Download document 7858276

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Molecular ecology wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Proteolysis wikipedia , lookup

Biochemistry wikipedia , lookup

Gene desert wikipedia , lookup

Western blot wikipedia , lookup

Amino acid synthesis wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Genetic engineering wikipedia , lookup

Gene therapy wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

RNA-Seq wikipedia , lookup

Gene wikipedia , lookup

Transformation (genetics) wikipedia , lookup

Magnesium transporter wikipedia , lookup

Real-time polymerase chain reaction wikipedia , lookup

Endogenous retrovirus wikipedia , lookup

Fatty acid metabolism wikipedia , lookup

Fatty acid synthesis wikipedia , lookup

Genomic library wikipedia , lookup

Gene expression wikipedia , lookup

Biosynthesis wikipedia , lookup

Gene nomenclature wikipedia , lookup

Plasmid wikipedia , lookup

Gene regulatory network wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Expression vector wikipedia , lookup

Community fingerprinting wikipedia , lookup

Point mutation wikipedia , lookup

Two-hybrid screening wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
Vol. 269, No. 4, Issue of January 28, pp. 2921-2928, 1994
Printed in U S A .
T m JOURNAL
OF BIOLOGICAL
CHEMISTRY
Q 1994 by The American Soeiety for Biochemistry and Molecular Biology, Inc
Sequence and Functionof the aas Gene in Escherichia coZi*
(Received for publication, May 10, 1993, and in revised form, August 16, 1993)
Suzanne Jackowski, PamelaD. Jackson, and Charles0. Rock$
From the Department of Biochemistry, St. Jude Children's Research Hospital, Memphis, Tennessee 38101 and the
Department of Biochemistry, University of Tennessee, Memphis, Tennessee 38163
2-Acylglycerophosphoethanolamine(2-acyl-GPE)ac- glycerol kinase (3). The acyl moieties of membrane phospholipyltransferase and acyl-acyl carrier protein (acyl-ACP)
ids inE. coli are metabolically active (4,5). Fatty acid turnover
synthase activitiesare encodedby the aaa gene inEach- at the l-position of PtdEtn is related to the transacylation
erichia coli. The am gene was cloned, and theDNA se- reactions that occur during the maturation
of bacterial lipoproam and teins and may also occur because of the action of phospholiquence of theaaa gene and the region between
galR established the clockwise gene order in the 61.2 pases. The resulting
2-acyl-GPE is thenrecycled into PtdEtnby
min of theE. coli chromosome as am-orf-scrlR-lyaA-lysR- 2-acyl-GPE acyltransferaselacyl-ACPsynthetase (4-6). 2-Acylorf-ard. The aua gene consistsof a single open reading GPE acyltransferase/acyl-ACPsynthetase is an inner memframe of 2,157 base pairs predicted to encodea protein brane enzyme that transfers fattyacids to the l-position via an
the enzyme-bound acyl-ACP intermediate in the presence of ATP
of 80.6 kDa. Strains harboring multiple copies ofam
gene overproduced both 2-acyl-GPE acyltransferase and
and Mg2' (5-7). The physiological function of 2-acyl-GPE acylacyl-ACP synthetase activitiesin vitro and had higher
transferase is to regenerate PtdEtn from 2-acyl-GPE that is
specific activities for the incorporation of exogenous
fatty acids and lysophospholipids into the membrane
in formed by transacylation reactions or phospholipase A1 action
vivo. Specific expressionof the am gene yielded a pro- (5-7).
tein with an apparent molecular mass of 81 kDa. Com- There are two pathways for fatty acidincorporation into
parison of the predicted amino acid sequence ofaaa
the membrane phospholipids(Fig. 1). The most activepathway
involves acyl-CoA synthetase, the product of the f a d D gene.
gene with mammalian, yeast, and bacterial long chain
acyl-coenzymeA synthetases revealed three domains
of Fatty acids entering thecell by this pathway areconverted to
high similarity which are postulated to form the acyl- acyl-CoA derivatives and eitherutilized as an energysource or
incorporated into phospholipid via the glycerolphosphate acylA M P binding pocket. These data verify that 2-acyl-GPE
acyltransferase and acyl-ACP synthetase are reactions transferase system (Fig. 1).2-Acyl-GPE acyltransferase/acylACP synthetase is responsible for the acyl-CoA-independent
carried out by the same gene product, verify the role of
2-acyl-GPE acyltransferasdacyl-ACP synthetase in the incorporation of exogenous fatty acids and 2-acyllysophosphoacylation of endogenous a-acyl-GPE, and establish the
lipids into the cell (Fig. 1; 8, 9). In f a d D mutants, acyl-CoA
product of the aaa gene as the rate-limiting enzyme in synthetase isinactive, and only the 2-acyl-GPE acyltransferase
the uptake and incorporation of exogenous 2-acyllyso- pathway is available for fatty acid incorporation into phosphophospholipids.
lipid. Mutation at a single locus (aas)at 61.2 min of the chromosome results in the inactivation of both 2-acyl-GPE acyltransferase andacyl-ACP synthetase activities. These mutants
In addition to their role in maintaining membrane structure, also lack acyl-CoA-independentfatty acid uptake, do not incorthe membrane phospholipids of Escherichia coli serve as pre- porate exogenous lysophospholipids into the membrane, and
cursors in the synthesis of other membrane-associated mol- accumulate elevated levels of 2-acyl-GPE and acylphosphatiecules. PtdGro' can donate its polar headgroup to either the
dylglycerol. The accumulation of acylphosphatidylglycerol in
major outermembrane
lipoprotein (1) or theabundant
aas mutants iscaused by the acylation of PtdGro by lysophosperiplasmic glucose polymers known as membrane-derived oli- pholipase L2 (the p l d B gene product) since aas p l d B double
gosaccharides (2). The diacylglycerol by-product of these two mutants accumulatea-acyl-GPE, but notacylphosphatidylglycbiosynthetic pathways is recycled into phospholipid by diacyl- erol (10). Double mutants (aas fadD) cannot incorporateexogenous fatty acids into membrane phospholipid at all (9). The
