Download fragments

Effects of Environmental Toxicants Reach Down Through Generations
A Washington State University researcher has demonstrated that a variety of environmental toxicants can have
negative effects on not just an exposed animal but the next three generations of its offspring.
The animal's DNA sequence remains unchanged, but the compounds change the way genes turn on and off -- the
epigenetic effect studied at length by WSU molecular biologist Michael Skinner and expanded on in the current issue of
the online journal PLoS ONE.
While Skinner's earlier research has shown similar effects from a pesticide and fungicide, this is the first to show a greater
variety of toxicants -- including jet fuel, dioxin, plastics and the pesticides DEET and permethrin -- promoting epigenetic
disease across generations.
"We didn't expect them all to have transgenerational effects, but all of them did," Skinner said. "I thought hydrocarbon
would be negative but it was positive too."
This tells researchers that the ability to promote transgenerational disease is "not simply a unique aspect for a unique
compound" but a characteristic of many environmental compounds.
Researchers tested a pesticide mixture (permethrin and insect repellant DEET), a plastic mixture (bisphenol A and
phthalates), dioxin (TCDD) and a hydrocarbon mixture (jet fuel, JP8).
The field opens new ground in the study of how diseases develop. While toxicologists generally focus on animals exposed
to a compound, Skinner's work further demonstrates that diseases can also stem from older, ancestral exposures that are
then mediated through epigenetic changes in sperm.
The work also points the way to identify and diagnose exposures through the use of specific epigenetic molecular
markers.
"In the future we might be able to use these epigenetic biomarkers to determine your ancestral and personal exposure
early in life and to predict your susceptibility to get a disease later in life," Skinner said.
The study was funded by the U.S. Army to study pollutants that troops might be exposed to. Skinner and his colleagues
exposed pregnant female rats to relatively high but non-lethal amounts of the compounds and tracked changes in three
generations of offspring.
The researchers saw females reaching puberty earlier, increased rates in the decay and death of sperm cells and
lower numbers of ovarian follicles that later become eggs. Future studies can use the molecular tools for risk
assessment analysis.
© Cengage Learning 2015
Biology
Concepts and Applications | 9e
Starr | Evers | Starr
Chapter 14
Human Inheritance
© Cengage Learning 2015
© Cengage Learning 2015
14.1 How Do We Study Inheritance Patterns
In Humans?
• Pea plants and fruit flies are perfect for
genetic studies because:
– They have few chromosomes
– They reproduce quickly
– They can survive in lab conditions
– There are few ethical problems with their use
© Cengage Learning 2015
How Do We Study Inheritance Patterns In
Humans?
• Humans involve more issues
– Geneticists often use historical records
– Make charts (pedigrees of genetic
connections)
• Allows geneticists to determine the probability that
a trait will recur in future generations
© Cengage Learning 2015
How Do We Study Inheritance Patterns In
Humans?
• Types of genetic mutations
– Single genes that follow Mendelian
inheritance patterns govern more than 6,000
genetic abnormalities and disorders
– Most human traits are polygenic, or influenced
by multiple genes
– Traits can be influenced by environmental
factors
– Alleles that give rise to severe genetic
disorders are rare
© Cengage Learning 2015
How Do We Study Inheritance Patterns In
Humans?
• Six main patterns of inheritance for genetic
abnormalities and disorders:
– Autosomal dominant inheritance pattern
– Autosomal recessive inheritance pattern
– X-linked recessive inheritance pattern
– X-linked dominant inheritance pattern
– Changes in chromosome number
– Changes in chromosome structure
© Cengage Learning 2015
How Do We Study Inheritance
Patterns In Humans?
© Cengage Learning 2015
How Do We Study Inheritance Patterns In
Humans?
A
B
© Cengage Learning 2015
How Do We Know When A Trait Is Affected
By An Allele On An Autosome?
normal
mother
affected
father
meiosis
and gamete
formation
affected child
© Cengage Learning 2015
normal child
disordercausing
How Do We Know When A Trait Is Affected
By An Allele On An Autosome?
carrier
mother
carrier
father
affected child
carrier child
normal child
meiosis
and gamete
formation
© Cengage Learning 2015
disordercausing
allele (recessive)
How Do We Know When A Trait Is Affected
By An Allele On An X Chromosome?
