOTU 43 38 27 11 10 29% (11) 2.5% (1) 5% 5% 10.5% 26% (2) (2) (4) (10) 10.5% (4) 2.5% (1) 25% (7) 9% (1) 4% (1) 4% (1) 4% (1) 10% (2) 27% (9) 14% (4) 4% (1) 4% (1) 64% (7) 10% 10% 10% 50% (1) (1) (1) (5) 18% (2) 9% (1) 10% (1) 10% (1) 488 S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 First of all, the Schreyahn soil harbours halophilic Archaea like Halorubrum, Halogeometricum or alkaliphilic ones such as Natronococcus and Natronomonas which are known to live in hypersaline NaCl or soda environments (Burns et al., 2004a,b; Sörensen et al., 2005). In Schreyahn, however, the salt load does not exceed 20%, even in the brine of the mud. The electric conductivity measurements can only be roughly converted to salt concentrations but the maximal EC value of 82 mS/cm measured in the mud corresponds to approximately 5.3% NaCl (Table 1). Since closely related taxa can be halophilic or not, the organism behind a new sequence retrieved from an environmental sample cannot, in most cases, be assigned to being halophilic, although affiliation to a known taxon is frequently possible by comparison with the databank entries. As with the Archaea, also with the Bacteria, some clearly halophilic species such as Halobacillus sp. with almost identical sequences to H. locisalis of a saltern at the Yellow Sea in Korea (Yeon, submission AY190534 to GenBank, 2004) and Loktanella found in brines of the Vestfold Hill region (Van Trappen et al., 2004) in a coastal, ice-free area in East Antarctica (Ventosa and Nieto, 1998) were detected. Other true halophilic genera or species to be mentioned here were Streptomyces with a sequence closely related to that from S. maritima, Nitrospira (close to N. marina), Halomonas (two sequence deposits, with almost 100% similarity to H. cupida) or Sphingomonas with close relatedness to Sphingomonas sp. (AF235131) and S. faenia (AJ429239). Azospirillum halopraeferans was retrieved several times in Schreyahn but is generally not mentioned in reports on bacteria in hypersaline environments. A. halopraeferans requires 0.25% NaCl for good growth (Reinhold et al., 1987). Remarkably, the distribution of halophilic Archaea and Bacteria unlikely followed the salt gradient in the soil, since several of them (Halomonas AY795741, Nitrospira AY795679, Haloarchaea DQ177853, DQ177856 and DQ177842, for example) were retrieved from samples taken from the roots of P. distans, the area with the lowest salt load examined as well as in soils of higher salt content. However, growth of many salt resistant prokaryotes (e.g. the Halobacteriaceae) is strictly dependent on a much higher salt load than around the roots of P. distans (Ventosa and Nieto, 1998; Oren, 1999). This could mean that microsites with high salt concentrations exist at sites like around P. distans and, conversely, salt-intolerant species may occupy non-loaded microsites in high salt sites. Such microsites should, however, not affect the belt formations of the halophytes. Alternatively, it may be suggested that the extremely salt resistant prokaryotes may remain dormant when the salt concentration in the soil is too low and may resume life activity when the salt concentration in the soil rises during drought periods. These inland salt marshes with their own ecology offer fascinating perspectives not only with respect to their plant distribution but also in their community of prokaryotes and their adaptation mechanisms. The recently discovered Salinibacter ruber (Anton et al., 2002) which has now been detected in several hypersaline waters (Benlloch et al., 2002; Øvreås et al., 2003; Pašić et al., 2005) was, however, not in the list of the Schreyahn bacteria. Since its 16S rDNA sequence was deposited in the TReFID bank, it might have been retrieved if occurring abundantly at Schreyahn. Other members of the Sphingobacteriaceae with clear sequence divergence from S. ruber were detected. Like salt tolerant and resistant species, non-tolerant prokaryotes occurred also at all sites in Schreyahn. Somewhat surprisingly, several sequences were detected which we recently found in a totally different, sandy, non-saline soil of a mixed fir-oak-hornbeam wood in the Rhine valley close to Cologne (Rösch, 2005; Rösch and Bothe, to be