* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download The Biotechnology Age: Issues and Impacts
Endomembrane system wikipedia , lookup
G protein–coupled receptor wikipedia , lookup
Magnesium transporter wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Signal transduction wikipedia , lookup
Protein phosphorylation wikipedia , lookup
Protein structure prediction wikipedia , lookup
Protein folding wikipedia , lookup
Protein moonlighting wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Chemical biology wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Western blot wikipedia , lookup
ABE: Advances in Bioscience Education A workshop bringing together students and faculty to explore research in the molecular and cellular biosciences. Dr. Kabi Neupane, Coordinator (co-PI, LCC) Faculty Partners John Berestecky (KCC) Ingelia White (WCC) Janice Ito (LCC) Priscilla Millen (LCC) Catherine Unabia (HPU) David Christopher (PI, UH, Manoa) Stepping into scientific research From the classroom to the lab bench with intensity. What are our goals? What kind of research are we doing ? What is an Arabidopsis plant? What kind of results might you expect? Research philosophy. Goals • Reach for new learning and knowledge. • To learn and grow - actively, by doing. • Move out of the comfort zone and into the stretch zone. • Take risk, try something new, unfamiliar and break thru the fear barrier. Research = Stretch Zone: Willing to sail into unchartered waters To discover… make mistakes… …change direction. Have FAITH that you can learn from mistakes as you move along. Scientific Research: Learn by Trial and error. Embrace mistakes Persistance is more important than strength Scientific Research: Discover new knowledge. Use tools of molecular and cellular biology to figure out the underlying biochemical processes that control how living cells work. From DNA of genes to LIFE ! From DNA sequence (chemical) to Life GGTTCCAAAAGTTTATTGGATGCCG TTTCAGTACATTTATCGTTTGCTTT GGATGCCCTAATTAAAAGTGACCCT TTCAAACTGAAATTCATGATACACC AATGGATATCCTTAGTCGATAAAAT TTGCGAGTACTTTCAAAGCCAAATG AAATTATCTATGGTAGACAAAACAT TGACCAATTTCATATCGATCCTCCT GAATTTATTGGCGTTAGACACAGTT GGTATATTTCAAGTGACAAGGACAA TTACTTGGACCGTAATAGATTTTTT GAGGCTCAGCAAAAAAGAAAATGGA AATACGAGATTAATAATGTCATTAA TAAATCAATTAATTTTGAAGTGCCA TTGTTTTAGTGTTATTGATACGCTA ATGCTTATAAAAGAAGCATGGAGTT ACAACCTGACAATTGGCTGTACTTC CAATGAGCTAGTACAAGACCAATTA TCACTGTTTGATGTTATGTCAAGTG AACTAATGAACCATAAACTTGGTCA Tools of molecular and cellular biology - Recombinant DNA technology - Biochemistry - Microscopy - Molecular genetics - Computers Use these tools from an actual research project National Sciences Foundation (NSF) funds ABE: “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks” • Complicated name: What does it mean? “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks” Functional Genomics: • New field of biological science • Rooted in Genetics • Genome: all of the genes encoded in DNA in a living organism. • Function: Research to figure out what the genes are doing. • What proteins do they encode and what jobs in the cell are they responsible for? What jobs do proteins do in a cell? • 1. Structure: hold things up • 2. Enzymes: activity make and burn energy. Stimulate growth and biomass production. • 1000’s different enzymes -> unique activities • Figure out their activities. ENZ A -----------> B • Where the enzyme is located in the cell? • Do they need other protein partners to do their job? “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks” Making of a protein: Converting the code in a polymer of nucleic acid to a polymer of amino acid DNA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Transcribed RNA PROTEIN Translated ENZYME: Protein Disulfide Isomerase = PDI • Chain of amino acids representing a PDI. • Disulfide: “Two sulfurs” The amino acid containing sulfur is cysteine Bond with 2 cysteines | SH | SH | SH ENZYME: Protein Disulfide Isomerase • Isomer: Different molecules with same chemical formula. • Alter chemical bonding --> different “shapes” --> activities and functions. •Isomerase: an enzyme that can make different molecular shapes out of the same substance. •Disulfide Isomerase: emzyme that alters molecular shape by acting on the disulfide bonds. PDI can make different protein shapes based on altered disulfide bonding | SH | SH 2 isomers with new activity ! OR -S S- | SH | SH -S-S- | SH “Functional Genomics of Protein Disulfide Isomerase Gene Family: Unraveling Protein Folding and Redox Regulatory Networks Proteins do not do their job unless they are folded correctly • So, PDIs fold other proteins correctly in cells. • A major responsibility for keeping cells normal, development, metabolism and growth. Protein Disulfide Isomerase (PDI) Gene Family • Study all the PDIs in the genome of a small plant. •All the PDIs in the same related family. • but they go off and have different jobs at various locations in the cell. PDI Protein folding- oxidoreductase PDI = cys Inactive state Active state All proteins have to fold to proper states Chemical Mechanism REDOX • Oxidation Remove 2 electrons and 2 H+ 2 cysteine sulfhydryls --> make disulfide bridge • Reduction --> breaks bridge --> – Add 2 electrons and 2 H+ to the 2 sulfhydryls In Yeast and humans - PDIs located in the endoplasmic reticulum (ER) • But what about plants???? Arabidopsis thaliana Plants Arabidopsis • First plant to have its genome completely sequenced – Smallest Plant Genome known -> 26,000 genes but makes a plant!! – 40 days from seed to seed. – Easily genetically engineered. – Easy to knock out genes to see what they do. Primary structure of a generic PDI ER retention motif C--C C--C Signal sequence Thioredoxin domains Directs a protein to a specific location Contains 2 cysteines and active catalytic site for oxidation-reduction and folding of proteins KDEL Research activities of workshop Learn some recombinant DNA methods Map genes that have been tagged by a T-DNA Learn PCR and RT-PCR Isolate proteins from leaves and detect proteins using antibodies Use a microscope to find where PDIs and green fluorescent protein are located in the cell. What kind of results might you expect? Any kind of result is a success Learn by doing !!! Have fun while you learn ! Nothing has to work perfectly to be a valuable learning experience. T-DNA Mapping M W.T 1-a 1-b 3-Ⅰ 3-Ⅱ 3-Ⅲ 4-Ⅰ 4-Ⅱ 4-Ⅲ Fluorescence microscopy uses high energy blue - UV light to excite the sample, which emits light at a lower energy Chlorophyll fluoresces red Green fluorescent chemical attached to an antibody that binds to a chloroplast PDI My first attempts at preserving tissue for transmission electron microscopy Sabbatical at University of Colorado 2005-2006 High pressure freezing: Plant tissue is flash frozen in a pressure bomb -197 C Water in the tissue is replaced with acetone over 5 day period Acetone saturated tissue is embedded in resin Resin is cut in thin sections, 80 nm thick Add antibody immunolabeling Electron microscope Very Wrinkled Chloroplast Carnage Pretty bad fixation 2nd time: procedures were done poorly, but there is hope… Back to the drawing board to start over. But what to correct? What to do different? Will it improve? When things do not work right, keep moving forward and ignore doubt, pressure and negativism. 3rd time A charm Excellent preservation And Immunolabeling the 3rd TIME HIGH MAG RE-search Not search Must be repeated Research time is spent: 70% trouble-shooting 15% success 15% communicating success. ROOT HOOK-o-PLASM PDI in Vacuole CNGC in Golgi Apparatus g 200 nm PDI in Golgi Apparatus c G 200 nm Dividing mitochondria Channel located to the plasma membrane Channel located to the plasma membrane -plasmolysis We learn more from mistakes than successes…