* This researchwas supported by National Institutes of Health Grant goal of the present work was to clone the aas gene and to
GM34496, Cancer Center (CORE) Support Grant CA21765from the determine if all of the biochemical reactions and physiological
National Cancer Institute, and the American Lebanese Syrian Associated Charities. Thecosts of publication of this article were defrayed in roles attributed to 2-acyl-GPE acyltransferase/acyl-ACP synthetase were caused by a single polypeptide chain or whether
part by the payment of page charges. This article must therefore be
hereby marked "advertisement"in accordance with 18 U.S.C. Section more than one gene product were required for the multiple
1734 solely to indicate this fact.
activities of this membrane-associatedcomplex.
The nucleotide sequence(s) reportedin this paper has been submitted
to theGenBankmIEMBL Data Bank with accession numbeds) L14681.
$ To whom correspondence should be addressed: Dept. of Biochemistry, St. Jude Children's Research Hospital, 332 North Lauderdale St., P.
0. Box318, Memphis, TN 38101. Tel.:901-522-0491; Fax: 901-5288025.
The abbreviationsused are: PtdGro, phosphatidylglycerol;
ACP, acyl
carrier protein; acyl-ACP, acyl-acyl carrier protein; a-acyl-GPE,2-acylsn-glycero-3-phosphoethanolamine; PtdEtn, phosphatidylethanolamine; orf, open reading frame;PCR, polymerase chainreaction;2-acylGPC, 2-acyl-sn-glycero-3-phosphocholine;
PtdCho, phosphatidylcholine;
GPE, sn-glycero-3-phosphoethanolamine;kb, kilobase(s); bp, base
paids).
EXPERIMENTALPROCEDURES
Materials-Sources of supplies were: AmershamCorp. for @,IO3Hlpalmitic acid (specific activity 60 Ci/mmol) and ACS scintillation
solution; DuPont NEN for [36SlmethioNne(specific activity 1,094 Ci/
mmol) and ENWANCE spray scintillation mixture; Analtech Inc. for
thin-layer chromatography plates; Boehringer Mannheim
for Rhizopus
arrhizus lipase, Triton X-100, Tris and ATP; Whatman Inc. for no. 42
and 3MM filter paper circles; Promega for molecular biology reagents
and the E. coli S30 transcription-translation system; Pierce Chemical
Co. for the BCA protein assay kit; Sigma for Brij-58; Serdary Research
Laboratories for bacterial
PtdEtn and phospholipid standards.ACP was
2921
Characterization of the aas Gene
2922
TABLEI
Strain list
Strain
Genotype
source
LCHl
W-1M t B l ~ l ASPOT1
l
gyrA216 h r k P
LCH23
aas-1metBl relAl spoTl gyrA216
h'h-PlpLCH1
This study
LCH25
aas-1 metBl relAl spoTl gyrA216
h'h-PIpLCH3
This study
LCH26
aas-1metBl relAl spoTl gyrA216
r e d 1 srl:.TnlOhrh-P
This study
LCH28
aas-1metBl relA1 spoTl gyrA216 r e d 1
srl:.Tn10hrh-lpLCH3
This study
LCH55
fadD metBl relAl spoTl gyrA216 r e d 1
srl:.TnlOhrh%
This study
LCH56
aas-1fadD metBl relAl spoTl gyrA216
r e d 1 srl:.TnlOh'h-P
metBl reMl spoTl gyrA216 h'h%
This study
UB1005
(10)
(15)
on a dry paper towel to remove excess liquid, transferred to another
Petri dish, and rapidly frozedthawed twice with liquid nitrogen. A 1-ml
acyl-CoA
reaction mixture containing 0.1 M Tris-HC1, pH 8.0, 10 m~ ATP, 2 m~
dithiothreitol, 20 p i [3Hlpalmitic acid (specific activity 60 Wmmol),
and 2% Triton X-100 was then applied to the replica print. After incu/j-oxidation
bation at 37 "C for 1 h, thereplica print was washed twicein chloroform:
FIG.1. Pathways for the incorporation of exogenous fatty
ac- methano1:acetic acid (3:6:1, v/v) to remove unreacted [3H]palmitic acid
ids into phospholipids. Exogenous fatty acids transit theouter membrane via interaction with the FadL protein. The fatty acids then d i f f i e and to precipitate [3Hlpalmitoyl-ACF! The washed replica print was
to the cytoplasmic aspect of the inner membrane where they are avail- dried, sprayed with ENWANCE, and exposed to x-ray film at -80 "C.
able as substrates for oneof the two synthetases. Acyl-CoA synthetase Following fluorography, the replica print was stained with Coomassie
(FadD) is theproduct of the fadD gene and converts fatty acids to their Brilliant Blue to localize the colonies. Candidate clones expressing acylcorresponding acyl-CoA derivatives. Acyl-CoAs are released from the ACP synthetase were identified by comparison of the blue-stained repenzyme and are then used as substrates for the @-oxidationpathway or lica print with the correspondingfluorogram. Three candidate colonies
by the sn-glycerol-3-phosphateacyltransferase system to form phospha- were positive for acyl-ACP synthetase activity in the initial screen.
tidic acid. 2-Acyl-GPE acyltransferaselacyl-ACPsynthetase (Aas)is the Plasmids were then purified from these three isolates, and following a
product of the a a s gene and activates the fatty acid for transfer to second round of transformation and screening, one plasmid (pLCH1)
2-acyl-lysophospholipidsvia the formation of an enzyme-bound acyl- remained strongly positive and was selected for further analysis.
ACP intermediate. The acyl-ACP intermediate remains associated with
DNA Sequencingof the a a s Gene-Plasmid DNAisolation,restriction
A a s and is not available to the enzymes of fatty acid biosynthesis or to
enzyme digestions, and agarose slab gel electrophoresiswere performed
the glycerolphosphateacyltransferase system. The Aas enzyme complex as described (21). Plasmid pLCHl was mapped, and the minimum
is also responsible for the incorporation of exogenous 2-acyl-lysophos- fragment of DNA whichrestored acyl-ACP synthetase activity to strain
pholipids into the cell.
LCHl was the 2.8-kb Hind111 fragment in plasmid pLCH3. Plasmid
pLCH3 was then digested with BamHI and the insert cloned into the
purified by the method of Rock and Cronan (11).2-Acyl-GPE and 2-acyl- pBS vectorin both orientations to yield plasmids pLCH5 and pLCH6. A
series of unidirectional deletions of each of these plasmids was generGPC wereprepared by digestion of E. coli PtdEtn or egg PtdCho with R.
arrhizus lipase as described by Homma and Nojima (12). 2-Acyl-GPE ated essentially as described by Henikoff (22) using the Promega Erasea-Base reagents. This collection of plasmids was used to sequence both
and 2-acyl-GPC concentrations were determined using the method of
