Download 09_Development

Announcements
Candidate genes for behavioral ecology
Trends in Ecology and Evolution, pages 96-104 Feb. 2005
Fitzpatrick, Ben-Shahar, Smid, Vet, Robinson, Sokolowski
Additivity or dominance: the effect of one allele on
another allele at the same genetic locus.
Epistasis: the effect of one genetic locus on
another independent locus.
Pleiotropy: the effect of a single gene or two or
more phenotypic traits.
Polygenic: the effect of two or more genes on a
single phenotypic trait.
Phenotypic plasticity: the interaction between
genetic factors and the environment (e.g, norm of
reaction).
Variation in gene sequence
(polymorphisms, allelic differences)
atgtcagccgataactcattgatcgtaaattgagtttt
atgtcagccgataactgactgatggtaaattgagtttt
Variation in gene expression
(mRNA abundance)
Juvenile hormone analog (methoprene) accelerates the
onset of foraging and causes forager-like changes in
brain gene expression (in the absence of experience)
“marker” genes
Treat with
methoprene
(JH analog)
Caged bees
(no task-related
experiences)
High in
foragers
(32)
High in
nurses
(18)
Induced by
methoprene
(249)
13
0
Repressed by
methoprene
(222)
0
11
Whitfield CW et al. PNAS. 2006. Oct 31; 103(44):16068-75.
Queen mandibular pheromone (QMP) delays the onset of
foraging and causes nurse-like changes in brain gene
expression (in the absence of experience)
“marker” genes
Treat with QMP
Caged bees
(no task-related
experiences)
High in
foragers
(32)
High in
nurses
(18)
Induced by
QMP (602)
0
4
Repressed by
QMP (704)
18
2
Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS. 2003. Nov 25; 100:14519
Proximate studies: genetic variation for behavioral
variation is maintained.
Ultimate studies: why is genetic variation
maintained if selection usually acts to decrease
variation!?!
Fitness benefits of genetic variants are not
constant, but depend on environment, and the
environment is variable?
Back to rovers and sitters.
Back to rovers and sitters – why are there two
feeding strategies?
Hypothesis: Sitting is best strategy at low
densities, while roving is best in high densities.
Test: Raise random sets
of larvae in different
environments and
measure average
movement after several
generations.
Developmental flexibility
&
Developmental homeostasis
Proximate: What are they?
Ultimate: Why did they evolve?
Developmental flexibility: a change in the
development & production of a behavior
based on variation in environment.
Examples:learned behaviors, hormonal
effects on behaviors, just about everything
except behavioral differences due entirely to
genetic differences!
Kin discrimination
The capacity of an individual to react
differently to others based upon their
degree of genetic relatedness.
Kin discrimination
1) Social and aggressive behaviors:
“associate with kin and be aggressive to
nonkin”
2) Sexual behaviors: inbreeding avoidance “associate (mate) with nonkin”
Learned kin discrimination: Imprinting
Paper wasps (Polistes) imprint on odors of nest &
nestmates and are aggressive towards individuals
with non-familiar odors.
nestmates
non-nestmates
Learned kin discrimination: Phenotype
Matching
(aka the “armpit effect”)
Compare a foreign phenotype to your own phenotype.
Learned kin discrimination: Phenotype
Matching
(aka the “armpit effect”)
Compare a foreign phenotype to your own phenotype.
MHC alleles: Genes that function in immune response
and are some of the most variable (# alleles) genes
known.
Basis for odor-based phenotype matching in fish, mice
and humans.
Major Histocompatibility Complex (MHC).
MHC genes play a central role in immune recognition.
influence odors and mating preferences in vertebrates
MHC genes are among the most polymorphic loci:
1. There are a large number of alleles per locus (>100).
2. Large sequence divergence between alleles.
3. MHC allelic lineages are old (older than recent
speciation events). So, for example, any given human
MHC allele is more related to some alleles from
chimpanzees and gorillas than it is to most other
human alleles.
From W. Potts, U. Utah
Belding’s ground squirrels:
Sisters reared apart are less
aggressive towards each other
than other pairings.
Why are brother-sister pairings
so aggressive?
Golden Hamsters:
Discriminate unfamiliar kin from familiar and
unfamiliar non-kin
(work by Jill Mateo, University of Chicago)
Normal vs. cannibal forms in tiger salamanders
Individuals can develop as normal predatory
larvae or switch over to a cannibal form.
