* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download video slide - Wesleyan College Faculty
Gene regulatory network wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Genome evolution wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
List of types of proteins wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Molecular evolution wikipedia , lookup
Silencer (genetics) wikipedia , lookup
SNP genotyping wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
DNA vaccination wikipedia , lookup
Genomic library wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Chapter 20 DNA Technology and Genomics PowerPoint TextEdit Art Slides for Biology, Seventh Edition Neil Campbell and Jane Reece Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.1 DNA microarray that reveals expression levels of 2,400 human genes (enlarged photo) Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.2 Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes Bacterium 1 Gene inserted Cell containing gene of interest into plasmid Bacterial chromosome Gene of interest Plasmid Recombinant DNA (plasmid) 2 Plasmid put into DNA of chromosome bacterial cell Recombinate bacterium 3 Host cell grown in culture, to form a clone of cells containing the “cloned” gene of interest Gene of interest Copies of gene Basic research on gene Gene for pest resistance inserted into plants Protein expressed by gene of interest Protein harvested 4 Basic research and various applications Gene used to alter bacteria for cleaning up toxic waste Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Protein dissolves blood clots in heart attack therapy Basic research on protein Human growth hormone treats stunted growth Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction site DNA 5 3 3 5 GAATTC CTTAAG 1 Restriction enzyme cuts the sugar-phosphate backbones at each arrow G G Sticky end 2 DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. G AATTC C TTAA G G Fragment from different DNA molecule cut by the same restriction enzyme G AATTC CTTAA G One possible combination 3 DNA ligase seals the strands. Recombinant DNA molecule Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings G Figure 20.4 Cloning a human gene in a bacterial plasmid (layer 1) 1 Isolate plasmid DNA and human DNA. Bacterial cell lacZ gene (lactose breakdown) Human cell Restriction site ampR gene (ampicillin resistance) 2 Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Bacterial plasmid Gene of interest Sticky ends Human DNA Fragments Recombinant DNA plasmids Figure 20.4 Cloning a human gene in a bacterial plasmid (layer 2) 1 Isolate plasmid DNA and human DNA. Bacterial cell lacZ gene (lactose breakdown) Human cell Restriction site ampR gene (ampicillin resistance) Bacterial plasmid Sticky ends 2 Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Gene of interest Human DNA Fragments Recombinant DNA plasmids Recombinant bacteria Figure 20.4 Cloning a human gene in a bacterial plasmid (layer 3) 1 Isolate plasmid DNA and human DNA. Bacterial cell lacZ gene (lactose breakdown) Human cell Restriction site ampR gene (ampicillin resistance) Bacterial plasmid Sticky ends 2 Cut both DNA samples with the same restriction enzyme, one that makes a single cut within the lacZ gene and many cuts within the human DNA. 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Gene of interest Human DNA Fragments Recombinant DNA plasmids Recombinant bacteria Colony carrying nonrecombinant plasmid with intact lacZ gene Colony carrying recombinant plasmid with disrupted lacZ gene Bacterial clone Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.5 Nucleic acid probe hybridization APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, step 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. Colonies containing gene of interest Master plate Master plate Probe DNA TECHNIQUE Solution containing probe Radioactive single-stranded DNA Gene of interest Single-stranded DNA from cell Filter Film Filter lifted and flipped over Hybridization on filter 1 A special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter. RESULT 2 The filter is treated to break open the cells and denature their DNA; the resulting singlestranded DNA molecules are treated so that they stick to the filter. 3 The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 4 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.6 Genomic libraries Foreign genome cut up with restriction enzyme or Recombinant plasmids Bacterial clones (a) Plasmid library Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Recombinant phage DNA Phage clones (b) Phage library Figure 20.7 The polymerase chain reaction (PCR) 5 3 Target sequence APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. TECHNIQUE The starting materials for PCR are doublestranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. 