published). Others found in Schreyahn such as Bacillus macroides or Brevundimonas apparently were non-halophilic; these were also retrieved from all sites with the exception of the heap. With respect to the nitrogen cycle, the demonstration of 16S rRNA gene sequences coding for planctomycetes is noteworthy because these bacteria possibly perform the anammox reaction which is a topic of current interest (Dalsgaard et al., 2003; Kuypers et al., 2003). Sequences of planctomycetes were retrieved from a hypersaline environment, the stromatolites of the Hamelin pool, Shark Bay in Western Australia (Burns et al., 2004a,b), but the Schreyahn sequences are at best distantly related to those from Australia and all others of the databanks. The nitrifiers are other constituents of the N cycle that have recently been reported to operate in saline areas (Sorokin and Kuenen, 2005). One sequence of amoA retrieved several times from Schreyahn was totally unrelated to that of marine Nitrosococcus or Nitrosomonas halophila Nm1 (Sorokin et al., 2001) as well as to those of terrestric (Nitrosospira and others) ammonia oxidizing bacteria. However, it shows only 1.8% sequence divergence from those obtained from marine sediments of the Chesapeake Bay on the Eastern coast of the United States (Francis et al., 2003). These bacteria may represent a novel group of nitrifiers which needs laboratory cultivation prior to elucidate its properties. Soda lakes are known to harbour bacteria participating in the sulphur cycle (Sorokin and Kuenen, 2005). In line with this, Thiothrix was retrieved several times in the 16S rRNA TReFID analysis of samples from Schreyahn. Many new sequences closely matched those of as yet uncultured bacteria where only sequence deposits are available in the databanks. This was particularly evident in the case of nifH despite the fact that this gene has been characterized from many known N2-fixing bacteria. Nitrogenase occurrence in bacteria has been extensively studied in diverse environments by the use of this gene (Zehr et al., 2003), but studies like the current one reveal that a number of diazotrophs not yet described may exist in nature. This also follows from other recent studies (Knauth et al., 2005). The observation that bacteria occur in Schreyahn which have only recently been isolated from far away areas like Vestfold in the Antarctic or Korea may be surprising at first glance, particularly since the Schreyahn salt marsh and the other 100 or so potash mines in Northern Germany are relatively young historically. Prokaryotes may be propagated by wind over long distances and within a short time scale to result in a cosmopolitan distribution. Due to the rather limited knowledge about S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 such a distribution, prokaryotes detected in exotic places may in reality have a wider occurrence than sometimes assumed. The high species richness of halophytes in Schreyahn is more surprising. It is assumed but not proven that these plants are propagated by migrating birds which could also be the cause for the prokaryote distribution, but also further, unresolved factors may play a role in radiation. The proportion of sequences that could not be affiliated with databank (GenBank) entries was below 10% for all genes employed. Among these, endemic species may occur, although endemism for bacteria is disputed or rare (Donachie et al., 2004). Also with respect to plants, the unusual habitat of the potash mines in Northern Germany possesses the common halophytes of salt marshes with the notable exception of Hymenolobus procumbens (Brassicaceae) which is almost exclusively restricted to potash locations (Haeupler and Muer, 2000). Culturing approaches or sequencing of PCR-products of extracted DNA generally permit to characterize only a small percentage of the bacteria of a soil (only ‘‘a needle in the haystack’’, generally below 1% of the total community under investigation) and are not successful for identifying dominant bacterial species in saline environments (Buchan et al., 2003). Computer-based algorithms (Kent et al., 2003) have recently been developed to assess the biodiversity of the bacterial life in environmental samples without the need to