Download The Role Of The Planar Cell Polarity Pathway In The Second Heart

THE ROLE OF THE PLANAR CELL POLARITY PATHWAY IN THE SECOND
HEART FIELD DURING OUTFLOW TRACT MORPHOGENESIS
by
TANVI SINHA
JIANBO WANG, CHAIR
CHENBEI CHANG
STUART J. FRANK
KAI JIAO
MICHAEL A. MILLER
ROSA SERRA
A DISSERTATION
Submitted to the graduate faculty of The University of Alabama at Birmingham,
in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
BIRMINGHAM, ALABAMA
2014
THE ROLE OF THE PLANAR CELL POLARITY PATHWAY IN THE SECOND
HEART FIELD DURING OUTFLOW TRACT MORPHOGENESIS
TANVI SINHA
GRADUATE PROGRAM IN CELL BIOLOGY
ABSTRACT
Outflow Tract (OFT) malformations underlie a majority of congenital heart
defects (CHD) in humans and are a leading cause of childhood mortality. The OFT,
which gives rise to the aorta and pulmonary artery of the heart, relies on the contribution
of the Second Heart Field (SHF) progenitors in the pharyngeal and the splanchnic
mesoderm, outside of the initial heart. OFT morphogenesis requires highly regulated SHF
development involving the proliferation, differentiation and deployment of the SHF
progenitors to the heart. Extensive studies elegantly demonstrate how transcriptional
networks integrating signaling input from multiple pathways finely balance the
proliferation and differentiation of SHF progenitors. However, the mechanisms involved
in the deployment of SHF progenitors to the OFT have remained largely unknown.
Here, in chapter 2, we first demonstrate that Dvl2-mediated Planar Cell Polarity
(PCP) signaling is specifically required in the SHF lineage during OFT morphogenesis.
Loss of PCP genes Vangl2 and Dvl1/2 and the non-canonical Wnt, Wnt5a result in severe
defects in OFT elongation and looping, characteristic of comprised SHF contribution.
Further, in chapter 3, our extensive genetic studies in the mouse and experimental
manipulations in the chick directly demonstrate that Wnt5a is involved in the deployment
of SHF progenitors from the splanchnic mesoderm to the OFT. These studies have
allowed us to put forth a novel mechanism to understand how SHF progenitors may be
uni-directionally and cohesively deployed in a PCP-dependent fashion to elongate the
ii
OFT and how a perturbation in Wnt5a signaling can lead to inefficient SHF deployment
and abnormal OFT morphogenesis. Finally, as described in chapter 4, by performing
detailed lineage analysis of the other non-canonical Wnt, Wnt11 with an inducible
Wnt11-CreER BAC transgene, we have generated a high resolution expression and fate
map of Wnt11 expressing cells during early development, which indicates its dynamic
contribution during endoderm development, vasculogenesis and cardiac development.
Together, these results have significantly enriched our understanding of PCP signaling
during SHF development and OFT morphogenesis, which is essential towards designing
diagnostic and therapeutic approaches toward
malformations.
Key words: Planar Cell Polarity
Outflow tract morphogenesis
Second heart field
Wnt5a/Wnt11
Heart development
Lineage tracing
iii
the treatment
of congenital OFT
DEDICATION
To my parents, Rani and Mahesh and my brother, Ameya, without whom none of this
would have been possible; without whom none of this would be worth it.
In memory of my late grandfather, Shri Pratap Charan Sinha.
iv
ACKNOWLEDGEMENTS
Reflecting back, it is abundantly clear that I would never have been able to get to
where I am today without the support of a lot of people; for that I will always be grateful.
First and foremost, a big thank you to my mentor, Dr. Jianbo Wang for taking a
chance on me and giving me the opportunity to carry out my graduate work with him. I
am thankful for his immense patience and guidance. His unswerving confidence in my
abilities has been instrumental in my scientific growth and in shaping my graduate career
and I cannot thank him enough for that. I am also thankful for all the valuable
interactions I have had with past and present members of the Wang lab, especially with
Bing Wang - I have missed your presence in the past two years!
I would like to thank my committee members Dr. Chenbei Chang, Dr. Kai Jiao,
Dr. Stuart Frank, Dr. Michael Miller and Dr. Rosa Serra for their constructive, insightful
advice and their constant support throughout my graduate studies. They have been a great
inspiration to work with and I could not have asked for a better committee. A special
shout out to Drs. Chang and Serra for being extremely generous with their resources and
time, which were vital towards the completion of this project.
I would also like to thank our graduate program director, Dr. Jim Collawn for his
encouragement and astute advice, in matters both scientific and non-scientific. Thank you
to our fantastic program coordinator, Rene Eubank – it has been a delight knowing you
and without you, I would never have been able to navigate absolutely any of the
paperwork that grad school entails.
v
I have been exceptionally lucky to be surrounded by a great group of people who
have made this journey enjoyable and for that, I am very thankful. To my room-mate of 4
years and friend through 8, Swati. You were instrumental in getting me to UAB and you
showed me how to get through grad school with élan – thank you! To Vedrana, Vlad and
Jessica – you have been my biggest cheerleaders throughout and I am overwhelmed by
your faith in me. To Edie Mitchell - for our shared love of bloody marys and for making
my life about more than just work. Thank you to Dr. Susan Nozell for being my steady
candy supplier and agony aunt extraordinaire and for always having your office door
open. Rajani – thank you for feeding me and for listening to me whine through the last
six months of school. My cousin, Manas- thank you for checking in ever so often to make
sure that graduate school hadn’t gotten the better of me!
I am very grateful for the immeasurable support from my family and there
probably aren’t enough ways in which I will ever be able to thank them. I am indebted to
my parents for their unwavering love and selflessness. You have always believed in me,
you have pushed me when I needed it and you have celebrated every achievement of
mine, no matter how big or small – thank you! I am thankful to and for my brother,
Ameya – without him, this dissertation literally would not be complete! He makes me
proud and inspires me to be a better person each day! A big thank you to my aunts back
home – Saroj and Sarita Saxena. I hope, someday, I can be half the women you are.
And finally, thank you to the entire UAB-CDIB family for accepting me as one of
their own and for giving me a home away from home.
vi
TABLE OF CONTENTS
ABSTRACT ........................................................................................................................ ii
DEDICATION ................................................................................................................... iv
ACKNOWLEDGEMENTS .................................................................................................v
LIST OF TABLES ............................................................................................................. ix
LIST OF FIGURES .............................................................................................................x
LIST OF ABBREVIATIONS .......................................................................................... xiii
INTRODUCTION ...............................................................................................................1
Early cardiac development ..........................................................................................2
The Outflow Tract (OFT) ...........................................................................................5
The Second Heart Field (SHF) ...................................................................................8
The Planar Cell Polarity (PCP) Pathway ..................................................................11
DISHEVELED MEDIATED PLANAR CELL POLARITY SIGNALING IS
REQUIRED IN THE SECOND HEART FIELD LINEAGE FOR OUTFLOW TRACT
MORPHOGENESIS ..........................................................................................................17
LOSS OF WNT5A,A PUTATIVE TBX1 TARGET GENE, DISRUPTS SECONDARY
HEART FIELD DEPLOYMENT AND MAY UNDERLIE THE OUTFLOW TRACT
MALFORMATIONS IN DIGEORGE SYNDROME.......................................................63
MAPPING THE DYNAMIC EXPRESSION OF WNT11 AND THE LINEAGE
CONTRIBUTION OF WNT11-EXPRESSING CELLS DURING EARLY MOUSE
DEVELOPMENT ............................................................................................................111
SUMMARY .....................................................................................................................184
Chapter 2 ..........................................................................................................................185
Chapter 3 ..........................................................................................................................187
Chapter 4 ..........................................................................................................................188
vii
SIGNIFICANCE ..............................................................................................................190
FUTURE DIRECTIONS .................................................................................................196
GENERAL LIST OF REFERENCES .............................................................................199
APPENDIX ......................................................................................................................213
viii
LIST OF TABLES
Table
Page
DISHEVELED MEDIATED PLANAR CELL POLARITY SIGNALING IS
REQUIRED IN THE SECOND HEART FIELD
LINEAGE FOR OUTFLOW TRACT MORPHOGENESIS
1. Summary of progeny recovered at weaning from crosses between Dvl1-/-; Dvl2-/-;
Dvl2-EGFP2; Dvl2-EGFP2 and Dvl1-/-; Dvl2+/-; Wnt1-Cre or Dvl1-/-; Dvl2+/-;
Isl1-Cre mice. ..........................................................................................................43
LOSS OF WNT5A, A PUTATIVE TBX1 TARGET GENE, DISRUPTS
SECONDARY HEART FIELD DEPLOYMENT AND MAY UNDERLIE THE
OUTFLOW TRACT MALFORMATIONS IN DIGEORGE SYNDROME
1. Number of chick embryos injected to analyze the effect of Wnt5a on SHF
deployment to the OFT............................................................................................99
MAPPING THE DYNAMIC EXPRESSION OF WNT11 AND
THE LINEAGE CONTRIBUTION OF WNT11-EXPRESSING
CELLS DURING EARLY MOUSE DEVELOPMENT
1. Summary of the spatio-temporally specific contribution of the Wnt11-CreER
expressing cells to the embryonic heart: ...............................................................159
ix
LIST OF FIGURES
Figure
Page
INTRODUCTION
1. Mammalian Heart Development ..............................................................................4
2. Overview of OFT development in the mouse during early embryogenesis ............6
3. A spectrum of conotruncal malformations ..............................................................8
4. Transcriptional and signaling networks involved in SHF development ................12
5. Schematic overview of canonical Wnt and Planar Cell Polarity pathways during
development ...........................................................................................................13
DISHEVELED MEDIATED PLANAR CELL POLARITY SIGNALING IS
REQUIRED IN THE SECOND HEART FIELD LINEAGE
FOR OUTFLOW TRACT MORPHOGENESIS
1. Genetic evidence that the OFT defect in Dvl1-/-; Dvl2-/- mutants arises from
disruption of PCP signaling. ..................................................................................44
2. Dvl2 is required in the SHF but not the CNC lineage for OFT development. ......45
3. Cardiac looping defects in various PCP mutants at E9.5 are correlated with OFT
shortening. ..............................................................................................................46
4. OFT alignment defects in E11.5 PCP mutants. .....................................................47
5. Wnt5a and Dvl1/2 mutants display histological defects in the caudal SpM, where
Wnt5s and Dvl2 are co-expressed..........................................................................48
6. Actin polymerization defects in SHF progenitors in the caudal SpM of Wnt5a and
Dvl1/2 mutants. ......................................................................................................50
7. Model of Wnt5a/Dvl-mediated PCP signaling in SHF deployment. .....................52
8. (Supplemental Figure 1) Assessment of cell proliferation and apoptosis in the
caudal SpM. ...........................................................................................................53
x