Stewart (13) and using E. coli PtdEtn as a standard. Protein was de- strands of the 2.8-kb insert. In addition, BamHI-HincII, AccI-HindIII,
termined by the Bradford (Bio-Rad) method
(14).All other biochemicals AccI-SphI, SphI-HincII, and AccI-AccI fragments were clonedinto M13
single-stranded phage and sequenced. Sequence analysis was accomand solvents were reagent grade or better.
plished using M13 universal primers using the automated sequencing
Bacterial Strains and Growth Conditions-All
strains used in this
work werederivatives of E. coli K-12and are listed in Table I. Minimal service (Applied Biosystems,Inc.) provided by the St. Jude Molecular
growth mediumconsisted of M9 minimal salts (16), 0.4% glycerol, 0.2% Resource Center.
To confirm the orientation between the a a s and galRgenes, primers
casein hydrolysate, and 0.001% thiamine. Rich broth or agar was composed of 10 glliter tryptone, 1glliter yeast extract, 5 gfliter NaCl, and 15 complimentary to the region of the w clone 166 bp upstream of the
glliter agar. The fadD allele in strains LCH55 and LCH56 was intro- initiator methionine and the amino-terminal coding sequence of the
duced by transduction with Pl";, phage grown on strain DC451 (fadD galR gene were synthesized. The aas primer sequence (5"TACCTCzae-2:.TnlO), and the r e d lesion was introduced into strains LCH26, TGGGATCCTGAlTGTGGTCTGC) contained an engineered BamHI
site, and the galR primer (5'-TAlTAATGACCGCGGGAAACGGTGLCH28, LCH55, and LCH56 by first removing the TnlO transposable
element (17, 18) followed by transduction with Plujrphage grown on GCGA) contained an engineered SOCIIsite to facilitate cloning and
sequencing the PCR product. E. coli chromosomal DNA was isolated,
strain SJ169 (redsr1::TnlO). The cell density was measured using a
Klett-Summerson colorimeter calibrated by determining the number of and the PCR amplification was accomplished using standard methods
(23).A single 475-bp PCR product was obtained, cloned into the pBluecolony forming unitdml as a function of the colorimeter readings.
Isolation of a a s Clones-The E. coli genomic library used to isolate script vector, and sequenced using the M13 universal primers.
Protein Expression-Proteins expressed by the deletion constructs of
the 2-acyl-GPE acyltransferasdacyl-ACP synthetase clone pLCHl was
obtained from C. DiRusso (19, 20). E. coli chromosomalDNA was par- the aas clones were analyzed using an E. coli S30 extract. Assays contially digested with Sau3A and size selected for fragments between 5 tained 2 pg of plasmid DNA, 15 pl of S30 extract (Promega),nucleotides,
and 20 kilobases. DNA was ligated into the BamHI site of pBR322, and and amino acids (except methionine, Promega) and 10 pCi [36Slmethiothe ligation m i x was transformed into strain LE392. Plasmids isolated nine in a final volume of 50 pl. The reaction was initiated by the
addition of plasmid DNA and was incubated a t 37 "C for 1 h. Aliquots
from about 5,000 Amp' colonies were used to transform strain LCHl
were removed, and the proteins were precipitated with 4 volumes of cold
(aas).Amp' colonies were selected and screened using the replica print
method for colonies that regained acyl-ACP synthetase activity (10). acetone. The precipitates were collectedby centrifugation, resuspended
Briefly, cells were transferred to a Whatman 42 filter disc and were in SDS sample buffer, and boiled for 5 min. The expression of proteins
RNA
pLCH5
and pLCH6 was also examined using the T7
permeablized with a solution of 25% sucrose in 50 m~ Tris-HC1, pH 7.4, by
5 mdml lysozyme, and 10 m~ EDTA. The replica print was then placed polymerasdpromoter system as described by Tabor (24). Cells contain-
6
Characterization of the aas Gene
2923
TABLE
I1
ing pLCH5 or pLCH6in addition to pGP1-2 were grown at 30 "C, and
Acyltransferaselsynthetase activities in strains carrying
the synthesis ofT7RNA polymerase was induced by raising the temthe pLCH3 plasmid
perature to 42 "C. Rifampicin was added
to inhibit transcriptionfrom E.
Membranes were prepared from
the indicatedstrains and assayed for
coli RNA polymerase, and [36Slmethionine was addedto the culture to
label proteins selectively which were expressedthe
from
T7 promoter on 2-acyl-GPE acyltransferaseor acyl-ACP synthetase as described under
pLCH5 or pLCH6.In both experiments,the proteins were fractioned
by "Experimental Procedures."
SDS-gel electrophoresis through 8% polyacrylamide gels, which were
2-Acyl-GPE
Acyl-ACP
Relevant
Strain
dried, and the protein bands were located
by autoradiography.
acyltransferase
Synthetase
genotype
Acyl-ACP
Synthetase
and 2-Acyl-GPE Acyltransferase Assays
nmollminlmg
pmollminlmg
-Membranes were prepared by differential centrifugation of bacterial
20
0.21
type
Wild
UB1005
cell lysates as described previously (25). The standard acyl-ACP syn0.01
0
LCHl
( ~ s - 1 )
thetase assay (7,25) contained 5 l ~ ATP,
l ~ 10 rn MgC12, 2 n m dithio0.02
4
LCH26
(ms-1 red)
threitol, 0.4 M LiCl, 60 w [3Hlpalmitic acid, 15 w ACP, 2% Triton
230
2.20
LCH25
(m~-l)pLCH3
X-100, and 0.1 M Tris-HC1, pH 8.0,and the indicated amount of mem240
2.76
LCH28
( m s - 1 md)pLCH3
brane protein ina final volumeof 40 pl. At the end of 10 min at 37 "C,
30 pl of the assay mixture was withdrawn and deposited
on a Whatman
3"
filter disc and washed withtwo changes of ch1oroform:methanol: ment theaas-1mutation, nor did they yield a positive reaction
acetic acid (3:6:1,vlv) to remove unreacted fatty acid. Thefilter papers
were dried and countedin 3 ml ofACS scintillation solutionto deter- in the acyl-ACP synthetase filter disc assay.
To determine whether strains harboring
pLCH3 overpromine the amount of [SHlpalmitoyl-ACP formed.
The standard 2-acyl-GPE acyltransferase assay contained5 rnATP, duced both acyl-ACP synthetase and 2-acyl-GPE acyltransfer5 rnMgCl,, 1l l l ~dithiothreitol,50 p [SHlpalmitic acid, 100
p 2-acyl- ase activities, membranes were isolated fromwild-type or muGPE, 10 p ACP, 1%TritonX-100,0.1 M Tris-HC1,pH 8.0,and the tant strains either with