sequence clone libraries or isolate strains. The TReFID program (Rösch and Bothe, 2005) has now been employed to compare the relative abundance of prokaryotes at sites of different salt contents in the soil with some remarkable results. First of all, with the exception of the heap, the intersecting set of prokaryotes that occurred at all Schreyahn sites (or jointly at the site of the highest and lowest salt load) was high. The distribution of either halophilic or non-salt prokaryotes apparently does not follow the salt gradient as already suggested from the data of the clone library. It shows that a- and likely also g-proteobacteria thrive abundantly in Schreyahn soils which is in agreement with reports from other saline habitats (Benlloch et al., 2002; Buchan et al., 2003). Among the aproteobacteria, members of the Rhodobacteriaceae play a dominant role at hypersaline sites (Øvreås et al., 2003; Fourcans et al., 2004) and also at Schreyahn. In contrast, Acidobacteria, which occur almost everywhere in soils, amounted to less than 1% of the sum of bacteria retrieved and were thus rare in Schreyahn. These statements are based on 1639 16S rRNA tRF patterns of the TReFID databank which were found in the Schreyahn soil samples. However, the confidence in the statement of the present study should be taken as akin to predictions before human elections. Claims will be safer, the more sequences are deposited that can be exploited for such algorithms as used here. For the evaluation of the data obtained, gene amplifications by PCR seem to be most critical. It was stated already years ago (Polz and Cavanaugh, 1998) that different target genes cannot be amplified to the same extent from one PCR to the next. Purity of the DNA extracted and exact standardization of the PCR protocol as well as of the amount of DNA subjected to tRFLP analysis seem to be crucial. As an extreme 489 example, 1440 tRF patterns were retrieved from the DNA taken from the roots of S. europaea in the first PCR whereas only 98 could be analysed at the next. In tRFLP, the heights and the areas of the peaks can hardly be exploited to determine the relative abundance of one single species (species evenness) in a sample. As regards species richness, a tRFLP peak size may be just above the threshold value with DNA from one sample but so low in the next that the bacterium behind it is dismissed. DNA of particularly rare and thus low-density bacteria may not be well amplified. The Gram-positive bacilli were well represented in the current clone library but were almost absent in the tRF patterns from the TReFID program. Bacilli may well be overrepresented in culturing approaches, a possibility which has also been noted by others (Felske et al., 1999; Buckley and Schmidt, 2002). Thus the present study showed that the TReFID program can be successfully employed to give a gross analysis of the prokaryotic community structure in different environmental samples based on the entries in the databank. However, biases with the PCR amplifications must be addressed to be more quantitative, and the databases particularly for the functional genes like nifH or nosZ have to be enlarged to obtain more reliable data. 5. Conclusions Approaches based on culturing of bacteria or on sequencing of PCR-products of DNA from small clone libraries yield data of relatively few bacteria of a soil community due to its extreme species richness. In spite of this, the molecular analysis of bacteria occurring at the polluted site resulting potash mining provided information on a lot of new, not yet deposited sequences but also on some bacteria that had been described to occur at far distant locations. The recently developed TReFID algorithm for identifying prokaryotes in an environmental sample can be applied successfully to characterize a prokaryotic community with confidence. Whereas the distribution of plants at such a potash polluted sitedsimilar as in a NaCl marshdstrictly follows the salt gradient in the soil, all the evidence obtained thus far indicated that this is not the case for prokaryotes. Microorganisms of hypersaline areas coexist with salt-non-tolerant species at different concentrations of potash in the soil. Sequences obtained for amoA of ammonium monooxygenase from nitrifying bacteria, for nosZ of nitrous oxide reductase of denitrifying microorganisms and for nifH of nitrogenase of nitrogen-fixing bacteria were repeatedly retrieved. This might indicate that all these reactions of the nitrogen cycle could play an ecological role in this polluted environment. Acknowledgements The authors are indebted to Dr M.G. Yates, formerly at the Unit of Nitrogen Fixation in Brighton, UK, for carefully commenting and improving the English. The excellent technical expertise of Mirela Stecki and Karin Otto is also gratefully acknowledged. 