LOSS OF WNT5A, A PUTATIVE TBX1 TARGET GENE, DISRUPTS
SECONDARY HEART FIELD DEPLOYMENT AND MAY UNDERLIE THE
OUTFLOW TRACT MALFORMATIONS IN DIGEORGE SYNDROME
1. The Spm of the mouse SHF is epithelial in nature and Wnt5a is expressed in the
caudal SpM ............................................................................................................92
2. SHF progenitors are trapped in the SpM in Wnt5a-/- embryos ..............................93
3. Loss of regional OFT myocardium and ectopic expansion of the superior OFT
myocardium in Wnt5a-/- mutants............................................................................94
4. In vivo characterization of caudal SHF deployment to the OFT in the chick
embryo ...................................................................................................................97
MAPPING THE DYNAMIC EXPRESSION OF WNT11 AND
THE LINEAGE CONTRIBUTION OF WNT11-EXPRESSING
CELLS DURING EARLY MOUSE DEVELOPMENT
1. Generation and characterization of Wnt11-CreER BAC transgene. ...................143
2. Cells expressing Wnt11-CreER at the onset of gastrulation contribute to the
endodermal and endothelial lineages. ..................................................................145
3. Cells expressing Wnt11-CreER at the mid streak stage contribute to the
endodermal and mesodermal lineages. ................................................................146
4. Contribution of E6.5 Wnt11-CreER expressing cells to the endothelium and
endodermally derived internal organs in E12.5 embryos. ...................................147
5. Cells expressing Wnt11-CreER at late streak stage contribute to the posterior
endoderm and distinct mesodermal tissues. .........................................................149
6. Wnt11-CreER expression terminates in the embryonic endoderm and the extraembryonic vasculature shortly after gastrulation. ................................................151
7. Wnt11-CreER expression is initiated in the endocardial progenitors during
gastrulation and maintained in the differentiated endocardium. ..........................153
8. Sequential activation of dynamic expression of Wnt11-CreER in the progenitors
of the ventricular myocardium. ............................................................................155
9. Spatially restricted contribution of Wnt11-CreER expressing cells to the OFT
myocardium. ........................................................................................................157
xi
10. Suppl. Fig. 1. Cells expressing Wnt11-CreER at E7.5 contributes to the extraembryonic vasculature. ........................................................................................160
11. Suppl. Fig. 2. Dynamic contribution of Wnt11-CreER expressing cells to the
ventricles. .............................................................................................................161
12. Suppl. Fig. 3. Wnt11-CreER lineage does not contribute to the inflow tract/atrial
myocardium. ........................................................................................................162
SIGNIFICANCE
1. Wnt5a-/- mutants exhibit an up-regulation of N-cadherin in the caudal SpM. .....194
xii
LIST OF ABBREVIATIONS
A
Anterior
AA
angles of alignment
antNT
anterior neural tube
Ao
Aorta
AV Canal
atrioventricular canal
BA
Branchial Arch
BAC
Bacterial Artificial Chromosome
CAT
common arterial trunk
cDNA
Complementary DNA
CE
convergent extension
CHD
Congenital heart defects
CNC
cardiac neural crest
DA
dorsal aorta
DGS
DiGeorge Syndrome
Dil
1,1’-dioctadecyl-3,3,3’-tetramethylindocarbocyanine
perchlorate
DNA
Deoxyribonucleic acid
DORV
double outlet right ventricle
Dvl/Dsh
Disheveled
E
embryonic days
xiii
En
Endocardium
Epi
Epicardium
FG
Foregut
FHF
first heart field
Fmi
Flamingo
Fz
Frizzled
GIT
gastro-intestinal tract
H&E
Hematoxylin & Eosin
HG
Hindgut
HH
hamburger-hamilton
HT
Heart tube
IFT
inflow tract
IgG
Immunoglobin G
ISV
inter-somitic vessels
Kan
Kanamycin
LPM
lateral plate mesoderm
LV
left ventricle
LWR
length to width ratio
M-L
Mediolateral
MET
mesenchymal to epithelial transition
Mlc1v
Mlc1v-nLacZ-24
Myo
Myocardium
ND
nephric duct
xiv
nLacZ
nuclear lacZ
NP
notochordal plate
NT
neural tube
OFT
outflow tract
OV
omphalomesenteric vein
P
Posterior
PA
pulmonary artery
PBS
Phosphate buffered saline
PCP
planar cell polarity
PCR
Polymerase chain reaction
PECAM
Platelet endothelial cell adhesion molecule)
PFA
paraformaldehyde
PhA
pharyngeal arch
PM
pharyngeal mesoderm
post NT
posterior neural tube
PTA
persistent truncus arteriosus
R26R
Rosa26 Cre reporters
RV
right ventricle
Sema3c
Semaphorin 3c
SHF
second heart field
SpM
splanchnic mesoderm
T55
Myf5-nLacZ-A17-T55
TGA
Transposition of the great arteries
xv
Vang/Vangl Van Gogh like
YSV
yolk sac vasculature
ZO1
Zonula Occludens 1
xvi
1. INTRODUCTION
The heart of creatures is the foundation of life, the Prince of all, the sun of their
microcosm, from where all vigor and strength does flow.
—William Harvey, De Motu Cordis, 1628
As early as the 17th century, renowned physician William Harvey described the
development and physiology of the heart in one of the earliest and most influential works
of medicine, de Motu Cordis, which serves as the foundation for cardiovascular biology.
Since even before Harvey’s time, there has always been an intense fascination with
understanding the intricate mechanisms fundamental to the function of the heart, thereby
underscoring its importance as a vital organ.
Simplistically, the adult mammalian heart is a four chambered structure consisting
of two ventricles and two atria. Additionally, there are the two main great vessels of the
heart, the aorta and the pulmonary artery that connect with the left and right ventricles
respectively to establish and maintain the systemic and pulmonary circulatory systems.
One of the main functions of the heart during adult life is to act as a circulatory pump to
distribute oxygen-rich blood to all the organs and to return the deoxygenated blood to the
lungs for oxygenation. The heart is the earliest organ to form and achieve functionality
during development. It is initially present as a simple single muscular tube and its
formation is essential for the survival of the embryo mainly due to its primary embryonic
function of supplying oxygen and nutrients as required during development.
1
The embryonic heart is extremely sensitive to both genetic and environmental
disturbances. Abnormalities during its development result in congenital heart defects
(CHD). CHDs are the most common birth defects occurring in almost 1 out of every 100
live births and account for almost ten-fold more spontaneous abortions (Bruneau, 2008) .
The frequency of these CHDs reflects the necessity of a fully functional heart and
highlight the extreme precision required during this process. Therefore, elucidating the
developmental
mechanisms
involved
during cardiogenesis
is crucial
towards
identification of the etiologies underlying these CHDs and for designing novel and
innovative diagnostic and therapeutic approaches.
Early cardiac development
The heart develops from the cardiac progenitors situated in the anterior lateral
plate mesoderm. Cell labeling and tissue transplantation experiments in the mouse and
chick have shown that the cardiac progenitors are amongst the earliest mesodermal cells
to exit from the anterior primitive streak during gastrulation (Garcia-Martinez and
Schoenwolf, 1993; Lawson et al., 1991; Tam et al., 1997). In the mouse, these
mesodermal progenitors express the pan cardiac marker Mesp1 (Saga et al., 1999) and
traverse anterio-laterally along ‘mesodermal wings’ to reach their terminal position in the
cardiac crescent, which lies in the splanchnic mesoderm below the neural headfolds at
embryonic day (E) 7.5 (Fig. 1) (Tam and Behringer, 1997).
Lineage studies have shown that, at this stage, the cardiac progenitors are
arranged into two juxtaposed fields, the First Heart Field (FHF) and the Second Heart
Field (SHF), which together provide a majority of the progenitors that will make up the
different cardiac structures and cell types. The FHF and SHF progenitors were identified
2
based on the expression of several specific markers and mainly differ in their timing of
progenitor contribution to the heart (Buckingham et al., 2005). As development proceeds,
the FHF progenitors coalesce to form a linear, beating heart tube at E8.25, which will
finally give rise to the left ventricular compartment and parts of the inflow tract (IFT).
Following this, the SHF progenitors lying medio-dorsally undergo proliferation and
differentiation and are subsequently recruited to give rise to the right ventricle, the
outflow tract (OFT) and the IFT. The OFT will ultimately be remodeled to give rise to
the aorta and pulmonary artery while the inflow tract will form the left and the right
atrium (Fig.1) (Buckingham et al., 2005).
It was historically believed that the primitive heart tube contained all the
precursors required for the formation of a four-chambered heart. As per this ‘segmental
model’, the precursors within the heart underwent proliferation and the cardiac tube
expanded by a ballooning mechanism to form the different components of the heart. Even
though experiments conducted in the chick around the same time suggested an extracardiac origin of the precursors of the heart, especially of those which gave rise to the
OFT and distal right ventricular myocardium; these were largely ignored in favor of the
more traditional segmental model (de la Cruz et al., 1977; Inagaki et al., 1993;
Patwardhan et al., 2000; Redkar et al., 2001; Rosenquist, 1970; Stalsberg and DeHaan,
1969; Viragh and Challice, 1973). Finally, in the early 2000s, three landmark studies, two
in the avian embryo and one in the mouse, used genetic and cell labeling techniques to
convincingly demonstrate the extra-cardiac origin of the precursors of the OFT and the
3
Figure 1: Mammalian Heart Development. Oblique views of whole embryos and
frontal views of cardiac precursors during human cardiac development are shown. (First
panel) First heart field (FHF) cells form a crescent shape in the anterior embryo with
second heart field (SHF) cells medial and anterior to the FHF. (Second panel) SHF cells
lie dorsal to the straight heart tube and begin to migrate (arrows) into the anterior and
posterior ends of the tube to form the right ventricle (RV), conotruncus (CT), and part of
the atria (A). (Third panel) Following rightward looping of the heart tube, cardiac neural
crest (CNC) cells also migrate (arrow) into the outflow tract from the neural folds to
septate the outflow tract and pattern the bilaterally symmetric aortic arch arteries (III, IV,
and VI). (Fourth panel) Septation of the ventricles, atria, and atrioventricular valves
(AVV) results in the four-chambered heart. V, ventricle; LV, left ventricle; LA, left
atrium; RA, right atrium; AS, aortic sac; Ao, aorta; PA, pulmonary artery; RSCA, right
subclavian artery; LSCA, left subclavian artery; RCA, right carotid artery; LCA, left
carotid artery; DA, ductus arteriosus. (Figure and text adapted from Srivastava 2006,
permission obtained from Elsevier)
4
right ventricle in the SHF (Kelly et al., 2001; Mjaatvedt et al., 2001; Waldo et al., 2001).
Intense studies in the following decade have provided an extensive wealth of information
on the contribution of the SHF to the heart as well as on the gene regulatory networks
controlling these processes.
The Outflow Tract (OFT)
The two great arteries of the heart, the aorta and the pulmonary artery, arise from
a transient structure known as the OFT, which is formed by the contribution of the SHF
progenitors in pharyngeal and splanchnic mesoderm to the arterial pole of the heart . The
development of the OFT commences around E8.5 in the mouse embryo and it is initially
present as single vascular tube that connects the aortic sac to the ventricles. Within 24
hours, from E8.5 to E9.5, the OFT undergoes rapid elongation such that it acquires a
characteristic rightward curvature in a process known as cardiac looping (Fig.2)
(Buckingham et al., 2005; Kelly and Buckingham, 2002). This process of cardiac looping
has been described in both mouse and avian systems as well as in sections taken from
human embryos at equivalent Carnegie stages (Moorman et al., 2003). Maximal
elongation of the OFT is critical for appropriate cardiac looping so that the forming OFT
can be aligned appropriately between the left and the right ventricles. The OFT then
undergoes a caudal displacement to be aligned with the pharyngeal arches during
pharyngeal arch morphogenesis . After its caudal displacement and alignment with the
pharyngeal arches, the OFT is invaded by mesenchymal cells of the cardiac neural crest
(CNC) lineage between E10 and E12.5 (Hutson and Kirby, 2003; Waldo et al., 2005b).
