* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA, RNA, and Protein
Biochemistry wikipedia , lookup
RNA silencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Polyadenylation wikipedia , lookup
Community fingerprinting wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Molecular evolution wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Expanded genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Non-coding RNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA, RNA, and Protein Replication Transcription Translation Semi-conservative Replication • Occurs during S phase of cell cycle • DNA unwinds, at replication fork, via helicase • DNA polymerase makes 2 copies of DNA – Complementary base pairing: A=T, G=C • A & G are purines; T & C are pyrimidines • Purines are double rings; pyrimidines are single – Leading strand has continuous replication – Lagging strand done in Okazaki fragments • DNA ligase joins fragments on lagging strand Replication Forks & ORE Prokaryotic Replication • • • • Prokaryotes have no internal membranes. They have 1 circular chromosome. Replication starts at 1 site. Two replication forks form; replication moves in opposite directions. • Replication continues until forks meet & entire chromosome is copied. • http://www.wiley.com/college/pratt/0471393 878/student/animations/dna_replication/inde x.html Making copies of DNA • 5’TACCGACTTGATCATTTAGGTAGACATATT …3’ 3’ATGGCTGAACTAGTAAATCCATCTGTATAA …5’ DNA splits into leading (5’) & lagging (3’) strands Each strand does complementary base pairing. • 5’TACCGACTTGATCATTTAGGTAGACATATT …3’ 3’ATGGCTGAACTAGTAAATCCATCTGTATAA …5’ and • 3’ATGGCTGAACTAGTAAATCCATCTGTATAA…5’ 5’TACCGACTTGATCATTTAGGTAGACATATT …3’ Transcription • Makes RNA copy of DNA via RNA polymerase • Makes mRNA, tRNA, or rRNA • RNA polymerase binds to DNA promoter • DNA strands unwind & separate • RNA polymerase adds free RNA nucleotides to complement 1 strand of DNA bases. • G =C; C=G; T=A; A=U • RNA polymerase releases DNA & new RNA when reaches a termination signal. Transcription & Translation DNA:5’TACCGACTTGATCATTTAGGTAGACAT…3’ mRNA:AUGGCUGAACUAGUAAAUCCAUCUGUA… • mRNA exits nucleus after processing cap & tail • mRNA on ribosome is translated via tRNAs. • tRNA anticodons pair with mRNA codons (UAA, UAG, UGA). • Each tRNA carries a specific amino acid or a stop signal. • Genetic code is maintained universally. mRNA: AUGGCUGAACUAGUAAAUCCAUCUGUA polypeptide: met-ala-glt-leu-val-ast-pro-ser-val- Translation • • • • Involves all 3 types of RNA: mRNA, tRNA, rRNA Produces polypeptides which form proteins Peptide bonds link amino acids together There are 20 essential amino acids found in all living things. Some have modifications. o o o • Amino acids form 1 , 2 & 3 protein structures – Structures are essential to protein function Steps of Translation • • • • • • • • • mRNA docks on ribosome. Its 1st codon is AUG tRNA with met binds via its anticodon UAC. tRNA with its amino binds to 2nd codon. Ribosome detaches met from 1st tRNA. Peptide bond forms between met & 2nd amino acid. First tRNA exits the ribosome & 3rd tRNA enters. Elongation continues until reaches stop codon Ribosome separates from mRNA with last tRNA Translation machinery then translates same or new mRNA Human Genome • The entire gene sequence of human DNA • 3.2 billion base pairs in our 23 chromosomes • Use computers to analyze DNA sequences – Bioinformatics , a new field, compares these. • Help predict loci of genes • Don’t know yet what our 30,000 genes encode • Field of proteomics links gene to protein made