• X-linked recessive pattern
– X-linked recessive disorders tend to appear in
men more often than in women
• Men (XY) have only one X chromosome
• Women have two X chromosomes (XX), so they
can be heterozygous for a recessive allele
– Men can transmit an X-linked allele to
daughters, but not to sons – only a woman
can pass an X-linked allele to a son
© Cengage Learning 2015
How Do We Know When A Trait Is Affected By An
Allele On An X Chromosome?
dystrophin
(muscular dystrophy)
(anhidrotic ectodermal
dysplasia)
IL2RG (SCID-X1)
XIST X chromosome
inactivation control
(hemophilia B)
(hemophilia A)
© Cengage Learning 2015
X
(red-deficient color blind)
(green-deficient color blind)
How Do We Know When A Trait Is Affected
By An Allele On An X Chromosome?
carrier
mother
carrier
father
meiosis
and gamete
formation
© Cengage Learning 2015
normal daughter or son
carrier daughter
affected son
recessive allele
on X chromosome)
How Do We Know When A Trait Is Affected
By An Allele On An X Chromosome?
You may have one form of red–
green color blindness if you see
a 7 in this circle instead of a 29.
You may have another form of red–
green color blindness if you see a
3 instead of an 8 in this circle.
© Cengage Learning 2015
How Do We Know When A Trait Is Affected
By An Allele On An X Chromosome?
• Hemophilia A
– X-linked recessive disorder
– Interferes with blood clotting
– Involves factor VIII
– In the 19th century, it was relatively common
in royal families of Europe and Russia
© Cengage Learning 2015
How Do We Know When A Trait Is Affected
By An Allele On An X Chromosome?
© Cengage Learning 2015
14.4 How Does Chromosome Structure
Change?
• Mutations are small-scale changes in DNA
sequence
• Chromosome mutations
– Include duplications, deletions, inversions,
and translocations
– Have been evolutionarily important
– Tend to result in genetic disorders
© Cengage Learning 2015
How Does Chromosome Structure Change?
• Chromosome changes in evolution
– Most major alterations are harmful or lethal in
humans
– Many major structural changes have
accumulated in chromosomes of all species
over evolutionary time
– Speciation occurs by large-scale changes in
chromosomes
© Cengage Learning 2015
What Are The Effects of Chromosome
Number Changes in Humans?
– Trisomy 21 (Down syndrome)
• A normal gamete (n) fuses with an n+1 gamete
• New individual is trisomic (2n+1), having three of
one type of chromosome and two of every other
type
• Effects: Mild to moderate mental impairment;
health problems such as heart disease; flattened
facial profile; fold of skin on inner corner of eye;
low muscle tone
• Occurs 1/700 births
• Risk increases with maternal age
© Cengage Learning 2015
What Are The Effects of Chromosome
Number Changes in Humans?
Disorder
Main Symptoms
Down syndrome
Turner syndrome (XO)
Mental impairment; heart defects
Sterility; abnormal ovaries and
sexual traits
Sterility; mild mental impairment
Minimal abnormalities
Mild mental impairment or no effect
Klinefelter syndrome XXY
XXX syndrome
XYY condition
© Cengage Learning 2015
14.6 How Do We Use What We Know About
Human Inheritance?
• Genetic screening
– Can estimate probability that a child will
inherit a genetic disorder
– Pedigrees and genotype are analyzed by a
genetic counselor
– Some disorders can be detected early enough
to start countermeasures before symptoms
develop
– More than 30 conditions detectable prenatally
© Cengage Learning 2015
How Do We Use What We Know About
Human Inheritance?
• Newborn screening for phenylketonuria
(PKU)
– Newborns screened for mutations in the gene
phenylalanine hydroxylase, a defect that can
cause phenylalanine to accumulate to high
levels
– Results in imbalance that inhibits protein
synthesis in the brain
– Causes severe neurological symptoms
characteristic of (PKU)
© Cengage Learning 2015
How Do We Use What We Know About
Human Inheritance?
• Prenatal diagnosis
– Testing of an embryo or fetus can reveal
genetic abnormalities or disorders before birth
• Obstetric sonography
• Fetoscopy
• Amniocentesis
• Chorionic villus sampling (CVS)
– Invasive procedure that can carry a risk to the
fetus
© Cengage Learning 2015
Biology
Concepts and Applications | 9e
Starr | Evers | Starr
Chapter 15
Biotechnology
© Cengage Learning 2015
© Cengage Learning 2015
What is DNA Cloning?