The CNC cells are derived from the dorsal neural tube and they migrate through the 3 rd,
4th and 6th pharyngeal arches into the OFT, apposing the endocardial cells lining the OFT
5
myocardium. The CNC cells along with the endocardial cells undergoing an epithelial to
mesenchymal transition, form the cardiac cushions, which then spiral around to give rise
to the aorticopulmonary septum (APS). The formation of the APS converts the single
OFT vessel into the ascending aorta and pulmonary artery. In addition to their role in
septation, the CNC, in avian embryos, has been shown to be important in controlling the
proliferation as well as the recruitment of the SHF progenitors into the OFT.
Figure 2: Overview of OFT development in the mouse during early embryogenesis.
Red lines outline the developing OFT between E8.5 and E11.5. Right ventricle (RV), left
ventricle (LV), aorta (AO), pulmonary artery (PA), embryonic day (E). (Sinha and Wang)
(Hutson and Kirby, 2003; Hutson and Kirby, 2007; Sugishita et al., 2004b). Further,
lineage studies have shown that the CNC cells contribute not only to the APS but also to
the smooth muscle of the great arteries and the pharyngeal arch arteries (Jiang et al.,
2000a; Waldo et al., 2005b; Yelbuz et al., 2002). The septation of the OFT is
accompanied by the process of OFT rotation. Cell labeling studies in the chick and
genetic tracing experiments in the mouse have shown that the OFT undergoes a counter-
6
clockwise rotation such that myocardial cells from the inferior right side of the OFT will
eventually be present on the contra-lateral left side and will occupy the sub-pulmonary
myocardial domain. This rotation of the OFT is essential to align the pulmonary artery
and the ascending aorta with the right and left ventricles respectively to establish and
maintain the pulmonary and systemic circulatory systems, which are vital for survival in
the postnatal period (Bajolle et al., 2006; Waldo et al., 2005b). Finally, extensive
remodeling accompanied by hypoxia driven programmed cell death within the OFT result
in the compaction of the myocardium at the base of the pulmonary and aortic trunk to
allow for the muscularization of the proximal ventricular outlets (Sugishita et al., 2004a;
Sugishita et al., 2004b; Sugishita et al., 2004c). Additionally, the pharyngeal arch
arteries, which are initially present in bilateral pairs undergo asymmetric remodeling to
give rise to the aortic arch arteries and the ductus arteriosus.
The complexity of OFT morphogenesis is highly reflected in the frequency of
conotruncal anomalies in humans. A failure of either or both SHF and CNC development
and recruitment to the OFT accompanied with severe defects in the remodeling process
can result in a spectrum of OFT malformations such as Double Outlet Right Ventricle
(DORV), Transposition of the Great Arteries (TGA), which represent OFT alignment
defects and Persistent Truncus Arteriosus (PTA), which may result from an abnormal
septation of the OFT by the CNC (Fig.3). Several mouse models of these OFT
malformations have been generated and extensively characterized to understand the
pathogenesis of these defects and in turn provide avenues for the development of novel
diagnostic and therapeutic approaches (Bruneau, 2008; Moon, 2008).
7
The Second Heart Field (SHF)
The SHF originates in the anterior splanchnic mesoderm underlying the pharyngeal
endoderm and is initially present dorso-medially to the cardiac crescent / FHF (Fig.1).
Lineage studies in the mouse have shown that the SHF harbors the progenitors that will
give rise to the myocardium, the endocardium and the smooth muscle of the OFT, the
right ventricle, the interventricular septum, the atrial septum as well as of the atrium (Cai
et al., 2003; Goddeeris et al., 2007; Laugwitz et al., 2005; Verzi et al., 2005; Waldo et al.,
2005b). Only the apical part of the left ventricle is thought to be completely devoid of
SHF contribution (Aanhaanen et al., 2009; Buckingham et al., 2005).
Figure 3: A spectrum of conotruncal malformations. (A) Schematic showing the
positions of the great arteries (aorta, Ao and pulmonary artery, PA) relative to the
ventricles and to one another in the normal situation. When alignment/rotation of the
OFT does not occur properly, defects such
as complete transposition of the great arteries (B) or Double outlet RV with VSD (C)
occur. When the OFT does not septate, persistent truncus arteriosus occurs (D)o. The
case shown is the most severe type, in which the OFT is unseptated along its entire extent
and there is only a singe great vessel (TA). (Figure and text adapted from Moon 2008,
permission obtained from Elsevier)
8
As the linear heart tube forms, the progenitors in the SHF extend from the rostral
pharyngeal mesoderm to the caudal splanchnic mesoderm and are connected to both the
arterial and venous poles through which they contribute during looping morphogenesis.
Further, the SHF is patterned both along its medio-lateral and anterior-posterior axes
(Abu-Issa and Kirby, 2008). Extensive lineage analyses combined with fluorescent
labeling experiments in mouse and avian embryos have shown that the SHF progenitors
harbored in the anterior half of this splanchnic mesoderm are fated to give rise to the OFT
and the right ventricle at the arterial pole. This specific region has been further classified
as the anterior heart field (AHF) or the secondary heart field and is distinguished by the
expression of Fgf10 and an AHF specific enhancer of Mef2c (Goddeeris et al., 2007; Guo
et al.; Kelly et al., 2001; Mjaatvedt et al., 2001; Tirosh-Finkel et al., 2006; Waldo et al.,
2005b; Waldo et al., 2001; Zaffran et al., 2004). On the other hand, progenitor cells in the
posterior SHF mainly contribute to the atrial, atrial septal and venous pole myocardium.
However, the boundary between the anterior and posterior SHF is poorly defined and
needs to be characterized further (Dominguez et al.; Galli et al., 2008).
The major distinguishing features of the SHF cells from the linear heart tube are
their properties of continued proliferation and delayed differentiation which allows for
their gradual deployment to elongate the heart tube and promote looping morphogenesis
(Rochais et al., 2009b). Further, the proliferation of the SHF cells occurs most
prominently in a caudal proliferative center as has been identified in the avian embryo
from where the progenitors are gradually recruited towards both the poles of the heart
(van den Berg et al., 2009). It has been shown that the first wave of these SHF
progenitors to move towards the arterial pole prominently contribute to the OFT
myocardium followed by the second wave which primarily gives rise to the smooth
9
muscle of the great arteries (Waldo et al., 2005b). These critical properties of
proliferation and delayed differentiation of the SHF cells are controlled by extensive gene
regulatory and transcriptional networks that coordinate inputs from multiple signaling
networks between adjacent tissue types to maintain these progenitors in a specified state
(Fig.4). Various pro-proliferative and anti-differentiation signaling molecules and
transcription factors such as Fgf8, Fgf10, Isl1, Tbx1, Prdm1 and Six1 (Cai et al., 2003;
Chen et al.; Guo et al.; Ilagan et al., 2006; Kelly et al., 2001; Robertson et al., 2007) are
expressed in the early SHF to maintain the progenitors in an undifferentiated state. As
these progenitors proceed towards a more differentiated state, they exhibit the expression
of cardiac specific markers such as Nkx2.5, Gata4 and Mef2c (Verzi et al., 2005; Waldo
et al., 2001), and as they approach the heart, exposure to pro-differentiation BMP and
non-canonical Wnt signals has been shown to drive their terminal step into myocardial
differentiation (Hutson et al.; McCulley et al., 2008; Pandur et al., 2002). A precarious
balance between the proliferation and differentiation processes needs to be maintained so
that a threshold number of progenitors are continuously available for addition to the poles
of the heart. One of the ways that this balance is maintained is through the invasion of the
CNC cells through the pharyngeal arches which exert a braking influence on the
proliferative nature of FGF signaling, and are also subsequently involved in OFT
septation. The interactions between the CNC cells and the SHF progenitors are essential
for normal OFT morphogenesis as ablation of the CNC leads to a compromise in SHF
contribution to the OFT (Dyer et al.; Hutson et al.; Yelbuz et al., 2002). Finally several
other pathways, such as Hedgehog, canonical Wnt, Retinoic acid and non-canonical Wnt
have also been shown to play important roles during SHF development (Ai et al., 2007;
Bertrand et al.; Cohen et al., 2012; Cohen et al., 2007; David et al., 2008; Diman et al.;
10
Dyer and Kirby, 2009b; Garriock et al., 2005; Goddeeris et al., 2007; Hamblet et al.,
2002; Kioussi et al., 2002; Pandur et al., 2002; Park et al., 2008; Rochais et al., 2009b;
Sinha et al., 2012).
The Planar Cell Polarity (PCP) Pathway
The well known canonical Wnt signaling pathway governs cell fate decisions
during development and is activated by the binding of a secreted Wnt ligand to a Frizzled
receptor resulting β-catenin stabilization. On the other hand, the PCP pathway is a highly
conserved branch of the β-catenin-independent, non-canonical Wnt pathway that governs
cellular polarity and global tissue morphogenesis across multiple species (Fig.5). The
PCP pathway was first identified in Drosophila and was shown to regulate the polarity of
cells in the plane of the epithelium perpendicular to the cellular apical-basal axis, as
observed in the precise arrangement of the hair in the wing epithelium and of the
ommatidia in the retinal epithelium (Axelrod et al., 1998a; Boutros et al., 1998a;
Klingensmith et al., 1996; Winter et al., 2001). In vertebrates like Xenopus and zebrafish,
PCP plays a critical role during convergence and extension tissue morphogenesis by
controlling the medio-laterally oriented intercalation and directional migration of
mesodermal cells (Jessen et al., 2002; Wallingford et al., 2000). Moreover, both these
properties of the PCP pathway of regulating cellular polarity as well as coordinating
tissue morphogenesis have been co-opted in mammalian embryos as shown by its role in
11
Figure 4: Transcriptional and signaling networks involved in SHF development.
Scheme showing the network of major signaling pathways and regulatory genes
impacting on progressive second heart field development during the transition from
proliferating progenitor cell (top) to differentiated cardiomyocyte (bottom). Note the
central position of Isl1 and Tbx1 in regulating the proliferative progenitor cell state (top),
the pivotal position of FGF/BMP antagonism in controlling the balance between
proliferation and differentiation (middle), and the activation of the cardiomyogenic
program by a network of interacting transcription factors (bottom). Gray lines, direct
protein interactions; dotted lines, microRNA silencing. (Adapted from Kelly 2012,
permission obtained from Elsevier)
12
controlling the polarized arrangement of stereocilia in the cochlea and in mediating
neurulation, axial elongation and various aspects of organogenesis, respectively. The
disruption of PCP signaling in mice results in mis-oriented stereociliary bundles in the
sensory hair cells of the cochlea, open neural tube as well as defects in skeletogenesis,
highlighting the significance of PCP signaling during embryogenesis (Ai et al., 2007;
Murdoch et al., 2001; Qian et al., 2007; Wang et al., 2006a; Wang et al., 2005).