490 S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 References Anton, J., Oren, A., Benlloch, S., Rodriguez-Valera, F., Amann, R., RosselloMora, R., 2002. Salinobacter ruber gen. nov., sp. nov., a novel, extremely halophilic member of the bacteria from saltern crystallizer ponds. International Journal of Systematic and Evolutionary Microbiology 52, 485e491. Axelrood, P.E., Chow, M.L., Arnold, C.S., Lu, K., McDermott, J.M., Davies, J., 2002a. Cultivation-dependent characterization of bacterial diversity from British Columbia forest soils subjected to disturbance. Canadian Journal of Microbiology 48, 643e654. Axelrood, P.E., Chow, M.L., Radomski, C.C., McDermott, J.M., Davies, J., 2002b. Molecular characterization of bacterial diversity from British Columbia forest soils subjected to disturbance. Canadian Journal of Microbiology 48, 655e674. Benlloch, S., Lopez-Lopez, A., Casamayor, E.O., Øvreås, L., Goddard, V., Daae, F.L., Smerdon, G., Massana, R., Joint, I., Thingstad, F., PedrosAlio, C., Rodriguez-Valera, F., 2002. Prokaryotic genetic diversity throughout the salinity gradient of a coastal salar saltern. Environmental Microbiology 4, 349e360. Borneman, J., Triplett, E.W., 1997. Molecular microbial diversity in soils from eastern Amazonia: evidence for unusual microorganisms and microbial population shifts associated with deforestation. Applied and Environmental Microbiology 63, 2647e2653. Borneman, J., Skroch, P.W., O’Sullivan, K.M., Palus, J.A., Rumjanek, N.G., Jansen, J.L., Nienhuis, J., Triplett, E.W., 1996. Molecular microbial diversity of an agricultural soil in Wisconsin. Applied and Environmental Microbiology 62, 1935e1943. Buchan, A., Newell, S., Butler, M., Biers, E., Hollibaugh, J., Moran, M., 2003. Dynamics of bacterial and fungal communities on decaying salt marsh grass. Applied and Environmental Microbiology 69, 6676e6687. Buckley, D.H., Schmidt, T.M., 2002. Exploring the Biodiversity of SoildA Microbial Rain Forest. In: Stanley, J.T., Reysenbach, A.-L. (Eds.), Biodiversity and Microbial Life. Wiley-Liss, New York, pp. 183e208. Burns, D.G., Camakaris, H.M., Janssen, P.H., Dyall-Smith, M.L., 2004a. Combined use of cultivation-dependent and cultivation-independent methods indicates that members of most haloarchaeal groups in an Australian crystallizer pond are cultivable. Applied and Environmental Microbiology 70, 5258e5265. Burns, B.P., Goh, F., Allen, M., Neilan, B.A., 2004b. Microbial diversity of extant stromatolites in the hypersaline marine environment of Shark Bay, Australia. Environmental Microbiology 6, 1096e1101. Dalsgaard, T., Canfield, D.E., Petersen, J., Thamdrup, B., Acuna-Gonzalez, J., 2003. N2 production by the anammox reaction in the anoxic water column of Golfo Dulce, Costa Rica. Nature 422, 606e608. Demba Diallo, M., Martens, M., Vloemans, N., Cousin, S., Vandekerckhove, T.T.M., Neyra, M., de Lajudie, P., Willems, A., Gillis, M., Vyverman, W., Van der Gucht, K., 2004. Phylogenetic analysis of partial bacterial 16S rDNA sequences of tropical grass pasture soil under Acacia tortilis subsp. raddiana in Senegal. Systematic and Applied Microbiology 27, 238e252. Donachie, S.P., Hou, S., Lee, K.S., Riley, C.W., Pikina, A., Belisle, C., Kempe, S., Gregory, T., Bossuyt, A., Boerema, J., Liu, J., Freitas, T.A., Malahoff, A., Alam, M., 2004. The Hawaiian archipelago: a microbial diversity hotspot. Microbial Ecology 48 (4), 509e520. Dunbar, J., Takala, S., Barns, S.M., Davis, J.A., Kuske, C.R., 1999. Levels of bacterial community diversity in four arid soils compared by cultivation and 16S rRNA gene cloning. Applied and Environmental Microbiology 65, 