• Restriction enzymes
– Cuts DNA wherever a specific nucleotide
sequence occurs
– Allows researchers to cut DNA into
manageable chunks
– Allows for combining DNA fragments from
other organisms
– Leave single-stranded tails
– Complementary tails will base-pair together
© Cengage Learning 2015
Restriction Enzyme
• Cuts DNA at specific sites—depending on
enzyme.
•
•
•
•
•
EcoR1 cuts DNA
PovII cuts DNA
SmaI cuts DNA
StuI cuts DNA
Alul cuts DNA
© Cengage Learning 2015
GAATTC
CAGCTG
CCCGGG
AGGCCT
AGCT
ATCGTCGAACTGGGATCCGGTAAAG
CTTTAAGGCCTTACGTTCCGGGAAG
GTTCCGGATTAAGGCCTTAAGGTTT
CCGATCGATCGATTCGATCCGGATAT
CGGTAATTCGAATTCGTGTCATCGTT
ACGCTTGCCGGAATTTCCGTATCGC
CGGTTAATCTGAGACTACGGAGCAT
CGTAGTC
© Cengage Learning 2015
Use Enzyme Fournier1 which cuts
CCGG
ATCGTCGAACTGGGATCCGGTAAAGCTTTA
AGGCCTTACGTTCCGGGAAGGTTCCGGA
TTAAGGCCTTAAGGTTTCCGATCGATCGA
TTCGATCCGGATATCGGTAATTCGAATTC
GTGTCATCGTTACGCTTGCCGGAATTTCC
GTATCGCCGGTTAATCTGAGACTACGGA
GCATCGTAGTC
Segments are 18, 26, 11, 40, 41, 17 and 31.
So, in order, you get banding at:
11, 17, 18, 26, 31, 40, 41
© Cengage Learning 2015
What is DNA Cloning?
• DNA cloning mass produces specific DNA
fragments
– Fragments to be copied are inserted into
plasmids or other cloning vectors and inserted
into host cells such as bacteria
• Host cells divide and make identical
copies (clones) of the foreign DNA
• A huge population of clones can be grown
© Cengage Learning 2015
What is DNA Cloning?
chromosomal DNA
plasmid
cloning
vector
A
© Cengage Learning 2015
B
fragments of
Chromosomal DNA
cut
plasmid
recombinant
plasmid
C
© Cengage Learning 2015
15.2 How Do Researchers Study One Gene
In The Context of Many?
• Genome
– The entire set of genetic material of an
organism
– Consists of thousands of genes
© Cengage Learning 2015
DNA Sequencing
• Gel Electrophoresis
– Separates fragments by length into bands
– Electric field pulls DNA fragments through
semisolid gel
– Fragments of different sizes move at different
rates
– Shorter fragments slip through the tangled
molecules of the gel faster than longer
fragments
© Cengage Learning 2015
Mixture of DNA
fragments of
different sizes
Band of
longest
(slowest)
fragments
Power
source
Gel
Completed gel
© Cengage Learning 2015
Figure 12.17-3
Band of
shortest
(fastest)
fragments
© Cengage Learning 2015
© Cengage Learning 2015
© Cengage Learning 2015
DNA Sequencing
• The Human Genome Project
– Human genome consists of about three billion
nucleotide bases
– Celera Genomics invented faster methods of
sequencing genomic DNA
– Human genome sequence completed in 2003,
but could not be patented
– 50 years after discovery of DNA structure,
human genome was complete
© Cengage Learning 2015
How Do We Use What Researchers Discover
About Genomes?
• DNA profiling
– Identifies a person by their DNA
• 99% of DNA is same among all humans
• A base pair variation >1% of population is called a
single-nucleotide polymorphism (SNP)
– Examples include determining an individual’s
array of SNPs on microscopic arrays
© Cengage Learning 2015
Selective
Breeding
© Cengage Learning 2015
15.5 What is Genetic Engineering?
• Genetic engineering
– Process by which an individual’s genome is
deliberately modified
– Produces a genetically modified organism
(GMO)
• A gene may be altered and reinserted into an
individual of the same species
• A gene from one species may be transferred to
another to produce an organism that is transgenic
• Most common GMOs are bacteria
© Cengage Learning 2015
What is Genetic Engineering?