Figure 5: Schematic overview of canonical Wnt and Planar Cell Polarity pathways
during development. (Sinha and Wang)
13
At the interface of both the canonical Wnt and the PCP pathway, lies the
cytoplasmic scaffolding protein Disheveled (Dvl). Disheveled proteins are a multi-gene
family in mammals and are made up of three homologues, Dvl1, Dvl2 and Dvl3, which
show functional redundancy. In addition to transducing canonical Wnt signals, Dvl, along
with certain Frizzled receptors and Wnt ligands, can participate in the PCP pathway by
interacting with a distinct set of core PCP proteins such as Van gogh/Van gogh-like
(Vang/Vangl), Prickle, Diego and Flamingo (Fig.5) (Etheridge et al., 2008; Wallingford
and Habas, 2005; Wang et al., 2006a). One of the ways it does so is through the Dvlmediated activation of a novel formin homology protein Daam1 (Disheveled associated
activator of morphogenesis 1) to regulate actin polymerization and consequently
influence cell morphology and cell behavior, which may also require signaling through
the small GTPases Rho/Rac/CDC42(Habas et al., 2003; Habas et al., 2001; Liu et al.,
2008; Veeman et al., 2003). Further, the pathway specificity of Dvl in mediating either
the canonical or the non-canonical Wnt branches depends on signal transduction through
its specific domains. The Dvl protein has three conserved domains, DIX, PDZ and DEP.
Studies in flies, Xenopus and mice have shown that the DIX domain is required for the
canonical Wnt pathway whereas the DEP domain is necessary for the PCP pathway (Ai et
al., 2007; Park et al., 2005; Wallingford and Habas, 2005; Wallingford et al., 2000; Wang
et al., 2006a; Wang et al., 2005).
The activation of PCP signaling in vertebrates during convergent extension tissue
morphogenesis has been shown to be initiated through the two main non-canonical Wnt
ligands, Wnt5a and Wnt11. The characterization of these ligands as non-canonical was
based on their inability to stabilize β-catenin or to transform certain cultured mammalian
cells into a cancerous phenotype, in contrast to the responses obtained by treatment with
14
Wnt1 or Wnt3a (Wong et al., 1994) . Additionally, disrupting the expression of these
ligands in Xenopus and zebrafish results in characteristic convergent extension defects
reminiscent of those observed due to perturbations of other PCP signaling components
(Heisenberg et al., 2000; Kilian et al., 2003; Tada and Smith, 2000; Wallingford et al.,
2001). Wnt5a can also signal through a family of receptor tyrosine kinases, Ror1/Ror2 to
regulate both the PCP and another branch on non-canonical Wnt signaling, the
Wnt/Ca2+pathway during tissue morphogenesis (Ho et al.; Nishita et al.; Ryu et al.) .
Another way through which Wnt5a mediated non-canonical Wnt signaling has been
shown to mediate its effects is by antagonizing the canonical Wnt pathway; loss of Wnt5a
in mice can result in a context specific stabilization of β-catenin and the consequent
upregulation of canonical Wnt target genes (Mikels and Nusse, 2006; Roarty et al., 2009;
Topol et al., 2003).
Extensive evidence exists for a well-defined biphasic role for canonical Wnt
signaling during cardiac development: initially in the specification of the earliest cardiac
progenitors followed by a role in maintaining the proliferative and undifferentiated state
of these progenitors. Disruption of canonical Wnt pathway components has been shown
to perturb the gene regulatory networks involved during cardiogenesis and results in
profound defects in heart formation, especially in SHF development (Ai et al., 2007;
Cohen et al., 2007; Kwon et al., 2007; Kwon et al., 2009; Lin et al., 2007; Manisastry et
al., 2006; Rochais et al., 2009b). Mouse mutants for various PCP genes such as Vangl2,
Wnt5a, Wnt11 and Dvl1/2 also present with a spectrum of outflow tract malformations in
the form of DORV, PTA, TGA and aortic arch interruptions. Studies to delineate how the
PCP pathway is involved in the pathogenesis of these defects have identified a role for
PCP signaling within the OFT itself (Hamblet et al., 2002; Henderson et al., 2001;
15
Phillips et al., 2005; Phillips et al., 2007; Schleiffarth et al., 2007; Zhou et al., 2007).
Additionally, work from our lab has also shown that Dvl2-mediated PCP signaling is
required specifically in the SHF, outside of the OFT (Sinha et al., 2012).
Finally, in spite of intensive research on the PCP pathway in the past twenty-five
years, a reliable downstream molecular pathway to conclusively show its activation or
inhibition still remains elusive and warrants the development of novel tools and
technologies.
16
2. DISHEVELED MEDIATED PLANAR CELL POLARITY SIGNALING IS
REQUIRED IN THE SECOND HEART FIELD LINEAGE FOR
OUTFLOW TRACT MORPHOGENESIS
by
Tanvi Sinha, Bing Wang, Sylvia Evans, Anthony Wynshaw-Boris, Jianbo Wang
Developmental Biology 370(1):135-44
Copyright
2012
by
Elsevier Inc.
Used by permission
Format adapted and errata corrected for dissertation
17
Abstract:
Disheveled (Dvl) is a key regulator of both the canonical Wnt and the planar cell polarity
(PCP) pathway. Previous genetic studies in mice indicated that outflow tract (OFT)
formation requires Dvl1 and 2, but it was unclear which pathway was involved and
whether Dvl1/2-mediated signaling was required in the second heart field (SHF) or the
cardiac neural crest (CNC) lineage, both of which are critical for OFT development. In
this study, we used Dvl1/2 null mice and a set of Dvl2 BAC transgenes that function in a
pathway-specific fashion to demonstrate that Dvl1/2-mediated PCP signaling is essential
for OFT formation. Lineage-specific gene ablation further indicated that Dvl1/2 function
is dispensable in the CNC, but required in the SHF for OFT lengthening to promote
cardiac looping. Mutating the core PCP gene Vangl2 and non-canonical Wnt gene Wnt5a
recapitulated the OFT morphogenesis defects observed in Dvl1/2 mutants. Consistent
with genetic interaction studies suggesting that Wnt5a signals through the PCP pathway,
Dvl1/2 and Wnt5a mutants display aberrant cell packing and defective actin
polymerization and filopodia formation specifically in SHF cells in the caudal splanchnic
mesoderm (SpM), where Wnt5a and Dvl2 are co-expressed. Our results reveal a critical
role of PCP signaling in the SHF during early OFT lengthening and cardiac looping and
suggest that a Wnt5a Dvl PCP signaling cascade may regulate actin polymerization
and protrusive cell behavior in the caudal SpM to promote SHF deployment, OFT
lengthening and cardiac looping.
Key Words: planar cell polarity; second heart field; outflow tract; heart development;
morphogenesis.
18
Introduction:
Outflow tract (OFT) malformation is one of the most common congenital heart
defects in humans (Hoffman and Kaplan, 2002; Samanek, 2000). The OFT, initially a
single vascular conduit linking the right ventricle and aortic sac, is septated later into the
aorta and pulmonary artery that connect with the left and right ventricles, respectively.
Defects in OFT septation lead to persistent truncus arteriosus (PTA), while its
misalignment with the ventricles causes double outlet right ventricle (DORV), overriding
aorta or transposition of the great arteries. Lineage studies show that the OFT does not
arise from expansion of the initial heart tube (also known as the first heart field (FHF),
but is added later from the second heart field (SHF) cells in the pharyngeal and
splanchnic mesoderm (SpM) (Cai et al., 2003; Dyer and Kirby, 2009a; Kelly et al., 2001;
Ma et al., 2008; Mjaatvedt et al., 2001; Verzi et al., 2005; Waldo et al., 2001; Zhu et al.,
2008). Recent studies further suggest that the FHF and SHF originate from a contiguous
population of mesodermal progenitors, but differ in the timing of their contribution to the
heart (Dyer and Kirby, 2009a; Ma et al., 2008). The FHF reflects the first wave of
mesodermal cells that differentiate to form the initial heart tube, whereas the SHF cells
remain as rapidly proliferating progenitors that undergo gradual differentiation and
deployment to the heart (Dyer and Kirby, 2009a).
A critical balance between proliferation, differentiation and deployment has to be
maintained in the SHF to ensure that a threshold number of descendents can be added to
the OFT to drive its rapid elongation during cardiac looping (Black, 2007; Dyer and
Kirby, 2009a; Zhu et al., 2008). Sufficient OFT lengthening is essential for proper
cardiac looping to reposition the OFT above the interventricular septum so that upon the
19
induction of OFT septation by cardiac neural crest (CNC) cells, the aorta can be
connected to the left ventricle (Dyer and Kirby, 2009a; Zhu et al., 2008). Events that
compromise the contribution of the SHF cells to the OFT may not only cause alignment
defects, but may also perturb the septation process (Black, 2007; Dyer and Kirby, 2009a;
Kirby, 2008; McCulley et al., 2008; Theveniau-Ruissy et al., 2008; Zhu et al., 2008).
Studies from many groups have delineated elegantly how proliferation and differentiation
in the SHF can be coordinately regulated by a transcriptional network (Black, 2007;
Zhang et al., 2006) that integrates signaling input from pathways including Fgf, Tgf-β,
Bmp, Shh, Wnt, Notch and Retinoic acid (Cohen et al., 2007; Dyer and Kirby, 2009b;
High et al., 2009; Ilagan et al., 2006; Kwon et al., 2009; Lin et al., 2007; McCulley et al.,
2008; Park et al., 2008; Rochais et al., 2009a; Zhu et al., 2008). In contrast, what governs
the deployment of SHF cells to the OFT remains largely unknown.
In this study, we provide evidence that the planar cell polarity (PCP) pathway is
required in the SHF lineage for early OFT morphogenesis and cardiac looping, and may
play a key role in the deployment of SHF cells from the SpM to the OFT. A branch of the
β-catenin independent non-canonical Wnt pathway, the PCP pathway is required for
coordinating cellular polarity in the plane of the epithelium in flies (Zallen, 2007) and
polarized cell intercalation or migration during convergent extension (CE) tissue
morphogenesis in Xenopus and zebrafish (Heisenberg et al., 2000; Keller, 2002;
Wallingford et al., 2000; Yin et al., 2008). This pathway mediates its effects through
several components shared with the canonical Wnt pathway, including the Frizzled (Fz)
receptor and cytoplasmic protein Disheveled (Dvl), along with a distinct set of core PCP
proteins including Van Gogh (Vangl in mammals). During CE, PCP signaling regulates
20
cell morphology and protrusive activity by modulating cytoskeletal organization and
dynamics (Keller, 2002; Khadka et al., 2009; Wallingford et al., 2000). Two noncanonical Wnts, Wnt5a and Wnt11, are required to activate PCP signaling during CE in
frogs and zebrafish (Heisenberg et al., 2000; Kilian et al., 2003). In mice, we and others
have found previously that mammalian core PCP proteins, including Dvl1/2/3, Fz3/6 and
Vangl1/2, are essential for tissue morphogenesis in the neural plate, inner ear, skin and
limb (Devenport and Fuchs, 2008; Etheridge et al., 2008; Torban et al., 2008; Wang et
al., 2011; Wang et al., 2006a; Wang et al., 2005; Wang et al., 2006b; Ybot-Gonzalez et
al., 2007). Genetic studies suggest that Wnt5a may regulate PCP signaling during neural
plate and limb morphogenesis in mice (Qian et al., 2007; Wang et al., 2011).