or without thepLCH3 plasmid, and the
indicated amount of membrane protein in a final volume of 40 pl(10). specific activities of the two enzymes were determined (Table
Incubations were terminated &r 10 min at 37 "C by adding 0.2 ml of
11).Strains LCHl (uus-1) and
LCH26 (aas-1r e d l ) had low to
ethanol. The mixture was evaporated to dryness under a stream of
nitrogen, resuspended in chlorofoxmmethanol
(l:l,vlv), and the sample nondetectable levels of the two enzyme activities. In contrast,
was appliedto the preabsorbent layerof a Silica GelG plate. The plate strains LCH25 (aas-llpLCH3) andLCH28 (aas-1recAlpLCH3)
was then developedwith chloroform:methanol:aceticacid(85:15:10,
had 10-fold higher specific activities of both acyl-ACP synthev/v), the PtdEtn area was located with the Bioscan Imaging Detector, tase and 2-acyl-GPE acyltransferase than their
wild-type counthe terparts. As in thewild-type membranes, thespecific activity of
and the amount of L3H1PtdEtn formed was determined by scraping
silica gel fromthe plate and liquid scintillation counting.
2-acyl-GPE acyltransferase was10-fold higher than the
specific
Incorporation of Exogenous FattyAcidsandLysophospholipids
-Strains were grown to the midlogarithmic phase (about 5 x lo8 cells/ activity of acyl-ACP synthetaseinthestrainsharboring
pLCH3. Both acyl-ACP synthetase and 2-acyl-GPE acyltransml) in glycerol minimal medium containing 0.5% Brij-58 and labeled
with 25 pCi/ml [3Hlpalmitic acid.
Culture samples(1ml) were placed on ferase activities were acquired following the introduction of
ice, and the cells were harvested by centrifugation at 12,000 x g for 15 pLCH3, demonstrating that the2.8-kb insert encoded both enmin at 4 "C. The cell pellet was washed with ice-cold unlabeled medium.
zymes.
The lipids were extracted by the method of Bligh and Dyer (26) and
DNA Sequence of the aas Gene-To facilitate DNA sequencwere separated on Silica Gel G thin-layer chromatography plates deing and protein
expression, the BamHI fragment
containing all
veloped with chloroform:methanol:aceticacid (55:20:5, v/v). The location of radioactivity on the thin-layer plate was determined with the of the chromosomal DNA was removed from pLCH3 and subBioscan Imaging Detector. The labeled phospholipids were identified by
cloned into the pBS vector in both orientations withrespect to
their migration with standards and then scraped from the plate and
the T7 promoter to yield plasmids pLCH5 and pLCH6. A series
counted in 3 ml of scintillation fluid. The same experimental approachof unidirectional deletions was made ineach of these plasmids
was used to assess the ability of strains to incorporate exogenous lysophospholipids except that 100 p 2-acyl-GPC was added to the culture using mung bean exonuclease I11 digestion. These deletions
at the same timeas the L3H1palmitate (9). Labeled PtdEtn and PtdCho were used to sequence both strands of the DNA. These DNA
sequencing results were corroborated by subcloning segments
were separated by thin-layer chromatography as described above.
of the 2.8-kb insert intoM13 followed by single-strand sequencRESULTS
ing. A restriction map of the 2.8-kb insert, the series of deleaas tions prepared with plasmid pLCH6, and the ability of the
Isolation of the aas Gene-Hybrid plasmids carrying the
gene were isolated from a chromosomal DNA library using a deleted plasmids to express 2-acyl-GPE acyltransferase and
replica print colony fluorography procedure (10). Strain LCHl acyl-ACP synthetase activities are shown in Fig. 2. The desig(aas-1)was transformed with the
plasmid library,and plasmid- nation Aas activity in the figure indicates that the plasmid
bearing strains were selected on rich agar plus ampicillin. A confers both acyl-ACP synthetase and2-acyl-GPE acyltransferreplica print was prepared, assayed for acyl-ACP synthetase ase reactions in crude cell lysates. None of the deletion conactivity (see "Experimental Procedures"), and candidate colo- structs exhibited only one of the two activities. A series of
nies wererecognized as dark colonies in a field of negative cells. deletions in plasmid pLCH5 was also generated using the same
Following secondary screening, onepositive clone was found in technique. This panel of deletions was less complete than the
this plasmid wasdesignated
16,000 transformants,and
pLCH6 series, and 2-acyl-GPE acyltransferase/acyl-ACPsynpLCH1. Strain LCHUpLCHl gave a positive reaction in the
thetase activity was lost in the smallest deletion (pLCH5.2),
replica print assay, and acyl-ACP synthetase activity was de- which removed only 250 bp from the insert (notshown).
tected in crude cell extracts verifying that plasmid pLCHl exThe DNA sequence of the aas gene is shown in Fig. 3. A single
pressed the aas gene. Plasmid pLCHlcontained a 5.3-kb insert 2,157-bp open reading frame was found in the 2.8-kb insert
determined by digestion with BamHI.Digestion of pLCHl with that waspredicted to encode a 719-amino acid protein having a
Hind111 and BamHIyielded insert fragmentsof 2.5 and 2.8 kb molecular mass of 80,624 kDa. The protein is composed of
which were subcloned into pBR322. The plasmid with the
58.7% hydrophobic and 41.3% hydrophilic amino acid residues.
2.5-kb insert, pLCH2, did not expressacyl-ACP synthetase ac- Positively charged amino acids were the predominant hydrotivity, whereas plasmid pLCH3 containing the 2.8-kb insert philic residues reflected in thepredicted isoelectric pH of 10.21.
gave a positive reaction in the replica print filter disc assay,
Hydropathy analysis of the protein sequence didnot reveal any
indicating that the aas gene was located within the 2.8-kb obvious, helical hydrophobic domains that would point to
insert in plasmid pLCH3. Recombinant plasmids containing
2-acyl-GPE acyltransferase/acyl-ACP synthetase as a transfurther major deletions of the insert inpLCH3 did not comple- membrane protein (not shown). Located 6 bp upstream of the
2924
-
Characterization of the aas Gene
T7-directed transcription in vivo using the dual-plasmid T7