A
B
© Cengage Learning 2015
C
What is Genetic Engineering?
• Engineered microorganisms
– GM bacteria:
• Produce medically important proteins such as
insulin
• Produce enzymes used in food manufacturing,
such as chymotrypsin
• Are used to improve taste of beer and fruit juice
and slow bread from staling
© Cengage Learning 2015
What is Genetic Engineering?
• Genetically modified animals
– Mice: used for medical research
– Goats: have proteins that treat cystic fibrosis,
heart attacks, nerve gas exposure, etc.
– Rabbits: make interleukin-2
– Pigs: modified for heart-healthy fat and lower
phosphate feces
– Trout and salmon: bigger versions
– Farm animals: produce more meat or milk
© Cengage Learning 2015
What is Genetic Engineering?
• Designer plants
– Genetically engineered crop plants are
widespread in the U.S.
– Genes introduced by a tumor-inducing (Ti)
plasmid from bacteria
• Transfers foreign or modified genes into food crop
plants such as soybeans, squash, and potatoes
– May be resistant to diseases, offer improved
yields, or make a protein (Bt) that is toxic to
some insect larvae
© Cengage Learning 2015
A resistant gene from Bacteria
was used.
In 1996, genetically modified
soybeans were made
commercially available. Current
glyphosate-resistant crops
include soy, corn, sorghum,
canola, alfalfa, and cotton, with
wheat still under development.
Genetically modified crops have
become the norm in the United
States. For example, in 2010,
70% of all the corn that was
planted was herbicide-resistant;
78% of cotton, and 93% of all
soybeans.
© Cengage Learning 2015
What is Genetic Engineering?
• GMO crops
– Engineered for drought tolerance and nutrition
• Example: rice plants engineered to make βcarotene, a precursor of vitamin A, in their seeds
– Most widely planted GMO crops include:
• Corn, sorghum, cotton, soy, canola, and alfalfa
© Cengage Learning 2015
What is Genetic Engineering?
© Cengage Learning 2015
What is Genetic Engineering?
• Concerns with GMOs
– Transgenes can (and do) escape into the
environment
– Many people are opposed to any GMO crops
or “Frankenfoods”
– Controversy raised by GMO use invites you to
read the research and form your own opinions
© Cengage Learning 2015
15.6 Can We Genetically Modify People?
• Gene therapy
– Gene is transferred into body cells to correct a
genetic defect or treat a disease
– Tested as a treatment for heart attack, sicklecell anemia, cystic fibrosis, hemophilia A,
Parkinson’s and Alzheimer’s diseases,
several cancers, and inherited diseases
• Weigh potential benefits of genetically
modifying humans against potential risks
© Cengage Learning 2015
Can We Genetically Modify People?
• Gene therapy
– SCID-X1
• A severe X-linked disorder of the IL2RG gene,
which codes for an immune-system receptor
protein
• Affected children can’t fight infections, and only
survive in germ-free isolation tents
© Cengage Learning 2015
Can We Genetically Modify People?
• Gene therapy and SCID-X1
– In the 1990s, 20 boys with SCID-X1 were
treated with gene therapy
• Researchers used a genetically engineered virus
to insert unmutated copies of IL2RG into cells
taken from their bone marrow
– 18 were cured; five treated with gene therapy
for SCID-X1 developed leukemia, and one
died
– Is this OK? Acceptable?
© Cengage Learning 2015
Can We Genetically Modify People?
• Eugenics
– Idea of deliberately improving the genetic
qualities of the human race
– Uses methods to select the most desirable
human traits
– Raises ethical issues
• Engineer cuter babies, or “superhumans”?
• Prevent of obesity, aggressiveness, or
homosexuality?
© Cengage Learning 2015
15.7 Personal Genetic Testing
© Cengage Learning 2015
Personal Genetic Testing
• Do you want to know your SNP profile?
– Companies can extract DNA from saliva and
analyze it using a SNP-chip
– Results indicate estimated risks of developing
certain diseases
– Personalized genetic testing is revolutionizing
medicine
• Can cause people to make beneficial lifestyle
changes
© Cengage Learning 2015