During mouse OFT formation, Wnt5a and Vangl2 have been suggested to
function in the CNC and OFT cardiomyocytes, respectively (Phillips et al., 2005;
Schleiffarth et al., 2007). Their roles in the SHF, however, have been unclear. Previously,
we found that mouse Dvl genes are also critical for OFT development (Etheridge et al.,
2008; Hamblet et al., 2002). In light of the central role of Dvl in both the canonical Wnt
and the PCP pathway, we performed pathway- and tissue-specific mutagenesis of Dvl2 in
this study and uncovered a key role of Dvl2-mediated PCP signaling in the SHF. In
conjunction with additional genetic, morphometric and histological analysis in Dvl1/2,
Vangl2 and Wnt5a mutants, we propose a novel model in which Wnt5a-activated PCP
signaling induces a mesenchymal to epithelial conversion in the caudal SpM to promote
SHF deployment, OFT morphogenesis and cardiac looping.
Methods:
21
Mouse strains and genotyping
Wnt5a and Vangl2 mutant mice were obtained from the Jackson Laboratory and
genotyped as described (Murdoch et al., 2001; Yamaguchi et al., 1999a). Genotyping of
the other mouse strains used in the study has been described previously: Dvl1 (Lijam et
al., 1997) and Dvl2 (Hamblet et al., 2002); Dvl2 BAC transgenes (Wang et al., 2006a);
Islet1-Cre (Cai et al., 2003) and Wnt1-Cre (Jiang et al., 2000b).
Animal care and use was in accordance with NIH guidelines and was approved by the
Animal Care and Use Committee of the University of Alabama at Birmingham.
Embryo collection, imaging and quantification of OFT length
Embryos derived from appropriate crosses were dissected between embryonic days (E)
9.5 to E18.5 and yolk sac was retained for PCR genotyping. Embryos were fixed in 4%
paraformaldehyde at 4°C overnight and stored in 70% ethanol.
To quantify the length of the OFT, fixed E9.5 embryos between 24-26 somites were
imaged with their right side facing up using a Leica MZ16FA stereoscope equipped with
a DFC490 CCD camera. To determine the OFT length, the LAS Interactive Measurement
Software Module was utilized to draw and quantify the length of a continuous line along
the inner curvature of the OFT from the distal end to the proximal border with the right
ventricle (as shown by a red line in Fig. 3A). Statistical analyses were performed using
two-tailed Student’s t-test.
Hearts from E11.5 and E18.5 embryos were dissected out and imaged prior to embedding
and histological sectioning.
Quantitative real-time PCR
22
OFT and SpM were micro-dissected from 3 E9.5 wild-type embryos. Samples were
pooled and lysed with Trizol reagent (Invitrogen) to collect total RNA. Quantitative realtime PCR was performed as described previously (Wang et al., 2011). GAPDH was used
to normalize gene expression. cDNA samples from 3 sets of embryos were tested, and
each cDNA sample was tested in replicate.
Primers used were:
GAPDH
(TGAAGGTCGGAGTCAACGGATTTGGT;
AAATGAGCCCCAGCCTTCTCCATG);
Dvl2 (AGCAGTGCCTCCCGCCTCCTCA; CCCATCACCACGCTCGTTACTTTG).
Histology, in situ hybridization and immuno-histochemistry
Fixed embryos and heart tissue were properly oriented in Histogel (Thermo/Fisher,
Pittsburgh,PA) and processed for paraffin embedding, or were processed through sucrose
gradients and embedded in OCT (Tissue-Tek/Sakura, Torrance, CA) for cryo-sectioning.
Paraffin–embedded samples were sectioned at 7um and stained with Hematoxylin &
Eosin (H&E) to examine histology. OCT embedded samples were cryo-sectioned at
25um, air-dried at room temperature, fixed with 4%PFA, permeabilized with PbTX
(0.1% Tween in PBS) and stained with Phalloidin-TRITC (Sigma, St.Louis, MO ).
Fluorescence immuno-histochemistry was performed on paraffin sections as described
(Wang et al., 2011). Primary antibodies used were anti-CleavedCaspase-3 (Asp175) (Cell
Signaling, Danvers, MA) and anti pHH3 (Ser10) (Millipore, Billerica, MA). Alexa Fluor
488-conjugated goat anti-rabbit IgG (Invitrogen, Carlsbad,CA) was used as secondary
antibody.
A
tyramide
signal
amplification
kit
(PerkinElmer,
Covina,
CA,
#NEL741E001KT) was used for anti-Cleaved Caspase-3 detection. All fluorescent and
23
confocal images were acquired with an Olympus FV1000 Laser Confocal Scanning
microscope and were subsequently analyzed using the FV10-ASW software. Wholemount in situ hybridization was carried out with a standard protocol (Wilkinson and
Nieto, 1993).
24
Results:
Dvl-mediated PCP signaling is critical for OFT development
The three mouse Dvl genes, Dvl1, 2 and 3, display a broad and overlapping
expression pattern. We previously reported that mice carrying null mutations in Dvl1
(Dvl1-/-) are viable (Lijam et al., 1997); but Dvl2 null mutants (Dvl2-/-) display partially
penetrant neonatal lethality and OFT defects, primarily in the form of DORV and PTA
(Hamblet et al., 2002). Deleting both Dvl1 & 2 in mice (Dvl1-/-; Dvl2-/-) increases the
penetrance of DORV and PTA to 100% (Fig. 2C), suggesting that Dvl1 and 2 have
redundant function during OFT formation. Dvl1-/-; Dvl2-/- mutants also develop three
additional defects not observed in each single mutant: i) randomized stereocilia
orientation in the inner ear sensory hair cells; ii) shortened cochlea; and iii) failure to
close the entire neural tube (Hamblet et al., 2002; Wang et al., 2006a). Our previous
studies concluded that the last three defects are due to disruption of Dvl-mediated PCP
signaling (Wang et al., 2006a; Wang et al., 2005), but the cause of the OFT defects
remained unclear.
To determine the cause of the OFT defects in Dvl1-/-; Dvl2-/- mutants, we first
determined the Dvl-mediated pathway(s) disrupted in the mutants. Dvl has three
conserved domains, DIX, PDZ and DEP (Fig. 1A) and studies in various model
organisms have indicated that the DIX domain is only required for the canonical Wnt
pathway while the DEP domain is only required for the PCP pathway (Axelrod et al.,
1998b; Boutros et al., 1998b; Wallingford et al., 2000). Therefore, we could determine
the signaling pathway underlying the OFT defect in Dvl1/2 mutants using a set of Dvl2
domain mutations established previously by BAC (bacterial artificial chromosome)
25
recombineering and transgenesis. BAC transgenes are known to faithfully recapitulate
endogenous gene expression patterns and levels because of their large size and low copy
number when inserted into the genome (Lee et al., 2001). Hence, each of the transgenes
in the Dvl2 BAC allelic series can function in either both or the Wnt or PCP signaling
pathways to complement the loss of endogenous Dvl2.
As illustrated in Fig. 1A, the Dvl2 BAC allelic series consists of a wild-type BAC
(Dvl2-EGFP2), two domain-deletion mutants (
-EGFP and
-EGFP) and a
point mutation (dsh1-EGFP). In the wild-type BAC Dvl2-EGFP2, the Dvl2 coding
region is intact, but an EGFP cDNA is inserted in-frame following the last codon of Dvl2,
generating a fully functional Dvl2-EGFP fusion protein that allowed us to study the
localization of Dvl2 in the neural tube and inner ear previously (Wang et al., 2006a;
Wang et al., 2005). In addition, this Dvl2-EGFP2 BAC allele contained two LoxP sites
(one in intron2 and one behind exon15, blue triangles in Fig. 1A), resulting in a floxed
(LoxP flanked), conditional BAC allele. When crossed into Dvl1-/-; Dvl2-/- mutants, Dvl2EGFP2 fully complemented the cochlear and neural tube defects and rescued them to
fertile adults(Wang et al., 2006a). Not surprisingly, the Dvl2-EGFP2 transgene could
also rescue the OFT defects in E18.5 Dvl1-/-; Dvl2-/- mutants (Fig. 1B, n=8; histological
analysis of Dvl1-/-;Dvl2-/-; Dvl2-EGFP2 hearts at E18.5 – Fig. 2H), indicating that the
wild-type Dvl2-EGFP2 BAC transgene could fully substitute for all endogenous Dvl2
function.
We then used the ∆DEP-EGFP BAC transgene to test whether the DEP domain,
important only for PCP signaling, is required for rescuing the OFT defect in Dvl1-/-; Dvl226
/-
mutants. ∆DEP-EGFP deletes the entire DEP domain (aa442-736) and an identical
mutant in Xenopus cannot function in CE, but still activates canonical Wnt signaling
(Wallingford et al., 2000). Our previous studies also indicate that ∆DEP-EGFP abolishes
PCP signaling during neural tube closure in mice. When we crossed ∆DEP-EGFP into
Dvl1-/-; Dvl2-/- mutants and examined the hearts of Dvl1-/-; Dvl2-/-;∆DEP-EGFP embryos
at E18.5, we recovered the OFT defect, DORV, identical to Dvl1-/-; Dvl2-/- mutants
(compare Fig. 1D to Fig. 2C, n=6), indicating that the DEP domain, and therefore Dvlmediated PCP signaling, is required for rescuing the OFT defects in Dv1/2 mutants.
To further confirm this finding, we used the dsh1-EGFP BAC transgene that
contains a point mutation leading to a K to M substitution at aa446 (Fig. 1A). In flies, this
mutation specifically abolishes PCP signaling but leaves Wnt signaling intact (Axelrod et
al., 1998b; Boutros et al., 1998b) and we demonstrated previously that in mice, this
mutation also abolished PCP signaling in the inner ear and during neurulation (Wang et
al., 2006a). When we bred dsh1-EGFP into Dvl1-/-; Dvl2-/- mutants, we found that it also
failed to rescue the OFT defects (Fig. 1E, n=5), confirming that the OFT defect in Dvl1/2
mutants is due, at least in part, to disruption of PCP signaling.
To test whether dsh1-EGFP can rescue the partially penetrant OFT defects in
Dvl2-/- single mutants, we crossed Dvl2+/-; dsh1-EGFP to Dvl2-/- mice. In the progeny, we
found that 73% of Dvl2-/- mutants survived to weaning (66 expected; 48 recovered); but
surprisingly, only 18% of the expected Dvl2-/-; dsh1-EGFP mutants survived to weaning
(66 expected; 12 recovered). Heart dissection and sectioning at E18.5 revealed DORV in
21% of Dvl2-/- mutants (3 out of 14 embryos, data not shown) and in 70% of Dvl2-/-; dsh1
27
mutants (5 out of 7 embryos, data not shown), indicating that dsh1 exerted a dominant
negative effect during OFT development. We reason that the mutant dsh1 protein may be
able to interact with most of the molecular partners of Dvl, but the complexes containing
dsh1 cannot function properly in the PCP pathway, thus antagonizing the activity of
remaining Dvl1 or 3. Collectively, these results indicate an essential role of Dvl-mediated
PCP signaling in OFT development.
