Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Construction of Reporter Luciferase Genes to Assess NOC4
Document related concepts
Restriction enzyme wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Gene prediction wikipedia , lookup
Exome sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA sequencing wikipedia , lookup
Bioinformatics wikipedia , lookup
Metagenomics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Genome editing wikipedia , lookup
Designer baby wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA supercoil wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular cloning wikipedia , lookup
Expression vector wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Point mutation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcript
Construction of Reporter Luciferase Genes to Assess NOC4 expression Finding the Promoter Region of the NOC4 Gene. Nicholas Simon Faculty Sponsor: Nancy Bachman Overview Luciferase Vectors Mutagenesis Strategy Bioinformatics Mutagenesis Transformation DNA Sequencing Reporter Assays Luciferase Vectors Vectors have four features they are able to replicate they have selectable markers foreign DNA can be inserted in them they often carry a reporter gene Luciferase Vectors Mutagenesis Strategy Point Mutations or Deletions? Point mutation in a region of 250bp – need 30 primers Deletion in a region of 250bp – need only 6 primers Issues: Cost and Saturation Deletion was Best Deletions cttctctatcgataggtaccgagctcttacgcgtaggtaccgagctcttacgcgtg cggccgcgggctggcgggggacccttcaggcccggccccgtttgggcctcggct cctggaaaagcgactcgcgcctctgggaagccgcagccccagactccagtcgc gcttctcgcccggcgccgccggaaagcagcctctccaacgcctgccggaaagc agcccggcccggcattttacgacgttcgcagcgctacccttttccgctccacggtg acctccgtgcggccgggtgcgggcggagtcttcctcgatcccgtggtgctccgcg gcgcggccttgctctcttccgggggctcgagatctgcgatctaagtaagcttggc att tttctctatcgataggtaccgagctcttacgcgtaggtaccgagctcttacgcgtg cggccgcgggctggcgggggacccttcaggcccggccccgtttgggcctcggct cctggaaaagcgactcgcgcctctgggaagccgcagccccagactccagtcgc gcttctcgcccggcgccgccggaaagcagcctctccaacgcctgccggaaagc agcccggcccggcattttacgacgttcgcagcgctacccttttccgctccacggtg acctccgtgcggccgggtgcgggcggagtcttcctcgatcccgtggtgctccgcg gcgcggccttgctctcttccgggggctcgagatctgcgatctaagtaagcttggc att General Strategy Bioinformatics Used to design primers Minimize secondary structures Denature the DNA template Anneal the primers Synthesize the mutant strand DNA Sequencing Purify the Vector DNA from E. coli Cycle DNA sequencing Reporter Assays Transfect the DNA vector into HeLa cells Wait for 24 hours so cell will express the luciferase Then measure luciferase activity And What Happens If No Expression?