1662e1669. Dunbar, J., Barns, S.M., Ticknor, L.O., Kuske, C.R., 2002. Empirical and theoretical bacterial diversity in four Arizona soils. Applied and Environmental Microbiology 68, 3035e3045. Ellenberg, H., 1988. Vegetation Ecology of Central Europe. Cambridge University Press, Cambridge, New York. Felsenstein, J., 2004. PHYLIP: Phylogeny Inference Package. Felske, A., Wolterink, A., van Lis, R., de Vos, W.M., Akkermans, A.D.L., 1999. Searching for predominant soil bacteria: 16S rDNA cloning versus strain cultivation. FEMS Microbiology Ecology 30, 137e145. Fourcans, A., De Oteyza, T.G., Wieland, A., Sole, A., Diestra, E., Van Bleijswijk, J., Grimalt, J.O., Kühl, M., Esteve, I., Muyzer, G., Caumette, P., Duran, R., 2004. Characterization of functional bacterial groups in a hypersaline microbial mat community (Salins-de-Giraud, Cammargue, France). FEMS Microbiology Ecology 51, 55e70. Francis, L.A., O’Mullan, G.D., Ward, B.B., 2003. Diversity of amoA genes across environmental gradients in Chesapeake Bay sediments. Geobiology 1, 129e140. Galtier, N., Gouy, M., Gautier, C., 1996. SeaView and Phylo_win, two graphic tools for sequence alignment and molecular phylogeny. Computer Applications in Biosciences 12, 543e548. Haeupler, H., Muer, T., 2000. Bildatlas der Farn- und Blütenpflanzen Deutschlands. Eugen Ulmer, Stuttgart. Horst, K., Redel, I., 1977. Salzpflanzen und salzliebende Pflanzengesellschaften bei Schreyahn - ein schutzwürdiges Refugium im Hannoverschen Wendland. Jahresheft des Heimatlichen Arbeitskreises Lüchow-Dannenberg 6, 25e35. Janssen, P.H., 2006. Identifying the dominant soil bacterial taxa in libraries of 16S rRNA and 16S rRNA genes. Applied and Environmental Microbiology 72, 1719e1728. Joseph, S.J., Hugenholtz, P., Sangwan, P., Osborne, C.A., Janssen, P.H., 2003. Laboratory cultivation of widespread and previously uncultured soil bacteria. Applied and Environmental Microbiology 69, 7210e7215. Kent, A.D., Smith, D.J., Benson, B.J., Triplett, E.W., 2003. Web-based phylogenetic assignment tool for analysis of terminal restriction fragment length polymorphism profiles of microbial communities. Applied and Environmental Microbiology 69, 6768e6776. Knauth, S., Hurek, T., Brar, D., Reinhold-Hurek, B., 2005. Influence of different cultivars on expression of nifH gene pools in roots of maize. Environmental Microbiology 7, 1725e1731. Krave, A.S., Lin, B., Braster, M., Laverman, A.M., van Straalen, N.M., Röling, W.F., van Verseveld, H.W., 2002. Stratification and seasonal stability of diverse bacterial communities in a Pinus merkusii (pine) forest soil in central Java, Indonesia. Environmental Microbiology 4, 361e373. Kuske, C.R., Barns, S.M., Busch, J.D., 1997. Diverse uncultivated bacterial groups from soils of the arid southwestern United States that are present in many geographic regions. Applied and Environmental Microbiology 63, 3614e3621. Kuypers, M.M., Sliekers, A.O., Lavik, G., Schmid, M., Jörgensen, B.B., Kuenen, J.G., Damsté, J.S.S., Strous, M., Jetten, M.S.M., 2003. Anaerobic ammonium oxidation by anammox bacteria in the Black Sea. Nature 422, 608e611. Liles, M.R., Manske, B.F., Bintrim, S.B., Handelsman, J., Goodman, R.M., 2003. A Census of rRNA Genes and Linked Genomic Sequences within a Soil Metagenomic Library. Applied and Environmental Microbiology 69, 2684e2691. Lopez-Garcia, P., López-López, A., Moreira, D., Ródriguez-Valera, F., 2001. Diversity of free-living prokaryotes from a deep-sea site at the Antarctic polar front. FEMS Microbiology and Ecology 36, 193e202. Marschner, H., 1986. Mineral Nutrition in Higher Plants. Academic Press, London. McCaig, A.E., Glover, L.A., Prosser, J.L., 1999. Molecular analysis of bacterial community structure and diversity in unimproved and improved upland grass pastures. Applied and Environmental Microbiology 65, 1721e1730. Munson, M.A., Nedwell, D.B., Embley, T.M., 1997. Phylogenetic Diversity of Archaea in Sediment Samples from Coastal Salt Marsh. Applied and Environmental Microbiology 63, 4729e4733. Nicolaisen, M.H., Ramsing, N.B., 2002. DGGE approaches to study the diversity of AOB. Journal of Microbiology Methods 50, 189e203. Nogales, B., Moore, E.R., Llobet-Brossa, E., Rossello-Mora, R., Amann, R., Timmis, K.N., 2001. Combined use of 16S