expression system resulted in plasmid pLCH5 producinga 81Aaa
F S D V T A
kDa protein, whereas plasmid pLCH6 did not yield a protein
Actlvlty Phrmld
I
I
1
I
product. These data confirm the orientation of the aas gene
500
NMO
1600
2000
2600
y..
0.0
I
I
depicted in Fig. 2. In the S30 system, the a a s gene was exy
.
.
0.1
I
I
pressed from its own promoter, and an 81-kDa protein was
Yea
0.2
I
I
ma
0.3
I
I
synthesized from both pLCH5 and pLCH6 plasmids (Fig. 5).
No
0.4
I
I
Plasmid pLCH6.3 producedthe full-length 81-kDa protein (Fig.
No
6.6
I
I
No
0.0
I
I
5) as did pLCH6.1 and pLCH6.2, which contain smaller deleNo
0.m
I
I
A = ACCI
No
0.m
I
I
tions (not shown). However, pLCH6.4 yielded
a truncated prodB s BamHI
No
6.7
k
I
D
DraI
uct,
and
the
protein
product
of
pLCH6.5
was
even
shorter (Fig.
NO
6.8
I
I
F = Hincl
M
e.&
(3
B@I
5). These data show that the stop codonof the aas gene is
No
om
H
Hind1
located between 2569
and 2789 bp (Fig.
31, the end points of the
No
os
P
PSI1
No
0.m
s * *HI
aas
constructs
in
plasmids
pLCH6.4
and pLCH6.3, respecT
*
A
a
l
I
No
6.n
H
u = Asux
tively. Selected plasmids from the pLCH5 deletion series were
No
0.e
H
v
PVUI
FIG.2. Deletion analysis of plasmid pLCH6. A unidirectional set also tested in the S30 and T7 expression systems (not shown).
of nested deletions of plasmid pLCH6was generated by digesting The smallest deletion in plasmid pLCH5 (pLCH5.2)lacked the
pLCH6 with Sac1 followed by incubation with exonuclease 111. At dif- predicted transcriptional initiation sequences andthe ATG
ferent time intervals, the reaction was stopped, and the protruding ends start codon, and we found no protein expression detected in
were trimmed with S1 nuclease, filled with Klenow, and the plasmids
religated and transformed into strain LCHl( a a s ) . The individual plas- either the T7 or S30 system directed by these plasmids (not
mids were isolated from different time points and were digested with shown). Therefore, the protein expression data are consistent
restriction enzyme to determine the approximate size of the deletion. A with the location of the predicted initiation and termination
collection of plasmids was selected based on the deletions occurring signals predicted from the DNA sequence (Fig. 3). These data
every 200 bp. The deletion end points shown in the figure were deterwere not consistent with the molecular mass of 27 kDa of the
mined byDNA sequencing. The presence or absence of 2-acyl-GPE
synthetasdacyl-ACP synthetase activity was assayed in crude cell ly- aas gene product derived from SDS-gel electrophoresis of a
sates and isindicated in the kfi column.
purified 2-acyl-GPE acyltransferasdacyl-ACP synthetase
preparation (7). The reasons for this discrepancy are not iminitiator methionine codon was a probable ribosome binding mediately obvious, but the 27-kDa species would appear to be
site (WAG). Located at 45 bp upstream of the initiator codon either a proteolytic breakdown product or a major contaminatwas a probable -10 promoter sequence (TGTAAT), and a cor- ing protein in thepreparation.
responding -35 region further upstream isindicated on Fig. 3.
Physiological Consequences of 2-Acyl-GPE Acyltransferase J
Physical Location of the aas G k e A comparison of the re- Acyl-ACP Synthetase Overexpression-The acyltransferasel
striction enzyme map of pLCHl with the restriction enzyme synthetase was postulated to play a role in the reacylation of
map of the A phages located in the61-min regionof the genetic endogenous 2-acyl-GPEand the incorporation and acylation of
map (27) indicated that the a a s gene was located close to the 2-acyl-lysophospholipidsinto the membrane (9, 10). Therefore,
galR gene on h8H3 (Fig. 4). Our aas sequence derived from we examined the effect of 2-acyl-GPE acyltransferasdacyl-ACP
plasmids pLCH5 and pLCH6 did not overlap with the pub- synthetase overexpression on these activities. As in strains
lished galR sequence. Therefore, we synthesized primers ho- containing pLCH3 (Table 111, strains harboring pLCHl overmologous t~ the published sequence ofgalR and theregion just produced both activities approximately 10-fold as determined
upstream of the start of the aas sequence and used PCR to by in vitro enzyme assays in cell lysates (not shown). Since
amplifiy the DNA between these oligonucleotides. A 475-bp 2-acyl-GPC is an alternate, nonphysiological substrate for
band was obtained and cloned into pBluescript and sequenced. 2-acyl-GPE acyltransferase, this lysophospholipid was used to
Overlap with the previously determined DNA sequence ofgalR measure the uptake of exogenous 2-acyl-lysophospholipids(9).
and ouraas sequence was found and the intervening sequence This allowed us to distinguish between fatty acids incorporated
melded with the sequence of pLCH5 and pLCH6 (Fig. 3). These into the lysophospholipids generated by cellular metabolism
data confirm that aas and galR are transcribed in opposite (L3H1PtdEtn)and fatty acids incorporated into exogenous lysodirections as indicated in Fig. 4. Analysis of the sequence be- phospholipids ([3HlPtdCho).In addition, all of the strainswere
tween aus and galR revealed the presence of a small open defective in acyl-CoA synthetase ( f a d D )to eliminate fatty acid
reading frame predicted to encode a protein with a molecular incorporation via this pathway (Fig. 1). Strains harboring
weight of 6,548 and with an isoelectric point of 11.64. The pLCHl exhibited a greater than 10-fold increase in the acylainitiator codon a t position 283 is indicated in Fig. 3, and the tion and incorporation of 2-acyl-GPC into the membrane (Fig.
termination codon at position 448 is followed by a region of 6A).Since the increase in [3HlPtdCholabeling occurred in fadD
dyad symmetry followed by a run of Ts, indicating the presence mutants, the observed labeling was independent of acyl-CoA
of a factor-independent terminator between the orf and aas. synthetase activity. Furthermore, [3HlPtdCholabeling was virThese data suggest that theorfencodes a small protein, but the tually abolished in aas fa& double mutants, illustrating that