Finally, we used the ∆DIX-EGFP BAC transgene to assess whether perturbation of
canonical Wnt signaling may also contribute to the OFT defects in Dvl1-/-; Dvl2-/- mutants.
∆DIX-EGFP deletes part of the DIX domain (aa67-159) essential for Wnt signaling
(Capelluto et al., 2002), but retains the ability to mediate PCP signaling during mouse
neural tube closure (Wang et al., 2006a). When crossed into Dvl1-/-; Dvl2-/- mutants,
∆DIX-EGFP was able rescue the OFT defects at E18.5 (Fig. 1C, n=8) and the lethality at
perinatal stage (6 Dvl1-/-; Dvl2-/-; ∆DIX-EGFP mutants recovered at weaning, 6 expected),
indicating that restoring only PCP signaling activity is sufficient to rescue the OFT defect
in Dvl1-/-; Dvl2-/- mutants. Together, these data indicate that the OFT defect in Dvl1-/-;
Dvl2-/- mutants is solely due to disruption of the PCP pathway.
Dvl2 is required in the SHF but not the CNC lineage during OFT development
Since, both the SHF (Cai et al., 2003; Kelly et al., 2001; Verzi et al., 2005; Waldo
et al., 2001; Zhu et al., 2008) and the CNC (Snider et al., 2007; Waldo et al., 2005a)
lineage are essential for OFT development, we performed tissue specific gene-ablation
28
using the Dvl2-EGFP2 BAC transgene to determine which lineage requires Dvl1/2
function.
Dvl2-EGFP2 contains two LoxP sites flanking exons 3 and 15 and hence, we
predicted that Cre mediated recombination could inactivate the transgene by deleting all
exons from 3 to 15, including the entire 3’ UTR (Fig. 2A). Using a ubiquitously
expressed EIIa-Cre transgene(Lakso et al., 1996) and 3 primers surrounding the two
LoxP sites, we confirmed that Dvl2-EGFP2 could indeed be efficiently recombined as
predicted (Fig. 2B).
To inactivate both Dvl1 and 2 only in the CNC, we crossed Dvl1-/-; Dvl2-/-; Dvl2EGFP2 mice with Dvl1-/-; Dvl2+/-; Wnt1-Cre mice that expressed Cre in all CNC
progenitors in the dorsal neural tube(Jiang et al., 2000b). We found normal OFT
formation in the hearts of Dvl1-/-; Dvl2-/-; Dvl2-EGFP2; Wnt1-Cre embryos at E18.5
(n=5, Fig. 2E). This finding was further confirmed by histological sectioning of Dvl1-/-;
Dvl2-/-; Dvl2-EGFP2; Wnt1-Cre embryonic hearts at E18.5 which clearly showed that the
aorta was connected to the left ventricle as in the rescued Dvl1-/-; Dvl2-/-; Dvl2-EGFP2
embryos (Compare Fig. 2H and 2I). Furthermore, over 95% of Dvl1-/-; Dvl2-/-; Dvl2EGFP2; Wnt1-Cre mice survived beyond weaning (26 expected, 25 recovered, Table 1).
Therefore, deleting both Dvl1 and 2 only in the CNC lineage is not sufficient to
recapitulate the OFT defect observed in Dvl1-/-; Dvl2-/- null mutants.
In contrast, in parallel crosses where we used Islet1-Cre (Isl1-Cre) that expressed
Cre in SHF progenitors in the pharyngeal and splanchnic mesoderm (Cai et al., 2003; Ma
29
et al., 2008; Sun et al., 2007), we recovered OFT defects in Dvl1-/-; Dvl2-/-; Dvl2-EGFP2;
Islet1-Cre embryos at E18.5 (8 mutants recovered, 4 with DORV and 4 with PTA;
representative PTA shown in Fig. 2F and 2J). The variation observed in the expressivity
of the OFT defects in the form of either DORV or PTA may be due to the maintenance of
the mutant strains in a mixed 129Sv/C57 background.
Moreover, consistent with OFT defects as the cause of lethality, only 8% of Dvl1/-
; Dvl2-/-; Dvl2-EGFP2; Islet1-Cre mutants survived to weaning (25 expected, 2
recovered, Table 1), and these survivors were likely due to incomplete inactivation of
Dvl2-EGFP2 by Isl1-Cre (Ma et al., 2008). Collectively, the tissue specific gene-ablation
experiments indicate that Dvl1/2 function is required in the SHF, but not the CNC,
lineage for proper OFT development.
Dvl1/2 mutants display defects in early OFT morphogenesis and cardiac looping
To further investigate how the OFT defect arose in Dvl1-/-; Dvl2-/- (Dvl1/2)
mutants, we examined their heart morphology at different stages of development. By
E9.5, the OFT in Dvl1-/-; Dvl2-/- and Dvl1-/-; Dvl2-/-; Dvl2-EGFP2; Isl1-Cre mutants
already lacked the rightward curve apparent in wild-type embryos (green arrows and
traced by red lines in Fig. 3A&B and data not shown), suggesting aberrant cardiac
looping. Consistent with this idea, in frontal views, the right ventricle was located higher
than the left ventricle (red line, Fig. 3F) in Dvl1-/-; Dvl2-/-; Dvl2-EGFP2; Isl1-Cre
mutants, while in wild-type the two ventricles were on the same horizontal plane (red
line, Fig. 3E). At E11.5, the right ventricle in Dvl1-/-; Dvl2-/- and Dvl1-/-; Dvl2-/-; Dvl2EGFP2; Isl1-Cre mutants eventually descended to the same level as the left ventricle, but
an apparently shorter OFT was aligned with only the right ventricle; while in wild-type
30
embryos, the OFT was situated over the inter-ventricular septum (compare Fig. 4A&B
and Fig. 4E&F, data not shown). The mis-alignment of OFT is therefore the most likely
cause of DORV during subsequent OFT remodeling and septation in Dvl1/2 mutants.
PCP gene Vangl2 and non-canonical Wnt gene Wnt5a are also required for proper
cardiac looping
To further characterize the role of PCP signaling in early OFT morphogenesis, we
examined Looptail (Vangl2Lp) mice (Kibar et al., 2001; Murdoch et al., 2001) carrying a
mutation in Vangl2, one of the two Vang homologs in mice. Vangl2Lp/Lp homozygotes are
also known to display DORV (Henderson et al., 2001). When we examined Vangl2Lp/Lp
mutants at E9.5, we found that their OFTs also lacked the rightward curve (Fig. 3C) and
displayed aberrant cardiac looping (Fig. 3G), similar to Dvl1/2 mutants.
PCP signaling in frogs and zebrafish requires non-canonical Wnt ligand Wnt5a
(Kilian et al., 2003; Wallingford et al., 2001). In mice, null mutation of Wnt5a (Wnt5a-/-)
causes PTA or DORV (Schleiffarth et al., 2007). Our examination of E9.5-11.5 Wnt5a-/mutants revealed cardiac looping defects similar to those in Dvl1/2 and Vangl2 mutants
(Fig. 3D and data not shown), suggesting that aberrant cardiac looping may also
contribute to the OFT defects in Wnt5a mutants.
Aberrant cardiac looping in mouse PCP mutants is associated with OFT shortening
A previous study on Vangl2Lp/Lp mutants attributed the abnormal cardiac looping
to neural tube closure and axial rotation defects (Henderson et al., 2001). However, in
both Dvl1-/-; Dvl2-/-; Dvl2-EGFP2; Isl1-Cre and Wnt5a-/- mutants, neural tube closure and
31
axial rotation are normal, yet aberrant cardiac looping persists (Fig. 3D&F). To explore
alternative causes for the looping defects, we assessed OFT length since maximal OFT
extension is critical for cardiac looping and proper OFT alignment (Rochais et al., 2009b;
Sugishita et al., 2004b; Yelbuz et al., 2002; Zhu et al., 2008). When we measured the
OFT length along the inner curvature (from the distal end of the OFT to the border
between the OFT and the right ventricle) at E9.5 (24-26 somites), we found a significant
shortening of the OFT in each mutant, with Wnt5a mutants more severe than Dvl1/2 and
Vangl2 mutants (Fig. 3I; wild-type: 1.01 + 0.04 mm, Dvl1-/-; Dvl2-/-: 0.76+ 0.07 mm,
Vangl2Lp/Lp: 0.77+ 0.03 mm, Wnt5a-/-: 0.70+ 0.07, p<0.01 between wild-type and each
mutant). Therefore, our morphometric analyses indicate that the cardiac looping defect in
mouse PCP mutants is correlated with OFT shortening.
Vangl2 and Wnt5a genetically interact during OFT development
While the signaling mechanism of Wnt5a in mammals has been controversial, the
similar OFT shortening and looping defects in Wnt5a, Dvl1/2 and Vangl2 mutants
suggest that Wnt5a may function through the PCP pathway during early OFT
morphogenesis. To test this hypothesis, we studied the genetic interaction between
Vangl2 and Wnt5a. We found that reducing the dosage of Wnt5a by 50% significantly
enhanced both the cardiac looping and OFT shortening defects in Vangl2Lp/Lp mutants,
indicating genetic interaction between Wnt5a and Vangl2. In E9.5 Vangl2Lp/Lp; Wnt5a+/mutants, the right ventricle was located almost vertically on top of the left ventricle
(compare Fig. 3H to 3G), and the OFT was also shortened significantly when compared
to Vangl2Lp/Lp mutants (Fig. 3I, 0.69+ 0.04 mm in Vangl2Lp/Lp; Wnt5a+/- vs. 0.77+ 0.03
mm in Vangl2Lp/Lp; p=0.02). In E11.5 Vangl2Lp/Lp; Wnt5a+/- mutants, the right ventricle
32
was still higher than the left ventricle and the OFT was aligned solely with the right
ventricle (compare Fig. 4C and 4D). The genetic interaction between Wnt5a and Vangl2
supports the hypothesis that Wnt5a signals through the PCP pathway during early OFT
morphogenesis.
Wnt5a expression is restricted in the caudal domain of the SHF splanchnic mesoderm,
overlapping with Dvl2-EGFP
To investigate how Wnt5a-initiated PCP signaling might regulate early OFT
morphogenesis, we analyzed Wnt5a expression by in situ hybridization. Between E9.0 to
10.5, Wnt5a was highly expressed in the caudal region of the SHF splanchnic mesoderm
(SpM) (green arrow, Fig. 5A, also see ref. (Chen et al., 2012; Schleiffarth et al., 2007;
Yamaguchi et al., 1999a)) and in the anterior region of the first and second pharyngeal
arches, but interestingly, not within the OFT or the rest of the heart proper.
We also examined the expression of the Dvl2-EGFP2 BAC transgene capable of
fully replacing endogenous Dvl2 (Fig. 1B & 2D). At E9.5, Dvl2-EGFP was expressed
highly in the SpM (red arrow in Fig. 5B) and pharyngeal arches, but at much lower level
in the OFT. To determine whether endogenous Dvl2 is also differentially expressed in the
SpM and OFT, we performed quantitative RT-PCR using micro-dissected SpM and OFT
from E9.5 embryos. Our results indicate that endogenous Dvl2 expression in the SpM is
also over four fold higher than that in the OFT (Fig. 5C).
