Download DNA, RNA, and Protein

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Biochemistry wikipedia , lookup

RNA silencing wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Polyadenylation wikipedia , lookup

Community fingerprinting wikipedia , lookup

Molecular cloning wikipedia , lookup

RNA polymerase II holoenzyme wikipedia , lookup

RNA-Seq wikipedia , lookup

Molecular evolution wikipedia , lookup

Eukaryotic transcription wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Gene wikipedia , lookup

DNA supercoil wikipedia , lookup

Non-coding DNA wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Point mutation wikipedia , lookup

Genetic code wikipedia , lookup

Expanded genetic code wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Messenger RNA wikipedia , lookup

Gene expression wikipedia , lookup

Non-coding RNA wikipedia , lookup

Transfer RNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Replisome wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
DNA, RNA, and Protein
Replication
Transcription
Translation
Semi-conservative Replication
• Occurs during S phase of cell cycle
• DNA unwinds, at replication fork, via helicase
• DNA polymerase makes 2 copies of DNA
– Complementary base pairing: A=T, G=C
• A & G are purines; T & C are pyrimidines
• Purines are double rings; pyrimidines are single
– Leading strand has continuous replication
– Lagging strand done in Okazaki fragments
• DNA ligase joins fragments on lagging strand
Replication Forks & ORE
Prokaryotic Replication
•
•
•
•
Prokaryotes have no internal membranes.
They have 1 circular chromosome.
Replication starts at 1 site.
Two replication forks form; replication moves
in opposite directions.
• Replication continues until forks meet & entire
chromosome is copied.
• http://www.wiley.com/college/pratt/0471393
878/student/animations/dna_replication/inde
x.html
Making copies of DNA
• 5’TACCGACTTGATCATTTAGGTAGACATATT …3’
3’ATGGCTGAACTAGTAAATCCATCTGTATAA …5’
DNA splits into leading (5’) & lagging (3’) strands
Each strand does complementary base pairing.
• 5’TACCGACTTGATCATTTAGGTAGACATATT …3’
3’ATGGCTGAACTAGTAAATCCATCTGTATAA …5’
and
• 3’ATGGCTGAACTAGTAAATCCATCTGTATAA…5’
5’TACCGACTTGATCATTTAGGTAGACATATT …3’
Transcription
• Makes RNA copy of DNA via RNA polymerase
• Makes mRNA, tRNA, or rRNA
• RNA polymerase binds to DNA promoter
• DNA strands unwind & separate
• RNA polymerase adds free RNA nucleotides to
complement 1 strand of DNA bases.
• G =C; C=G; T=A; A=U
• RNA polymerase releases DNA & new RNA
when reaches a termination signal.
Transcription & Translation
DNA:5’TACCGACTTGATCATTTAGGTAGACAT…3’
mRNA:AUGGCUGAACUAGUAAAUCCAUCUGUA…
• mRNA exits nucleus after processing cap & tail
• mRNA on ribosome is translated via tRNAs.
• tRNA anticodons pair with mRNA codons (UAA, UAG, UGA).
• Each tRNA carries a specific amino acid or a stop signal.
• Genetic code is maintained universally.
mRNA: AUGGCUGAACUAGUAAAUCCAUCUGUA
polypeptide: met-ala-glt-leu-val-ast-pro-ser-val-
Translation
•
•
•
•
Involves all 3 types of RNA: mRNA, tRNA, rRNA
Produces polypeptides which form proteins
Peptide bonds link amino acids together
There are 20 essential amino acids found in all
living things. Some have modifications.
o o
o
• Amino acids form 1 , 2 & 3 protein structures
– Structures are essential to protein function
Steps of Translation
•
•
•
•
•
•
•
•
•
mRNA docks on ribosome. Its 1st codon is AUG
tRNA with met binds via its anticodon UAC.
tRNA with its amino binds to 2nd codon.
Ribosome detaches met from 1st tRNA.
Peptide bond forms between met & 2nd amino acid.
First tRNA exits the ribosome & 3rd tRNA enters.
Elongation continues until reaches stop codon
Ribosome separates from mRNA with last tRNA
Translation machinery then translates same or new
mRNA
Human Genome
• The entire gene sequence of human DNA
• 3.2 billion base pairs in our 23 chromosomes
• Use computers to analyze DNA sequences
– Bioinformatics , a new field, compares these.
• Help predict loci of genes
• Don’t know yet what our 30,000 genes encode
• Field of proteomics links gene to protein made