* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Information flow within the cell
Survey
Document related concepts
Promoter (genetics) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Paracrine signalling wikipedia , lookup
Signal transduction wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Genetic engineering wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genomic library wikipedia , lookup
Gene regulatory network wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Gene expression wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcript
Information flow within the cell a primer… Zoi Lygerou Medical School, Patras University Greece All living organisms today have derived from the same cell which appeared on earth some 4 billion years ago © 2000 by Geoffrey M. Cooper All living organisms today are related The tree of life… © 2002 by Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith Roberts, and Peter Walter All living organisms are made up of cells Prokaryotic cell 1-10μm Eukaryotic cell 10-100 μm There are hundreds of different cell types within the human body, each with a unique structure and function Blood cells Neuron Sperm cell and oocyte Fibroblasts Cardiac myocyte There are millions of different cells on earth… All cells are made up of the same building blocks Which is the main structural and functional component of cells? Proteins are the main structural and functional components of the cell Collagen Haemoglobin Proteins are chains of amino-acids NH2 COOH Proteins are build from 20 different amino acids © 2000 by Geoffrey M. Cooper The unique properties of the amino-acid side chains give each protein its structure and function NH2 COOH Proteins are folded into a specific conformation compatible with a specific function The amino acid sequence contains all the information for protein structure and function Out of the trillions of amino acid combinations possible, proteins have the sequence which leads to a stable structure suitable for a specific function so, how is the amino-acid composition of proteins defined, preserved and passed down to future generations? Each cell contains all the information required to built and maintain the complete organism (to synthesize all the proteins needed in every cell type) This information must be stored safely but be accessible for decoding Every time a cell divides, an accurate and full copy must be made and correctly segregated to the daughter cell The storage molecule must be stable, with high information content, easily copied and read From Nature 171: 740–741 1953 Rosalind Franklin Francis Crick Maurice Wilkins James D. Watson 1962 Nobel Prize for Physiology or Medicine The DNA structure permits access to the primary sequence How can the 4 DNA letters code for 20 amino-acids? The 4 DNA letters are read in triplets 43 combinations = 64 Codons 5’GATGTTCATCGTAATCGTAGCTAACATATCA3’ 3’CTACAAGTAGCATTACGATCGATTGTATAGT5’ GAT GTT CAT CGT AAT CGT AGC TAA CAT ATC A Which is the look-up table? The Genetic Code Marshall W. Nirenberg Robert W. Holley H. Gobind Khorana Nobel Prize in Physiology or Medicine 1968 Second Position of Codon T TTT Phe [F] T C A G TCT Ser [S] TAT Tyr [Y] TGT Cys [C] T TTC Phe [F] TCC Ser [S] TAC Tyr [Y] TGC Cys [C] C TTA Leu [L] TCA Ser [S] TAA Ter [end] TGA Ter [end] A F TTG Leu [L] TCG Ser [S] TAG i CTT Leu [L] CCT Pro [P] CAT r s CTC Leu [L] CCC Pro [P] CAC C t CTA Leu [L] CCA Pro [P] CAA CTG Leu [L] P o ATT Ile [I] s ATC Ile [I] i A ATA Ile [I] t i ATG Met [M] o GTT Val [V] n GTC Val [V] G GTA Val [V] GTG Val [V] Ter [end] TGG Trp [W] T h T i C r d A G His [H] CGT Arg [R] His [H] CGC Arg [R] Gln [Q] CGA Arg [R] CCG Pro [P] CAG Gln [Q] CGG Arg [R] ACT Thr [T] AAT Asn [N] AGT Ser [S] ACC Thr [T] AAC Asn [N] AGC Ser [S] ACA Thr [T] AAA Lys [K] AGA Arg [R] ACG Thr [T] AAG Lys [K] AGG Arg [R] GCT Ala [A] GAT Asp [D] GGT Gly [G] GCC Ala [A] GAC Asp [D] GGC Gly [G] G P T o s C i A t G i o T n C GCA Ala [A] GAA Glu [E] GGA Gly [G] A GCG Ala [A] GAG Glu [E] GGG Gly [G] G The 4 DNA letters are read in triplets 5’ GATGTTCATCGTAATCGTAGCTAACATATCAAATTGA 3’ 3’CTACAAGTAGCATTAGCATCGATTGTATAGTTTAACT5’ Forward frames TTG A L Frame 1 G ATG TTC ATC GTA ATC GTA GCT AAC ATA TCA AAT TGA Met F I V I V A N I S N Stop Frame 2 GAT GTT CAT CGT AAT CGT AGC TAA CAT ATC AAA D V H R N R S StopH I K Frame 3 GA TGT TCA TCG TAA TCG TAG CTA ACA TAT CAA ATT GA C S S StopS StopL T Y Q I Reverse frames T CAA ATT TGA TAT GTT AGC TAC GAT TAC GAT GAA CAT C Frame 4 S I StopY V S Y D Y D E H TC AAA TTT GAT ATG TTA GCT ACG ATT ACG ATG AAC ATC Q F D Met L A T I T Met N I Frame 5 TCA AAT TTG ATA TGT TAG CTA CGA TTA CGA TGA ACA TC S N L I C StopL R L R StopT Frame 6 Open Reading Frame ORF From DNA to RNA DNA is copied into RNA, before it is decoded to protein Why? The central dogma DNA Transcription RNA Translation NH2 COOH Protein Genes are the functional units of the genetic material: a part of the genome which codes for a product with a specific function Regulatory region Transcribed region DNA RNA NH2 COOH Protein The central dogma Replication DNA Transcription RNA Translation NH2 COOH Protein An accurate copy of the genetic information must be made every time a cell divides Replication Replication Bacteria Single replication initiation point: origin of replication Eukarya Hundreds of origins scattered throughout the genome Replication only at a specific phase of the life of the cell (cell cycle) – S phase Need for accurate spatio-temporal regulation Information flow within the cell – a family business… Arthur Kornberg Nobel Price 1959 Replication Roger Kornberg Nobel Price 2006 Transcription A few complications… In eukaryotes, the genetic information is split… Genes contain parts coding for function (exons) interrupted by non-coding parts (introns) Regulatory region Transcribed region DNA Promoter Primary transcript Splicing NH2 Mature mRNA COOH Protein A few more complications… In addition to genes, there is a hell of a lot more in a genome… especially in the human genome… Less than 30% of our genome contains genes (introns and exons) Less than 2% of our genome encodes for protein Identifying genes is not straight forward If 1bp was 1mm… Our genome would be 3200km 300m 300m 30m There would be one gene every 300m Every gene would be 30m mRNA would be 1m Adapted from Molecular Biology of the Cell, Alberts et al Genes are not evenly distributed along the human genome… Gene-dense “urban centers” alternate with gene-poor “deserts” The sequence composition of gene-rich, gene-poor regions and boundaries differs significantly So what about all the rest? 50% are repetitive sequences Junk DNA ??? Or Shapers of the genome ??? A few more complications… DNA is very long… The DNA in each human cell is 1m long How to you fit a 1m long thread within a sphere 10μm in diameter? ….so that you do not tangle it up and are able to separate it every time the cell divides? …and so that each part of it can be accessed for transcription? DNA is folded together with proteins into chromatin Active regions are less compact (euchromatin) Inactive regions are more compact (heterochromatin) Chromatin is further compacted just prior to cell division to permit separation without entanglement chromosomes Regulation of gene expression (and inheritance of a cell character) involves to a great extent regulation of chromatin structure