the aas gene product is responsible for all of the basal lysophoscharacteristics of this orf were not investigated further.
Expression of the aas &+Both T7
and S30 systems were pholipid uptake in wild-type strains (strain LCH55). The 10used to express selectively the aas gene (Fig. 5). Activation of fold increase in [3H]PtdCho labeling in strain LCH561pLCHl
T3
I
c
aas
-
L
T7
-.
.
FIG. 3.DNAand predicted protein sequence of the aae gene and the DNAsequence of the orfbetween aae andgaZR. DNA sequencing
of pLCH6 and pLCH5, PCR amplification and sequencing of the region between a a s and gaZR were performed as described under “Experimental
Procedures.” The DNA sequence between positions 278 and 3186 was determined from analysis of pLCH5 and pLCH6. The a a s gene coding
sequence initiates at position 612and terminates at position 2771.Aputative ribosome binding site (RBS)is located 6 bp upstream of the ATG start
codon. Sequencesbearing a strong similarity to the -10 and -35 regionsof the characteristic u70binding sites are indicated. The sequence between
positions 1and 278 was derived from
PCR amplificationand sequencing of the region between the aas and gaZR genes and predicted the existence
of an open reading frame. The putative ribosome binding site for this of was located 4 bp upstream of the initiatorcodon located a t position 283.
A stop codon was located at position 448,and a stem-loop structure indicated by the arrows located between 496and 518 which is followed by 8
lk suggests the presence of a factor-independent terminator.
Characterization of the aas Gene
2925
160
URC
- cic m8
TAT
Tyr V.1
v.1
11.
Characterization of the aas Gene
2926
A
2000
1500
lo00
0 LCH55(fadD)
8
LCH56 (aasfadD)
-0-0-0
pLCm(aas)
WHIf
I
B = BamHI
K = KpnI
0
BglI
I
S
P
w
RPGKHPG
R I
--
-
€cow
EcoRI
P = PstI
H
B
4Ooo3ooo-
Hindl
S * a h 1
FIG.4. Physical map location of the aas gene. The restriction
0 LCH55 (fadD)
enzyme mapof plasmid pLCHl was compared with the restriction map
of the E. coli chromosome determined by Kohara et al. (27). A5A10 was
1000
amplified from the miniset library, and the match between the pLCHl
and A5A10 restriction maps wasconfirmed. The location and directions
of transcription forgalR,l y d , lysR, araE, andmutH were based onour
'0
15
30
45
60
75
90
evaluation of the literature (32-38). and the relationship among the
m s , otf, andgalR genes was
verified by PCR in this study (see"Results"
Time (mm)
and "Discussion" for details).
FIG.6. Overexpression of %acyl-GPEacyltransferaselacylACP synthetase accelerates lysophospholipid uptake
and acylation. ' h o methods were usedto assess theeffect of A a s overexpression
530
on acyl-CoA-independent incorporation of exogenous fatty acids and
lysophospholipids. Panel A, the rateof 2-acyl-GPC acylation andincorpLCH 5 6
5 6 6.3
6.4
6.5
pBS
poration into the membrane was measured in the three strains
by
kDa
determining the amountof [3H]PtdChoformed in incubations containing 100 p~ 2-acyl-GPC and 25 pCi/ml [3H]palmitic acid.Panel E , the
- 94
rate of endogenous acylation of 2-acyl-GPE in the three strains was
Aas -f
measured in incubations containing 25
p C U d [3Hlpalmiticacid. Lipid
- 67
extraction, thin-layer chromatography, and quantitation were carried
out asdescribed under "Experimental Procedures."
=I
- 43
Bla
- 30
+
1
2
3
4
5
6
7
8
with a 2.5-fold increase in Ptd[3H]Etn in the plasmid-bearing
strain, theabsolute amount of [3H]PtdEknlabeled was higher.
These data suggest that theacylation of endogenous substrate
was more efficient than the acylation of exogenous lysophospholipids and corroborate the role of theacyltransferasd
synthetase in the uptake and
acylation of exogenous lysophospholipids.
DISCUSSION
FIG.5. Protein expressionfrom the aas clones. Two expression
systems were used. The acrs gene was selectively expressed using the
The
physiological
consequences
of overexpressing the aas
dual plasmid T7 expression system. Plasmids
pLCH5 and pLCH6 differ
only in the orientation of the insert DNA with respect to the T7 pro- gene support the postulated role of the enzyme in theacylation
of endogenous and exogenous lysophospholipids.The product of
moter in the
pBS vector. The m s gene was also expressed using oits
wn
promoter ina n S30 extract. Plasmids
pLCH6.3, pLCH6.4, and pLCH6.5 the aas gene is theenzyme system responsible for the uptake
were deletions of pLCH6, and their structures are shown inFig. 1. In and acylation of exogenous lysophospholipids into the memboth cases proteins were labeled with [35Slmethionine and analyzed
by
SDS-gel electrophoresis on8%polyacrylamide gelsfollowed by autora- brane. Theincrease in exogenous lysophospholipidacylation in
vivo is proportional to the increase in 2-acyl-GPE acyltransferdiography.
was similar to the increase in 2-acyl-GPE acyltransferasdacylACP synthetase specific activity in this strain,suggesting that
this enzyme system catalyzed the rate-limiting step in theuptake andacylation of exogenous lysophospholipids.A somewhat
different picture emerged from the analysis of endogenous
2-acyl-GPE acylation by exogenous fatty acid (Fig. 6B). AcylCoA-independent incorporation of exogenous [3H]palmitate
into PtdEtn increased only2.5-fold in the plasmid-bearing
strains compared with the wild-type control. This smaller increase in endogenous lysophospholipid acylation conferred by
the pLCHl plasmid indicated that the supply of 2-acyl-GPE
substrate in vivowas the limiting factor in the incorporation of
exogenous fatty acids into endogenous 2-acyl-GPE. Although
there was a 10-fold increase in Ptd[3H]Cho formed compared
asdacyl-ACP synthetase specific activity in vitro (Table I1 and
Fig. 6) showing that this enzyme catalyzes the rate-limiting
step in lysophospholipid uptake. This conclusion is consistent
with the earlier hypothesis that theproduct of the aas gene is
the only protein required for exogenous lysophospholipid acylation (5, 10). The lower rate of fatty acid incorporation into
exogenous lysophospholipids compared with the incorporation