33
Histological defects in the SHF SpM in Wnt5a and Dvl1/2 mutants
The overlapping expression pattern of Wnt5a and Dvl2-EGFP prompted us to
carry out extensive analysis to identify the defects that could contribute to early OFT
shortening in Wnt5a-/- and Dvl1-/-; Dvl2-/- mutants. Examination of phospho-Histone H3
and cleaved caspase 3 staining at E9.5 revealed no difference in cell proliferation or
apoptosis rates in the mutant OFT or the SHF splanchnic and pharyngeal mesoderm,
suggesting that the OFT shortening is not caused by cell proliferation or apoptosis defects
in the OFT or the SHF (supplemental Fig. 1).
Interestingly, when we examined H&E (hematoxylin and eosin) stained sagittal
sections of E9.5 embryos, we found an unusual histological abnormality in the caudal
SpM of both Wnt5a and Dvl1-/-; Dvl2-/- mutants. In E9.5 wild-type embryos, the caudal
SpM dorsal and anterior to the inflow tract (IFT) consisted of loosely packed
mesenchyme adjacent to a cohesive, epithelial-like sheet (black box in Fig. 5D and
enlarged view in 5J). Rostrally, the epithelial sheet gradually gained a single-layered,
columnar character and became contiguous with the OFT, while the loosely packed
mesenchyme became sparse (yellow box in Fig. 5D and enlarged view in Fig. 5G). The
rostral SpM of Wnt5a-/- and Dvl1-/-; Dvl2-/- mutants appeared similar to that in the wildtype (compare yellow-boxed area in Fig. 5D to Fig. 5E&F and enlarged view in Fig. 5G
to Fig. 5H&I), but in the caudal SpM of both mutants, SHF progenitor cells aggregated
into compact clusters instead of forming an epithelial-like sheet as in the wild-type
(compare black-boxed area in Fig. 5D to Fig. 5E&F and enlarged view in Fig. 5J to Fig.
5K&L).
34
The aberrant cell packing in the caudal SpM of Wnt5 and Dvl1/2 mutants
coincides with Wnt5a expression in this region (Fig. 5A). To characterize this
abnormality further, we performed confocal scanning microscopy on the H&E stained
sections, taking advantage of the fact that Eosin can emit strong fluorescence upon laser
beam excitation (excitation 525nm; emission 545nm), allowing for high resolution
assessment of cellular morphology (de Carvalho and Taboga, 1996; McMahon et al.,
2002). Detailed confocal analysis revealed that wild-type SpM cells residing in the caudal
region of the epithelial-like sheet (boxed area in Fig. 5J) did not possess typical epithelial
morphology. Instead, they retained their mesodermal character and displayed a highly
protrusive morphology with numerous filopodia-like extensions (white arrows, Fig. 5M).
In both Wnt5a-/- and Dvl1-/-; Dvl2-/- mutants, however, caudal SpM cells were more
rounded with smooth surfaces and fewer extensions (Fig. 5N&O). Furthermore, instead
of organizing into a cohesive sheet of 1-2 cell layers as in the wild-type, the mutant cells
formed multi-layered, compact clusters (compare Fig. 5M to 5N&O).
Actin polymerization defect in the caudal SpM of Dvl1/2 and Wnt5a mutants
The aberrant cell morphology and packing in the caudal SpM of Dvl1-/-; Dvl2-/and Wnt5a-/- mutants prompted us to further examine actin organization, since filopodia
formation requires actin polymerization and Dvl-mediated PCP signaling is important for
actin polymerization during Xenopus CE (Khadka et al., 2009). To this end, we stained
sagittal cryosections of E9.5 wild-type and Wnt5a-/- and Dvl1-/-; Dvl2-/- mutant embryos
with phalloidin, a marker for F-actin. Consistent with the H&E staining results, cells in
wild-type caudal SpM were organized into a largely single-layered structure with actin
filaments aligned along the apical-basal axis (Fig. 6A). Along the basal side of these
35
cells, actin filaments also extended into numerous filopodia (green arrows in Fig. 6A).
The loosely packed mesenchymal cells (red asterisk in Fig. 6A and enlarged view in Fig.
6D) adjacent to the epithelial-like sheet also extended multiple F-actin rich filopodia
(yellow arrowheads in Fig. 6D), indicative of highly protrusive morphology.
In contrast, caudal SpM cells in both Wnt5a-/- and Dvl1-/-; Dvl2-/- mutants
displayed significantly diminished actin polymerization, with only diffuse phalloidin
staining present at the borders between adjacent cells (Fig. 6B&C). They also exhibited a
more compact, multilayered organization with very few loosely-packed mesenchymal
cells, and even these are rounded and lack F-actin rich filopodia (red asterisks in Fig.
6B&C and enlarged views in Fig. 6E&F).
The actin organization in the rostral SpM cells of both Wnt5a-/- and Dvl1-/-; Dvl2-/mutants (Fig. 6H&I), however, was similar to that in the wild-type (Fig. 6G), with F-actin
enriched primarily at apical surface. Moreover, actin polymerization and organization in
the myocardial layer of the OFT also appeared normal in both mutants (Fig. 6K&L).
Therefore, the aberrant cell morphology and defective actin polymerization in Wnt5a-/and Dvl1-/-; Dvl2-/- mutants are specific to SHF progenitors in the caudal SpM, coinciding
with Wnt5a expression (Fig. 5A).
36
Discussion
Dvl1/2 mediated PCP signaling is required specifically in the SHF for OFT
development
Dvl genes are evolutionarily conserved, key cytoplasmic regulators of both the
canonical Wnt and the PCP pathway. Previous genetic studies in the mouse using
-
catenin conditional knockout and over-expression mutants have demonstrated that the
canonical Wnt pathway regulates OFT development through controlling progenitor
expansion and differentiation in the SHF (Cohen et al., 2007; Klaus et al., 2007; Kwon et
al., 2009; Lin et al., 2007; Qian et al., 2007) as well as cell proliferation in the CNC
(Kioussi et al., 2002). On the other hand, although the PCP pathway is clearly
indispensable for OFT development since mouse PCP mutants display severe OFT
defects; few genetic studies had been carried out to define how and in what lineage the
PCP pathway regulates OFT development.
In this study, we first used a Dvl2 BAC allelic series, consisting of domain
deletions and a point mutation that specifically disrupt either canonical Wnt or PCP
signaling, to determine the cause of the OFT defects in mice lacking Dvl1 and 2, two of
the three Dvl genes in mammals. Our results clearly demonstrated that in Dvl1-/-; Dvl2-/mutants, the OFT defects arise solely from disruption of PCP signaling. This conclusion
is most strongly supported by the fact that the Dvl2 BAC transgene carrying the dsh1
point mutation, known to disrupt PCP signaling but leave canonical Wnt signaling intact
(Axelrod et al., 1998b; Boutros et al., 1998b; Park et al., 2005), completely failed to
rescue the OFT defects in Dvl1-/-; Dvl2-/- mutants. In contrast, the
BAC transgene,
which lacks residues critical for Wnt but not PCP signaling (Boutros et al., 1998b;
37
Capelluto et al., 2002; Rothbacher et al., 2000), was able to rescue the OFT defects in
Dvl1-/-; Dvl2-/- mutants. Our result is also consistent with previous studies in which a
LEF/TCF Wnt reporter was crossed into Dvl1-/-; Dvl2-/- mutants and no defects in Wnt
signaling activity were detected during embryogenesis (Etheridge et al., 2008). Therefore,
it appears that the remaining Dvl3 in Dvl1-/-; Dvl2-/- mutants is sufficient to mediate Wnt,
but not PCP, signaling above the threshold level for normal OFT development.
Using the floxed Dvl2-EGFP2 BAC transgene and tissue specific Cre lines, our
genetic studies further indicate that during mouse OFT development, Dvl1/2 are required
in the Isl1-Cre positive SHF lineage, but are dispensable in the Wnt1-Cre positive CNC
lineage. Therefore, the CNC anomalies described previously in Dvl1-/-; Dvl2-/- mutant
(Hamblet et al., 2002; Kioussi et al., 2002) could be either secondary to defects in the
SHF, or insufficient to perturb overall OFT development.
PCP signaling during OFT lengthening and cardiac looping
Taken together, our genetic analyses indicate that Dvl1/2-mediated PCP signaling
is essential in the SHF lineage for OFT development. This conclusion is further supported
by the fact that deleting Dvl1/2 in the SHF causes cardiac defects similar to those
following mutation of core PCP gene Vangl2, including aberrant cardiac looping and
OFT mis-alignment from E9.5. Furthermore, mutation of non-canonical Wnt gene Wnt5a
causes similar cardiac looping defects and Wnt5a genetically interacts with Vangl2,
suggesting that Wnt5a may act as a PCP ligand. Importantly, our morphometric analyses
indicate that aberrant cardiac looping in each PCP mutant is correlated with reduced OFT
38
length, characteristic of compromised recruitment of SHF cells during OFT lengthening
(Rochais et al., 2009b).
Interestingly, during OFT lengthening at E9.5, Wnt5a expression was not detected
within the OFT by in situ hybridization (Fig. 5A and ref. (Schleiffarth et al., 2007;
Yamaguchi et al., 1999a)). Instead, Wnt5a is co-expressed with Dvl2 in the caudal SpM,
which harbors SHF progenitors that are deployed to give rise to the inferior wall of the
OFT (Bertrand et al., 2011; Waldo et al., 2005b; Zhu et al., 2008). In Dvl1/2 and Wnt5a
mutants, SHF cells in the SpM display no defects in either cell proliferation or apoptosis,
suggesting that the shortened OFT in Dvl1/2 and Wnt5a mutants is not due to reduced
cell proliferation or survival, but may arise from defects in the deployment of SHF cells.
A model for PCP signaling in SHF deployment, OFT lengthening and cardiac looping
PCP signaling regulates polarized cell intercalation and directional cell migration
during CE in Xenopus and zebrafish, but how might this pathway promote SHF
deployment in the mouse? The expression of Wnt5a in the caudal SpM does not support
Wnt5a functioning as a chemoattractant to guide directional cell migration. In contrast,
our studies revealed that SHF cells in the caudal SpM of Wnt5a and Dvl1/2 mutants lack
the normal protrusive morphology and display defective actin polymerization and
filopodia formation, suggesting that PCP signaling may normally promote cell
intercalation in this region. A recent study in mice suggests that as the SpM is recruited
into the OFT rostrally, it is replenished by SHF progenitors caudally (Zhu et al., 2008).
Furthermore, detailed expression and lineage analyses of the distinct sub-domains within
the SHF have demonstrated that the caudal SpM progenitors in the SHF contribute to the
39
inferior wall of the distal and proximal OFT(Bertrand et al., 2011). Our finding that wildtype cells in the caudal SpM display a highly protrusive morphology (Fig. 5M) supports
this view. We hypothesize that Wnt5a-activated PCP signaling may induce protrusive
activity in the caudal SpM to incorporate surrounding SHF progenitors into a cohesive,
epithelial-like sheet. Rapid incorporation of progenitor cells at the caudal end may push
the sheet rostrally to become recruited into the inferior wall of the OFT (Fig. 7A). In
Wnt5a and Dvl1/2 mutants, cells in the caudal SpM form compact clusters rather than
becoming rearranged into a sheet, which may in turn compromise the recruitment of the
SpM rostrally into the OFT, leading to OFT shortening defects (Fig. 7B).