Switch to cannibalism affected by:
Population density
Size differences
Drying of water source
Genetic relatedness to others
Innate kin discrimination: Genotype
Matching
(aka the “green beard effect”)
term coined by Richard Dawkins
A gene gives individuals both a conspicuous trait
(such as a green beard) and a tendency to act
favorably to others with that same trait, mutual
altruism between individuals could evolve (in the
absence of kinship).
Dawkins “The Selfish Gene” 1976
Evidence for “green beards” in nature:
Different alleles for Gp-9 locus in fire ants
influence whether workers will adopt or kill
new queens.
Ross and Keller 1998. Selfish genes: a green beard in the red fire ant. Nature
Evidence for “green beards” in nature:
The csA gene in Dictyostelium discoideum
promotes cell adhesion only for like genotypes.
Queller_et al. 2002. Single gene green beard effects in a social amoeba. Science
Developmental homeostasis:
Development of specific behaviors
despite variation in environment
This category includes, but is not limited
to innate behaviors
Rewiring the ferret brain
Despite having completely novel sensory inputs,
the auditory cortex was able to develop into a
functioning processing center for visual signals!
Developmental homeostasis within
developmental flexibility!!
Flexibility
homeostasis
Normal
predator
homeostasis
Cannibal
Why do developmental flexibility and
homeostasis exist?
Flexibility can account for important, but
variable environmental conditions, leading to
increased fitness under different conditions.
Homeostasis reduces the chance of
devastating developmental errors due to
environmental deficits/changes
Evidence for ultimate benefits of
developmental flexibility
Anolis lizards: morphology of hind legs changes
when raised on large trunks or small branches.
Hypothesis: this flexibility leads to increased
running performance in a specific environment.
Test: compare running speed/performance of
lizards with different morphologies in both
environments
Prediction: “trunk” morphology performs better on
trunks while “branch” morphology performs better
on branches
Evidence for ultimate benefits of
developmental flexibility
Anolis lizards: morphology of hind legs changes
when raised on large trunks or small branches.
Losos et al. 2002 Evolution
Evidence for ultimate benefits of
developmental homeostasis
Wolf spiders: smaller males in poorer condition
tend to have more asymmetrical tufts on forelimbs
Hypothesis: females use tuft symmetry in mate
choice as indicator of level of homeostasis
Test: digitally manipulate tuft asymmetry on
videos of male wolf spiders courting females and
measure female receptiveness.
Prediction: females will be more receptive to
symmetrical males than asymmetrical males.
Evidence for ultimate benefits of
developmental homeostasis
Wolf spiders: smaller males in poorer condition
tend to have more asymmetrical tufts on forelimbs
Female spiders found video of control males more
stimulating than asymmetrical males.
Why measure fluctuating
asymmetry?
Uetz and Smith. 1999 Behavioral Ecology and Sociobiology
Directional asymmetry
A pattern of bilateral variation due to developmental
differences (predictable and subject to selection).
Fluctuating asymmetry
A pattern of bilateral variation where
variation on the right and left sides is
both random and independent.
It tends to be small (around 1% of trait
size or less)
Has become a popular measure of ‘quality’, ‘stress’,
‘health’ or ‘fitness’
(e.g., increased stress experienced during
development often yields increased
fluctuating asymmetry)
However, its developmental origins remain obscure
and are much debated.
Environmental quality (FA is higher in poorer quality
habitats)
Stress (stress during development increases FA)
Hybridization (FA is higher in hybrids between species)
Inbreeding (inbreeding increases FA)
Heterozygosity (FA decreases with increasing
heterozygosity)
Mate Choice (females prefer more symmetrical males)
Facial Symmetry and Attractiveness
Low
Symmetry
From Koehler et al. 2002
Normal
High
Symmetry
Perfect
Symmetry
Facial Symmetry and Attractiveness
• Evaluating original images and computergenerated composite images, participants rated
faces in terms of attractiveness, dominance,
sexiness and health.
• More symmetrical faces were given higher
ratings.
• Male faces with larger features demonstrating
male secondary sexual characteristics (large
square jaw) were preferred by females.
Randy Thornhill
From Grammer & Thornhill 1994