into endogenous 2-acyl-GPE (Fig. 6) indicates that lysophospholipid uptake by the system is a low capacity process. Accordingly, mutants unable to synthesize PtdEtn (pss::kan)
could not be rescued by the addition of 2-acyl-GPE plus fatty
acid to the medium even when the a a s overproducingclone was
introduced intothesestrains.2
2-Acyl-GPE acyltransferasd
S. Jackowski and C. 0. Rock, unpublished observations.
Characterization of the aas Gene
2927
acyl-ACP synthetase has also been proposed to play a major
Domain I
role in the reacylation of endogenous 2-acyl-GPE generated
COnWnsus
Aas
388
from lipoprotein acylation or perhaps phospholipase A1 degraFad)
210
dation (5-8,lO). Incontrast to the large increase in exogenous
FAAl
273
lysophospholipid acylation, incorporation of fatty acids into enRatL
272
Ram
270
dogenous 2-acyl-GPEincreased only 2.5-fold in strains overexL
u
d
184
pressing the aas gene product (Fig. 6).These data point to the
Dae
147
supply of 2-acyl-GPE as the limiting factor in the acylation of
475
PvcA
os2
808
endogenous2-acyl-GPE.
Thus, approximately 50% of the
canl
187
2-acyl-GPE generated in vivo is normally metabolized via
AcsM
283
2-acyl-GPE acyltransferase, and in strains harboring the aas
Domain II
clone, this enzyme system competes more effectively for 2-acyl- Aas
504
GPE that would ordinarily be metabolizedvia alternate routes.
Fad)
350
FAAl
448
One of the alternate pathways for 2-acyl-GPE catabolism is
Fall
452
catalyzed by lysophospholipase L2 (the pldB gene product) that
Rat8
450
L
u
d
335
either degrades 2-acyl-lysophospholipidsto fatty acid and GPE
or transfers the fatty acid of 2-acyl-GPE to PtdGro forming
Domain 111
acyl-PtdGro and GPE (28-30). Increased 2-acyl-GPE cataboFad)
432
lism via PldB compensates for the loss of 2-acyl-GPE acyltransFAAl
532
ferase activity in aas mutants (lo), and it is therefore likely
RaK
535
that PldB makes a significant contribution to 2-acyl-GPE caRatB
534
tabolism under normal physiologicalconditions.However,
there are other reactions that may also contribute to the metabolism of 2-acyl-GPE which must be considered. A memFIG. 7. Comparison of the predictedprotein structure of
brane-associated transacylase activity has been characterized 2-acyl-GPE acyltransferaselacyl-ACP synthetase to other s p
which converts two 2-acyl-GPEs to PtdEtn and GPE (12), and t h e w s . The predicted primary amino acid sequence ofthe aas gene
product (Fig. 3)was compared to the sequences of acyl-CoAsynthetases
there isa second lysophospholipase located in thesoluble frac- from E. coli (FadD; 39), Saccharomyces cerevisiae (FAA1; 40), rat liver
tion which catalyzes only the degradation of 2-acyl-GPE (31). (RatL; 41) and rat brain (RatB; 42), luciferin monooxygenasefrom LuThe extent to which these latter two enzymes contribute to cida cruciutu (LucF;43), o-alanine activating enzyme from Lactobacilsynthetase
lysophospholipid metabolism is unclear, but it is apparent that lus cusei (Dae; 44), S(L-a-aminoadipy1)-L-cysteinyl-o-valine
A. niduluns (AvCA, 45), gramicidin S synthetase 2 from Bacillus
multiple mechanisms exist in E. coli to control the levels of from
brevis (Grs2; 46), 4-coumarate-CoA ligase from Petroselinum crispurn
lysophospholipids and prevent the accumulation of potent de- (ComL;47). acetyl-CoAsvnthetasefrom M.soehnaenii (AcsM:48). Simitergents that would disrupt membrane structure.
lar &no acid &ups were defined as follows: P,-A, G , S, T; Q, N,E,D;
Our data contribute to the correlation of the genetic and H , K , R ; C ; V , L , I , M a n d F , Y , W .
physical maps of the E. coli chromosome.Kolodrubetz and
Schleif (32) placed araE between thyA and lysA based on threepoint cross-data, and the gene order of thyA-mutH-amE-galR- between the a a s gene product and the other synthetases.There
LysA-lysR appears in edition 8 of the E. coli linkage map (33). are two additional domains in the aas gene product which
Subsequently, several groups contributed to the cloning and possess a high degree of similarity to long chain acyl-CoA syncomplete DNA sequence of this region which established the thetases whose mechanisms involve an enzyme-boundlong
gene order araE-orf-lysR-lysA-galR(34-38). A comparison of chain fatty acyl-adenylate intermediate. Domains I1and I11 are
the restriction enzyme map of the araE-galR region (38) with highly conserved between 2-acyl-GPE acyltransferasdacylthe integrated genomic restriction map (27) suggests that the ACP synthetase and acyl-CoA synthetases from E. coli, yeast,
correct orientation of the gene cluster with respect to thyA is and mammals (Fig. 7). The functional significance of these two
thyA-galR-lysA-lysR-orf-araE.
Our genetic (10) and molecular domains is unknown. However, since the a a s gene product does
analysis (Fig. 4) place the aas gene between thyA and lysA, and not bind CoA, it appears that these conserved domains are not
PCR amplification and sequencing of the genomic region be- related to the association of the CoA moiety with the enzymes.
tween galR and aus show that these two genes are transcribed One possibility is that these two domains form a hydrophobic
in the opposite directions and are separated by a small gene binding pocket that accommodates the fatty acid moietyof the
(04)
of unknown function. In conclusion, our analysis supports acyl-AMP intermediate. Support for this concept comes from
the genomic organization shown in Fig. 4 as the correct ar- the lack of a similar domain structure in acetyl-coA syntherangement of the genes in this region of the chromosome.
tase. A protein sequence region with similarity to domain I1
The primary structure of 2-acyl-GPE acyltransferasdacyl- was not located in the acetyl-coA synthetases from MethanoACP synthetase has similarities to that of several other pro- thrix soehngenii (Fig. 7; 48), Aspergillus nidulans (501,or Neuteins, which reflects their common biochemical mechanism rospora crassa (50).However, a region of acetyl-coA synthetase