ribosomal DNA and 16S rRNA to study the bacterial community of polychlorinated biphenylpolluted soil. Applied and Environmental Microbiology 67, 1874e1884. Oren, A., 1999. Bioenergetic aspects of halophilism. Microbial Molecular Biology Reviews 63, 334e348. S. Eilmus et al. / Environmental Pollution 146 (2007) 478e491 Oren, A., 2002. Diversity of halophilic microorganisms; environments, phylogeny, physiology and applications. Industrial Microbiology and Biotechnology 28, 53e63. Øvreås, L., Daae, F.L., Torsvik, V., Rodriguez-Valera, F., 2003. Characterisation of microbial diversity in hypersaline environments by melting profiles and reassociation kinetics in combination with terminal restriction fragment length polymorphism (T-RFLP). Microbial Ecology 46, 291e301. Pašić, L., Bartual, S.G., Ulrih, N.P., Grabmar, M., Herzog Velikonja, B.H., 2005. Diversity of halophilic archaea in the crystallizers of an Adriatic solar saltern. FEMS Microbiology and Ecology 54, 491e498. Pfennig, N., Trüper, H.G., 1981. Isolation of members of the families Chromatiaceae and Chlorobiaceae. In: Starr, M.P., Stolp, H., Trüper, H.G., Balows, A., Schlegel, H.G. (Eds.), The Prokaryotes. Springer, Berlin Heidelberg New York, pp. 279e289. Polz, M.F., Cavanaugh, C.M., 1998. Bias in template-to-product ratios in multitemplate PCR. Applied and Environmental Microbiology 64 (10), 3724e3730. Reinhold, B., Hurek, T., Fendrik, I., Pot, B., Gillis, M., Kertsers, K., Thielemans, D., De Ley, J., 1987. Azospirillum halopraeferans sp. nov., a nitrogen fixing organism associated with roots of Kallar grass (Leptochloa fusca (L. Kunth)). International Journal of Systematic Bacteriology 37, 43e51. Rösch, C., 2005. Entwicklung eines Datenbank-gestützten Computerprogramms zur taxonomischen Identifizierung von mikrobiellen Populationen auf molekularer Basis. Thesis. University of Cologne, Cologne. Rösch, C., Bothe, H., 2005. Improved assessment of denitrifying, N2-fixing, and total-community bacteria by terminal restriction fragment length polymorphism analysis using multiple restriction enzymes. Applied and Environmental Microbiology 71, 2026e2035. Rösch, C., Mergel, A., Bothe, H., 2002. Biodiversity of denitrifying and dinitrogen-fixing bacteria in an acid forest soil. Applied and Environmental Microbiology 68, 3818e3829. 491 Rotthauwe, J.H., Witzel, K.P., Liesack, W., 1997. The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Applied and Environmental Microbiology 63, 4704e4712. Scala, D.J., Kerkhof, L.J., 1998. Nitrous oxide reductase (nosZ ) gene-specific PCR primers for detection of denitrifiers and three nosZ genes from marine sediments. FEMS Microbiology Letters 162, 61e68. Sörensen, K.B., Canfield, D.E., Teske, A.P., Oren, A., 2005. Community composition of a hypersaline endoevaporite microbial mat. Applied and Environmental Microbiology 71, 7325e7365. Sorokin, D.Y., Kuenen, J.G., 2005. Chemolithotrophic haloalkaliphiles from soda lakes. FEMS Microbiology and Ecology 52, 287e295. Sorokin, D.Y., Tourova, T.P., Schmid, M., Wagner, M., Koops, H.-J., Kuenen, J.G., Jetten, M., 2001. Isolation and properties of obligately chemolithoautotrophic and extremely alkali-tolerant ammonia-oxidizing bacteria from Mongolian soda lakes. Archives of Microbiology 176, 170e177. Stocker, O., 1928. Das Halophytenproblem. In: v.Frisch, K., Goldschmidt, R., Ruhland, W., Winterstein, H. (Eds.), Ergebnisse der Biologie. Verlag von Julius Springer, Berlin, pp. 266e353. Torsvik, V., Goksøyr, J., Daae, F.L., 1990. High diversity in DNA of soil bacteria. Applied and Environmental Microbiology 56, 782e787. Van Trappen, S., Mergaert, J., Swings, J., 2004. Loktanella fryxellensis gen. nov. sp. nov., Loktanella vestfoldensis sp. nov. and Loktanella salsilacus sp. nov., new members of the Roseobacter clade, isolated from microbial mats in Antarctic lakes. International Journal of Systematic and Evolutionary Microbiology 54, 1263e1269. Ventosa, A., Nieto, J.J., 1998. Biology of moderately halophilic aerobic bacteria. Microbiology Molecular Biology Reviews 62, 504e544. Zehr, J.P., Jenkins, B.D., Short, S.M., Steward, G.F., 2003. Nitrogenase gene diversity and microbial community structure: a cross-system comparison. Environmental Microbiology 5, 539e554.