* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Lesson 15a Components of DNA #1 PPT
Silencer (genetics) wikipedia , lookup
Epitranscriptome wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Gene expression wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Community fingerprinting wikipedia , lookup
List of types of proteins wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular evolution wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Expanded genetic code wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Point mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Biochemistry wikipedia , lookup
DNA DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell. DNA stands for deoxyribose nucleic acid     This chemical substance is present in the nucleus of all cells in all living organisms. DNA controls all the chemical changes which take place in cells. The kind of cell which is formed, (muscle, blood, nerve etc) is controlled by DNA. The kind of organism which is produced (buttercup, giraffe, herring, human etc) is controlled by DNA Composition of DNA DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides.  Each nucleotide is made up of a sugar called deoxyribose a phosphate group -PO4 and a nitrogen base. Components and structure of DNA •A very long molecule. 4 nitrogenous bases: The most common organic bases are Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Chargaff’s rules    The relative amounts of adenine and thymine are the same in DNA The relative amounts of cytosine and guanine are the same. Named after Erwin Chargaff Discovery of DNA Structure   Erwin Chargaff showed the amounts of the four bases on DNA ( A,T,C,G) In a body or somatic cell: A = 30.3% T = 30.3% G = 19.5% C = 19.9% 9 The bases always pair up in the same way Adenine forms a bond with Thymine Adenine Thymine and Cytosine bonds with Guanine Cytosine Guanine PO4 PO4 adenine thymine PO4 PO4 cytosine guanine PO4 PO4 PO4 PO4 Two Kinds of Bases in DNA Pyrimidines aresingle ring bases.  Purines are double C ring bases. N  N C C C N N C N C Thymine and Cytosine are pyrimidines  Thymine and cytosine each have one ring of carbon and nitrogen atoms. N N O C C O C C N C thymine N O C C C N C cytosine Adenine and Guanine are purines  Adenine and guanine each have two rings of carbon and nitrogen atoms. N C Adenine N C C N O N C N N C N C C C N Guanine C N N C The deoxyribose, the phosphate and one of the bases Combine to form a nucleotide PO4 adenine deoxyribose Joined nucleotides A molecule of DNA is formed by millions of nucleotides joined together in a long chain. PO4 PO4 In fact, the DNA usually consists of a double strand of nucleotides. The sugar-phosphate chains are on the outside and the strands are held together by chemical bonds between the bases. PO4 PO4 sugar-phosphate backbone + bases Rosalind Franklin  Used X-Ray diffraction to get information about the structure of DNA: Structure of DNA       Discovered in 1953 by two scientists: James Watson (USA) Francis Crick (GB) Known as the double-helix model. THE DOUBLE HELIX bases sugar-phosphate chain 2-stranded DNA PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 The double-helix  A twisted ladder with two long chains of alternating phosphates and sugars. The nitrogenous bases act as the “rungs” joining the two strands connected by H bonds. How long is the DNA molecule? Chromosomes & DNA replication    The nucleus of one human cell contains approximately 1 meter of DNA. Histones = DNA tightly wrapped around a protein Nucleosome: DNA replication Must occur before a cell divides. Each new cell needs a copy of the information in order to grow. Before a cell divides, the DNA strands unwind and separate. Each strand makes a new partner by adding the appropriate nucleotides. The result is that there are now two double-stranded DNA molecules in the nucleus. So that when the cell divides, each nucleus contains identical DNA. This process is called replication. PO4 PO4 PO4 The strands separate PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 Each strand builds up its partner by adding the appropriate nucleotides PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO4 PO PO4 TRANSCRIPTION  DNA is copied into mRNA with the aid of RNA polymerase. Copies genetic code of DNA by matching bases. Occurs in the nucleus. DNA changing to mRNA RNA Very similar to DNA.  