(Fig. 7). Domain I is a region that has a high degree of simi- retains the spacing between the glycine residues of domain 111
larity with all synthetases thought operate
to
via the formation (Fig. 71, suggesting that there may be similarities in overall
of an acyl-AMPintermediate. This region of similarity between protein conformation in this region even though the physical
synthetases is referred to as the AMP-binding signature and properties of the domain may be quite different. Furthermore,
has the consensus sequence GXYGXPKG. The AMP-binding the occurrence of domains I1 and I11 in firefly luciferase (Fig. 7;
signature is related to the collection of glycine-rich sequences
51) is consistent with these regions forming a hydrophobic
which forms the phosphate-binding loop (P-loop)found in nupocket since luciferin is an 11-carbon hydrophobic heterocyclic
merous ATP and GTP-binding proteins (49) and is likely to be
involved in binding the AMP moiety of the acyl-AMP interme- compound (52), and luciferase binds luciferyl-AMP as an intermediate in the light generating reaction.
diate in this
diverse collection of synthetases. TheAMP-binding
signature is found in more than 20 enzymes in the protein
Acknowledgments-We thank Li Hsu and Jonathan Powell for techstructure data base and is oRen the only region of similarity nical assistance.
2928
Characterization of the aas Gene
REFERENCES
1. Chattopadhyay, P. K , and Wu, H. C. (1977) h.
Natl. Acad. Sci. U.S. A 74,
531L5322
2. Schulman, H., and Kennedy, E.P. (1977) J. Bid. Chem. 252,425I.34255
3. Raetz, C. R. H., and Newman, K F. (1979) J. Eucteriol. 137, 860-868
4. Jackowski. S., and Rock, C. 0.(1986) J. Bwl. Chem. 281, 11328-11333
5. Rock, C. 0.(1984) J. Biol. Chem. 259,6188-6194
6. Homma, H., Nishijima, M., Kobayashi, T., Okuyama, H., andNojima, S . (1981)
Biochim. Biophys. Acta 663, 1-13
7. Cooper, C. L.,Hsu, L., Jackowski, S., and Rock, C.0.(1989)J. Biol. Chem. 264,
7384-7389
8. Rock. C. O., and Jackowski, S.(1985) J. Bwl. Chem. 260,1272&12724
9. Hsu, L., Jackowski, S., and Rock, C. 0.(1989) J. Bacterwl. 171, 1203-1205
10. Hsu, L., Jackowski, S., andRock, C. 0.(1991)J. Bwl. Chem. 266,13783-13787
11. Rock, C. O., and Cronan, J. E.,Jr. (1980)Anal. Biochem. 102,362-364
12. Homma, H., and Nojima, S.(1982) J. Biochem. (Tokyo)91, 1103-1110
13. Stewart, J. C.M. ( 1 9 8 O ) h l . Biochem. 104,10-14
14. Bradford, M. M. (1976)Anal. Biochem. 72,248-254
15. Booth, B. R. (1980) Biochem. Biophys. Res. Commun. 94,102%1036
16. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY
17.Bochner, B. R., Huang, H.-C., Schieven, G. L., and Ames, B.N. (1980) J.
Bacteriol. 143,92&933
18. Maloy, S . R., and Nunn, W.D. (1981) J. Bucteriol. 146,1110-1112
19. DiRusso, C. C., and Nunn, W. D. (1985) J. Eucteriol. 161,583-588
20. Jenkins, L. S., and Nunn, W. D. (1987) J. Bucteriol. 169,4%52
21. Maniatis, T., Fritach, E. F., and Sambrook, J. (1982) Molecular Cloning: A
Labomtory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY
22. Henikoff, S. (1984) Gene (Amst. ) 28,351359
23. Coen, D. M. (1990) in Current Protocols in Molecular Biology (Ausubel, F. A,,
Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A,, and
Struhl, K., eds) pp. 15.0.3-15.1.7, Greene Publishing, New York
24. Tabor, S. (1990) in Current Protocols in Molecular Biology (Ausubel, F. A,,
Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A,, and
Struhl, K, eds) pp. 16.2.1-16.2.11, Greene Publishing, New York
25. Rock, C. O., and Cronan, J. E.,Jr. (1979) J. Biol. Chem. 264,7116-7122
26. Bligh, E. G., and Dyer, W. J. (1959) Can. J . Biochem. Physwl. 37,911-917
27. Kohara, Y., Akiyama, K., and Isono, K (1987) Cell 60,495-508
28. Kobayashi, T., Homma, H., Natori, Y., Kudo, I., Inoue, K., and Nojima, S .
(1984) J. Biochem. (Tokyo)96, 137-145
29. Albright, F. R., White, D. A,, and Lennarz, W. J. (1973) J. Biol. Chem. 248,
39683977
30. Karasawa, K., Kudo, I., Kobayashi, T., Sa-eki, T., Inoue, K., and Nojima, S.
(1985) J. Biochem. (Tokyo)98, 1117-1125
31. Doi, O., and Nojima, S . (1975) J. Biol. Chem. 260, 52084214
32. Kolodrubetz, D., and Schleif, R. (1981) J. Bucteriol. 148,472479
33. Bachmann, B. J. (1990)Microbiol. Reu. 54,13&197
34. von Wilcken-Bergmann,B., and Muller-Hill, B. (1982) Pmc. Natl. Acud. Sci.
U.S. A. 79,2427-2431
35. Stragier, P., Richard, F., Borne, F., and Patte, J.-C. (1983) J. Mol. B i d . 168,
307320
36. Stragier, P., Danon, O., and Patte,, J.-C. (1983) J. Mol. Biol. 168, 321331
37. Stragier, P., and Patte, J.4. (1983) J. Mol. Biol. 168,333-350
38. Maiden, M. C.J., Jones-Mortimer, M. C., and Henderson, P. J. E (1988)J. Biol.
Chem. 263,80034010
39. Black, P. N., DiRusso, C. C., Metzger, A. K., and Heimert, T. L.(1992) J. Biol.
Chem. 267,25513-25520
40. Duronio, R. J.,Knoll, L. J., and Gordon, J. I. (1992) J. Cell Biol. 117,515-529
41. Suzuki, H., Kawarabayasi, Y., Kondo, J.,Abe, T., Nishikawa, K, Kimura, S.,
Hashimoto, T., and Yamamoto, T.(1990) J. Biol Chem. 286,868143685
42. Fujino, T., and Yamamoto, T. (1992)J. Biochem. (Tokyo) 111,197-203
43. Masuda, T., Tatsumi, H., and Nakano, E.(1989) Gene (Amst.) 77,265-270
44. Heaton, M. P., and Neuhaus, F. C. (1992) J. Bucteriol. 174,47074717
45. MacCabe, A. P.,van Liempt, H., Palissa, H., Unkles, S . E., Riach, M. B. R.,
Heifer, E.,von Dohren, H., and Kinghorn, J. R. (1991)J. Bwl. Chem. 266,
1264G12654
46. Hori, K., Yamamoto, Y.,' h k i t a , K, Saito, F., Kurotsu, T., Kanda, M., Okamura,
K , Furuyama, J., and Saito, Y. (1991) J. Biochem. 110,111-119
47. Lozoya, E., Hot€mann, H., D o u g h , C., Schulz, W., Scheel, D., and Hahlbrock,
K. (1988) Eur. J. Biochem. 176,661-667
48. Eggen, R. I. L., Geerling, A. C. M., Boshoven, A. B. P., and de Vos, W. M. (1991)
J. Bucteriol. 173, 63834389
49. Saraste, M., Sibbald, P. R., and Wittinghofer, A. (1990) %.endsBiochem. Sci.
16,430-434
50. Connerton, I. E , Fincham, J. R. S., Sandeman, R. A., and Hynes, M. J. (1990)
Mol. Microbial. 4, 451460
51. deWet, J. R.,Wood, K V., DeLuca, M., Helinski, D. R., and Subramani, S .
(1987) Mol. Cell. Biol. 7, 725-737
52. Bowie, L.J. (1978) Methods Enzymol. 57, 15-28