1 Denaturation: 5 5 3 3 5 Heat briefly to separate DNA strands 2 Annealing: Cycle 1 yields 2 molecules Cool to allow primers to hydrogen-bond. Primers 3 Extension: DNA polymerase adds nucleotides to the 3 end of each primer Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 3 Genomic DNA New nucleotides Figure 20.8 Gel Electrophoresis APPLICATION Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). Cathode 1 Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. Power source 2 When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. Mixture of DNA molecules of different sizes Gel Glass plates Anode Longer molecules TECHNIQUE RESULTS Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length. After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Shorter molecules Figure 20.9 Using restriction fragment analysis to distinguish the normal and sickle-cell alleles of the -globin gene Normal -globin allele 201 bp 175 bp DdeI DdeI Large fragment DdeI DdeI Sickle-cell mutant -globin allele Large fragment 376 bp Ddel Ddel Ddel (a) DdeI restriction sites in normal and sickle-cell alleles of -globin gene. Normal Sickle-cell allele allele Large fragment 376 bp 201 bp 175 bp (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.10 Southern blotting of DNA fragments APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). DNA + restriction enzyme Restriction fragments I II III Nitrocellulose paper (blot) Heavy weight Gel Sponge I Normal -globin allele Alkaline solution II Sickle-cell III Heterozygote allele 1 Preparation of restriction fragments. 2 Gel electrophoresis. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 3 Blotting. Paper towels Radioactively labeled probe for -globin gene is added to solution in a plastic bag I II III Probe hydrogenbonds to fragments containing normal or mutant -globin Paper blot 1 Hybridization with radioactive probe. RESULTS Fragment from sickle-cell -globin allele Fragment from normal -globin allele I II III Film over paper blot 2 Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.11 Three-stage approach to mapping an entire genome Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) Chromosome bands Genes located by FISH 1 Genetic (linkage) mapping Ordering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) Genetic markers 2 Physical mapping Ordering of large overlapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors Overlapping fragments 3 DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the complete genome sequence Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings …GACTTCATCGGTATCGAACT… Figure 20.12 Dideoxy chain-termination method for sequencing DNA APPLICATION The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. TECHNIQUE RESULTS This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA (template strand) 5 C T G A C T T C G A C A A 3 5 3 C T G A C T T C G A C A A Primer 3 T G T T Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) 5 DNA polymerase dATP ddATP dCTP ddCTP dTTP ddTTP dGTP ddGTP P P P P P P G OH ddG C T G T T ddA G C T G T T ddA A G C T G T T ddG A A G C T G T T ddT G A A G C T G T T Direction of movement of strands Laser Detector G A C T G A A G C H Labeled strands DNA (template strand) ddC T G T T G ddC T G A A G C T G T T ddA C T G A A G C T G T T ddG A C T G A A G C T G T T 3 Figure 20.13 Whole-genome shotgun approach to sequencing 1 Cut the DNA from many copies of an entire chromosome into overlapping fragments short enough for sequencing. 2 Clone the fragments in plasmid or phage vectors 3 Sequence each ACGATACTGGT fragment CGCCATCAGT 4 Order the sequences into one overall sequence with computer software. ACGATACTGGT AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA… Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Table 20.1 Genome Sizes and Estimated Numbers of Genes* Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.14 Research Method DNA microarray assay of gene expression levels APPLICATION With this method, researchers can test thousands of genes simultaneously to Tissue sample determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression. TECHNIQUE mRNA molecules 1 Isolate mRNA. 2 Make cDNA by reverse transcription, using fluorescently labeled nucleotides. Labeled cDNA molecules (single strands) 3 Apply the cDNA mixture to a microarray, a microscope slide on which copies of singlestranded DNA fragments from the organism’s genes are fixed, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. 4 Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample. RESULT The intensity of fluorescence at each spot is a measure of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the cDNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA microarray Size of an actual DNA microarray with all the genes of yeast (6,400 spots) Figure 20.15 RFLPs as markers for disease-causing alleles RFLP marker DNA Restriction sites Disease-causing allele Normal allele Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.16 Gene therapy using a retroviral vector Cloned gene (normal allele, absent from patient’s cells) Retrovirus capsid 1 Insert RNA version of normal allele into retrovirus. Viral RNA 2 Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. 3 Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient 4 Inject engineered cells into patient. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.17 DNA fingerprints Defendant’s blood (D) Blood from defendant’s clothes 4 g D from a murder case Jeans Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings shirt Victim’s blood (V) 8 g V Figure 20.18 “Pharm” animals Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.19 Using the Ti plasmid to produce transgenic plants APPLICATION Genes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. TECHNIQUE Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts 1 The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. 2 Isolated plasmids and foreign DNA containing a gene of DNA with the gene of interest Recombinant Ti plasmid interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. 3 Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell‘s chromosomal DNA. RESULT Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Plant with new trait T DNA