Exceptions: 1. Uracil replaces thymine 2. Single-stranded 3. Ribose is the 5-carbon sugar  tRNA (transfer)      approx. 80 nucleotides in length. Cross-like shape At one end an amino acid is attached At the other end there is an anticodon Acts like a truck Polypeptide assembly    Translation = reading or “translating” the RNA code to form a chain of amino acids. Known as protein synthesis Occurs in the cytoplasm. tRNA mRNA Amino acid 3 Types of RNA Types of RNA Where are they produced Function mRNA nucleus Carries the information in codons that determine the order of amino acids tRNA Other genes in the nuclear DNA code for tRNA molecules. Carries the anticodon and picks up the amino acid to bring to the rRNA rRNA Other genes in the nucleus produces the rRNA .rRNA molecules combine with protein to form the ribosomes, which serve as the base for interactions between mRNA codons and tRNA anticodons in translation in the cytoplasm Structure The sequence of bases in DNA forms the Genetic Code A group of three bases (a triplet) controls the production of a particular amino acid in the cytoplasm of the cell The different amino acids and the order in which they are joined up determines the sort of protein being produced Codons  A three letter “word” that specifies an amino acid. This is a small, imaginary protein molecule showing how a sequence of 5 different amino acids could determine the shape and identity of the molecule. Ser-Cyst-Val-Gly-Ser-Cyst Ala Val Val-Cyst-Ser-Ala-Ser-Cyst-Gly Val- Cyst-Ala-Ala-Ser-Gly Each amino acid (Serine, Cysteine, Valine, Glycine and Alanine) is coded for by a particular triplet of bases. For example Cytosine Adenine Codes for Valine Codes for Alanine Thymine Cytosine (C) Guanine (G) Adenine (A) This is known as the triplet code Each triplet codes for a specific amino acid CGA - CAA - CCA - CCA - GCT - GGG - GAG - CCA Ala Val Gly Gly Arg Pro Leu Gly The amino acids are joined together in the correct sequence to make part of a protein Ala Val Gly Gly Arg Pro Leu Gly The proteins build the cell structures. They also make enzymes. The DNA controls which enzymes are made and the enzymes determine what reactions take place. The structures and reactions in the cell determine what sort of a cell it is and what its function is. So DNA exerts its control through the enzymes. A sequence of triplets in the DNA molecule may code for a complete protein Such a sequence forms a gene There may be a thousand or more bases in one gene. Reading the genetic code    The genetic code is responsible for building all the proteins in the body using 20 different amino acids. How many 3 letter words can you make from the letters A,T,G and C? Answer: 64 Question 1 Which of the following are components of nucleotides? (a) deoxyribose (b) amino acids (c) phosphate (d) enzymes (e) organic bases Question 2 Which of the following represent a correct pairing of bases? (a) adenine with thymine (b) adenine with guanine (c) thymine with adenine (d) guanine with cytosine (e) thymine with thymine Question 3 DNA molecules are formed from (a) organic bases (b) amino acids (c) deoxyribose (d) nucleotides Question 4 Which of the following are organic bases? (a) Valine (b) Guanine (c) Thymine (d) Serine Question 5 Replication of DNA occurs (a) During cell division (b) before cell division (c) at any time Question 6 A nucleotide triplet codes for (a) a protein (b) an amino acid (c) an enzyme (d) an organic base Question 7        Transcribe this DNA sequence into RNA, then translate the RNA into an amino acid chain using the genetic code circle on the next slide. TAGCCGACAGGCCTCTTTACT An example of a DNA sequence might be CCC TGT GGA GCC ACA CCC TAG translate into mRNA GGG ACA CCU CGG UGU GGG AUC You can decode triplet by triplet. Start from the inside of the wheel: find the first letter of your codon in the centre of the wheel and work outwards, through the second ring (with the next letter) and so on, to find the corresponding amino acid. This would make the amino acid chain: P - C - G - A - T - STOP Proline-Cysteine-Glycine-Alanine-Threonine-STOP Genetic code: Answers         1. A,C,E 2. A,C,D 3. D 4. B,C 5. B 6. B 7. AUC, GGC, UGU, CCG, GAG, AAA,UGA MET, GLY, CYS, PRO, GLU, LYS, STOP
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            