* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The Biotechnology Age: Issues and Impacts
Protein (nutrient) wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Magnesium transporter wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Gene expression wikipedia , lookup
Genome evolution wikipedia , lookup
Western blot wikipedia , lookup
Gene expression profiling wikipedia , lookup
Protein moonlighting wikipedia , lookup
Interactome wikipedia , lookup
Point mutation wikipedia , lookup
Protein adsorption wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Gene regulatory network wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Two-hybrid screening wikipedia , lookup
List of types of proteins wikipedia , lookup
ABE: Advances in Bioscience Education Bringing together students and faculty to explore research in the molecular and cellular biosciences. Dr. Kabi Neupane, Coordinator (co-PI, LCC) Faculty Partners John Berestecky (KCC) Ingelia White (WCC) Priscilla Millen (LCC) Janice Ito (LCC) Catherine Unabia (HPU) David Christopher (PI, UH, Manoa) Summer 06 Stepping into scientific research From the classroom to the lab bench with intensity. What are our goals? What kind of research are we doing ? What is an Arabidopsis plant? Research philosophy. Goals • Reach for new learning and knowledge. • To learn and grow - actively, by doing….to change. • Move out of the comfort zone and into the stretch zone. • Take risk, try something new, unfamiliar and break thru the fear barrier. Research = Stretch Zone Willing to sail into unchartered waters To discover… make mistakes… …change direction. Have FAITH that you can learn from mistakes as you move along. Scientific Research: Learn by Trial and error. Embrace mistakes Persistance is more important than strength Scientific Research: Discover new knowledge. Use tools of molecular and cellular biology to figure out the underlying biochemical processes that control how living cells work. RESEARCH QUESTIONS: Plant growth… How do leaves, roots, stems, flowers develop from common precursor cells? How can native and crop plants safely resist pests and diseases that kill them ? How can plants be protected from environmental stress: drought, flood, salt, heat, UV, pollution ? “Arabidopsis thaliana: Research on a lawn mower to understand a corvette” Research Philosophy to gain insight into complex systems Learn the inner workings of something complicated, then start by studying the simpler version. $ 65,0000 $ 2,000 Model System - essence of an automobile Complex fascinating plants adapt to diverse environments Arabidopsis thaliana Plants simple Complex Economy of Size Cornfield Arabidopsis “field” in 4 inch petri plate Economy of Time Corn 100 - 140 days to seed Arabidopsis 30-40 days to seed Economy of Genes, Genome and DNA Arabidopsis has smallest genome, vascular plants Corn 48,000 genes Arabidopsis 29,000 genes 10 chromosomes 5 chromosomes ~ 5 billion nucleotides 125 million nucleotides Much junk spacer DNA small spacer DNA A G T C Arabidopsis = encapsulates the essence of all plants in a small package First fully sequenced genome of any plant All genes mapped and isolated Catalogue of genes can be ordered via mail Knockouts of genes MUTATE THEM Study the activity of 1000’s of genes simultaneously Easy to genetically engineer All of the genes in Arabidopsis have been found in other plants . Used as a starting point to identify genes in other plants Arabidopsis has facilitated the genetics of all plants Answer the question: What do the genes do? Amazing fact ! 60% genes in plants have counterparts in human DNA Genes for …Basic cellular processes Energy production, ATP Cell division Enzymes Protein biosynthesis From DNA sequence (chemical) to Life GGTTCCAAAAGTTTATTGGATGCCG TTTCAGTACATTTATCGTTTGCTTT GGATGCCCTAATTAAAAGTGACCCT TTCAAACTGAAATTCATGATACACC AATGGATATCCTTAGTCGATAAAAT TTGCGAGTACTTTCAAAGCCAAATG AAATTATCTATGGTAGACAAAACAT TGACCAATTTCATATCGATCCTCCT GAATTTATTGGCGTTAGACACAGTT GGTATATTTCAAGTGACAAGGACAA TTACTTGGACCGTAATAGATTTTTT GAGGCTCAGCAAAAAAGAAAATGGA AATACGAGATTAATAATGTCATTAA TAAATCAATTAATTTTGAAGTGCCA TTGTTTTAGTGTTATTGATACGCTA ATGCTTATAAAAGAAGCATGGAGTT ACAACCTGACAATTGGCTGTACTTC CAATGAGCTAGTACAAGACCAATTA TCACTGTTTGATGTTATGTCAAGTG AACTAATGAACCATAAACTTGGTCA Tools of molecular and cellular biology - Recombinant DNA technology - Biochemistry - Microscopy - Molecular genetics - Computers Use these tools from an actual research project National Sciences Foundation (NSF) funds ABE: “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks” • Complicated name: What does it mean? “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks” Functional Genomics: • New field of biological science • Rooted in Genetics • Genome: all of the genes encoded in DNA in a living organism. • Function: Research to figure out what the genes are doing. • What proteins do they encode and what jobs in the cell are they responsible for? What jobs do proteins do in a cell? • 1. Structure: hold things up • 2. Enzymes: activity make and burn energy. Stimulate growth and biomass production. • 1000’s different enzymes -> unique activities • Figure out their activities. ENZ A -----------> B • Where the enzyme is located in the cell? • Do they need other protein partners to do their job? “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks” Making of a protein: Converting the code in a polymer of nucleic acid to a polymer of amino acid DNA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Transcribed RNA PROTEIN Translated ENZYME: Protein Disulfide Isomerase = PDI • Chain of amino acids representing a PDI. • Disulfide: “Two sulfurs” The amino acid containing sulfur is cysteine Bond with 2 cysteines | SH | SH | SH ENZYME: Protein Disulfide Isomerase • Isomer: Different molecules with same chemical formula. • Alter chemical bonding --> different “shapes” --> activities and functions. •Isomerase: an enzyme that can make different molecular shapes out of the same substance. •Disulfide Isomerase: emzyme that alters molecular shape by acting on the disulfide bonds. PDI can make different protein shapes based on altered disulfide bonding | SH | SH 2 isomers with new activity ! OR -S S- | SH | SH -S-S- | SH “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks Proteins do not do their job unless they are folded correctly • So, PDIs fold other proteins correctly in cells. • A major responsibility for keeping cells normal, development, metabolism and growth. Protein Disulfide Isomerase (PDI) Gene Family • Study all the PDIs in the genome of a small plant. •All the PDIs in the same related family. • but they go off and have different jobs at various locations in the cell. PDI Protein folding- oxidoreductase PDI = cys Inactive state Active state All proteins have to fold to proper states Chemical Mechanism REDOX • Oxidation Remove 2 electrons and 2 H+ 2 cysteine sulfhydryls --> make disulfide bridge • Reduction --> breaks bridge --> – Add 2 electrons and 2 H+ to the 2 sulfhydryls In Yeast and humans - PDIs located in the endoplasmic reticulum (ER) • But what about plants???? Arabidopsis thaliana Plants Primary structure of a generic PDI ER retention motif C--C C--C Signal sequence Thioredoxin domains Directs a protein to a specific location Contains 2 cysteines and active catalytic site for oxidation-reduction and folding of proteins KDEL Research activities of workshop Learn some recombinant DNA methods Map genes that have been tagged by a T-DNA Learn PCR and RT-PCR Isolate proteins from leaves and detect proteins using antibodies Use a microscope to find where PDIs and green fluorescent protein are located in the cell. What kind of results might you expect? Any kind of result is a success Learn by doing !!! Have fun while you learn ! Nothing has to work perfectly to be a valuable learning experience.