Our model has important implications towards our understanding of the biology
of SHF development. Careful studies from Kirby’s group characterized the rostral SHF
SpM adjacent to the OFT as “a pseudostratified columnar layer of epithelial cells” in the
chick (Waldo et al., 2005b). We observed similar cell morphology in the mouse (Fig.
5G). How loosely packed mesenchymal cells in the SpM are converted to an epithelial
sheet and how cells in this epithelial sheet are deployed to the OFT remain unknown. Our
model in which PCP-mediated cell intercalation promotes a mesenchymal to epithelial
conversion in the caudal SpM provides an answer to both questions. Our model is also
consistent with chick vital dye labeling experiments which indicates that SpM is recruited
into the OFT as a cohesive cohort instead of individually migrating cells (van den Berg et
al., 2009).
Previous studies revealed that mutations in Vangl2 or Wnt11 also affect later OFT
development during a process known as myocardialization, where cardiomyocytes lose
40
their epithelial context and extend protrusions to invade the cushion mesenchyme and
muscularize it(Phillips et al., 2005; Zhou et al., 2007). Therefore, PCP-induced protrusive
cell behavior may be required at multiple stages of cardiogenesis.
In Xenopus, PCP signaling modulates actin organiztion and filopodia formation
through the formin homology protein Daam1 (Disheveled Associated Activator of
Morphogenesis 1), which links Dvl with actin binding protein Profilin in a Rho
dependent fashion (Khadka et al., 2009; Tanegashima et al., 2008). Mice carrying a
hypomorphic Daam1 mutation have been reported recently to display DORV and
defective actin organization in the cardiomyocytes of the ventricles (Li et al., 2011).
Whether Daam1 mutants have defects in the SHF SpM similar to those in Wnt5a and
Dvl1/2 mutants needs to be determined in the future.
Recent work on the transcriptional regulation of Wnt5a showed that Tbx1
regulates Wnt5a expression specifically in the SHF(Chen et al., 2012). Interestingly,
haploinsufficiency of Tbx1 results in the DiGeorge syndrome in humans which is
associated with conotrucal malformations(Scambler, 2010) and Tbx1-/- mutant mice also
display severe OFT anomalies(Chen et al., 2009). These studies, in conjunction with our
work, suggest that the pathogenesis of some of the OFT defects in Tbx1 mutants may
arise, in part, from the disruption of PCP signaling in the absence of Wnt5a expression.
In summary, our studies provide novel and important insights into how SHF
deployment to the OFT can be promoted by Wnt5a-activated PCP signaling in the caudal
SpM. It is interesting to note that another non-canonical Wnt ligand, Wnt11, is expressed
in the rostral pharyngeal region of the SHF and the OFT. Wnt11 expression in the OFT
41
activates
expression to regulate CNC and endocardial cell development (Zhou et
al., 2007), but whether Wnt11 may also have an earlier role in activating PCP signaling in
the pharyngeal mesoderm to promote SHF deployment from this rostal region needs to be
addressed in the future. Finally, whether and how transcriptional regulation of Wnt5a/11
may place PCP signaling under the control of a global signaling network to coordinate
SHF proliferation, differentiation and deployment are exciting questions that await future
exploration.
42
Table
Dvl1-/-;
Dvl1-/-; Dvl2+/-; Dvl1-/-; Dvl2- Dvl1-/-; Dvl2-/-;
Dvl2+/-;
Dvl2-EGFP2;
/-
Dvl2-
Cre
EGFP2
Cre
26
27
25
;
Dvl2- Dvl2-EGFP2;
EGFP2
Wnt1-Cre
Recovered
at 28
weaning
Expected at weaning
26
26
26
26
% Recovered
100%
100%
100%
96%
23
28
2
Islet1-Cre
Recovered
at 26
weaning
Expected at weaning
25
25
25
25
% Recovered
100%
92%
100%
8%
Table 1. Summary of progeny recovered at weaning from crosses between Dvl1-/-;
Dvl2-/-; Dvl2-EGFP2; Dvl2-EGFP2 and Dvl1-/-; Dvl2+/-; Wnt1-Cre or Dvl1-/-; Dvl2+/-;
Isl1-Cre mice.
43
Figures:
Figure 1. Genetic evidence that the OFT defect in Dvl1-/-; Dvl2-/- mutants arises from
disruption of PCP signaling. (A) Schematic diagram of the genomic structure and
resultant protein of the endogenous wild-type Dvl2 allele, the wild-type Dvl2-EGFP2 and
the mutant ΔDIX-EGFP, ΔDEP-EGFP and dsh1-EGFP BAC transgenes. The lower
panel depicts the AAG ATG alteration that leads to a K M substitution in the DEP
domain of dsh1-EGFP BAC and Drosophila dsh1 mutant allele (after Wang et. al.,
2006). When crossed into Dvl1-/-; Dvl2-/- background, the wild-type Dvl2-EGFP2 (B) and
the mutant ΔDIX-EGFP (C) BAC transgenes fully rescue the OFT defects, while the
ΔDEP-EGFP (D) and dsh1-EGFP (E) transgenes fail to do so, leading to OFT defects in
the form of DORV.
44
Figure 2. Dvl2 is required in the SHF but not the CNC lineage for OFT
development. (A) Schematic diagram of Cre mediated inactivation of Dvl2-EGFP2 and
the PCR genotyping strategy to detect successful recombination of Dvl2-EGFP2. (B)
PCR reactions confirming that Dvl2-EGFP2 can be efficiently recombined as predicted
upon exposure to Cre (lane 1). Dvl1-/-; Dvl2-/- mutants display DORV (C) and this defect
can be rescued by Dvl2-EGFP2 (D). Histological analysis of E18.5 embryonic hearts
showed that the aorta is connected to the right ventricle in Dvl1-/-; Dvl2-/- mutants (arrow
in G) whereas in Dvl1-/-;Dvl2-/-; Dvl2-EGFP hearts, the aorta is connected normally to the
left ventricle (arrow in H). Dvl2-EGFP2 retained its ability to rescue the OFT defects
when removed in the CNC by Wnt1-Cre (E and I), but failed to rescue and resulted in
45
PTA when removed in the SHF by Islet1-Cre (F and J). Arrowheads and arrows depict
connection of the aorta and pulmonary artery to the right ventricle in the mutants. Aorta
(Ao), Pulmonary Artery (PA), Persistent Truncus Arteriosus (PTA), Common arterial
trunk (CAT).
Figure 3. Cardiac looping defects in various PCP mutants at E9.5 are correlated
with OFT shortening. (A-D) Right-side views of E9.5 wild-type and PCP mutant
embryos. Note that mutant OFTs lack the rightward curve (green arrows in A-D, traced
with red lines). (E-H) Frontal views showing that aberrant cardiac looping leads to
changes in the plane of ventricular alignment (red lines in E-H) in PCP mutant hearts. (I)
Quantification of OFT length along the inner curvature (red lines in A-D) revealed
significant shortening in each PCP mutant. In Vangl2Lp/Lp; Wnt5a+/- mutants, reduced
Wnt5a dosage significant enhanced the OFT shortening defects observed in Vangl2Lp/Lp
mutants.
46
Figure 4. OFT alignment defects in E11.5 PCP mutants. During the remodeling
process at E11.5, the OFT is aligned between the right and left ventricles in wild-type
embryos (blue arrow in A), but is mis-aligned with only the right ventricle in Dvl1-/-;
Dvl2-/-; Dvl2-EGFP2; Isl1-Cre and Vangl2Lp/Lp mutants (blue arrows in B and C). In
Vangl2Lp/Lp ;Wnt5a+/- mutants, the alignment and cardiac looping defects become more
severe and the right ventricle remains higher than the left ventricle (blue arrows in D). (EH) Schematic representations of the heart morphology at E11.5 depict the misalignment
of the OFT with the ventricles in PCP mutants.
47
Figure 5. Wnt5a and Dvl1/2 mutants display histological defects in the caudal SpM,
where Wnt5a and Dvl2 are co-expressed. Wnt5a in situ (A) and epifluorescent analysis
48
of Dvl2-EGFP (B) revealed overlapping expression in the caudal SpM of the SHF (green
& red arrows). Quantitative RT-PCR analysis showed over 4-fold increase in endogenous
Dvl2 expression in the SpM as compared to the OFT(C). H&E stained sagittal sections of
E9.5 embryos indicate that wild-type caudal SpM (black box in D and high magnification
view in J) consists of loosely packed mesenchyme adjacent to a cohesive, epithelial-like
sheet, whereas those in Dvl1-/-; Dvl2-/- and Wnt5a-/- mutants contain cells accumulated
into compact clusters (black-boxed area in E and F and higher magnification views in K
and L). Higher resolution confocal analysis of H&E stained sections (boxed areas in J,
K&L) revealed that wild-type cells extend numerous filopodia-like protrusions (white
arrows in M), but Dvl1-/-; Dvl2-/- (N) and Wnt5a-/- (O) mutant cells are rounded and lack
filopodia formation. However, SHF cells in the rostral SpM (yellow-boxes in D-F and
magnified view in G-H) of Dvl1-/-; Dvl2-/- (E and H) and Wnt5a-/- (F and I) mutants have
cellular morphology and packing similar to those in the wild-type (D and G).
49
Figure 6. Actin polymerization defects in SHF progenitors in the caudal SpM of
Wnt5a and Dvl1/2 mutants. Phalloidin staining of sagittally cryo-sectioned E9.5
embryos revealed highly organized actin filaments in the largely single-layered SHF
progenitors in the wild-type caudal SpM (A), which extended filopodia-like protrusions
basally (green arrows in A). By contrast, SHF progenitors in the caudal SpM of Dvl1-/-;
Dvl2-/- (B) and Wnt5a-/- (C) mutants showed a multi-layered structure with diffuse actin
cytoskeleton and defective filopodia formation. Additionally, the loosely packed
50
mesenchymal cells lying dorsal to the epithelial-like sheet extended long protrusions in
the wild-type caudal SpM (red asterisk in A, magnified view in D). In contrast, the few
loose mesenchymal cells present in the caudal SpM of Dvl1-/-; Dvl2-/- and Wnt5a-/mutants appeared rounded and lacked filopodia (red asterisk in B and C; magnified views
in E and F). The actin organization in the rostral SpM and the OFT cardiomyocyte layer
of Dvl1-/-; Dvl2-/- (H and K) and Wnt5a-/- (I and L) mutants appeared normal when
compared to the wild-type (G and J).
51
Figure 7. Model of Wnt5a/Dvl-mediated PCP signaling in SHF deployment. (A) In
wild-type embryos, Wnt5a activates Dvl-mediated PCP signaling to induce protrusive
activity to incorporate SHF cells into an epithelial-like sheet in the caudal SpM, thereby
driving the deployment of SHF cells from SpM to the OFT. (B) In Wnt5a-/- or Dvl1-/-;
Dvl2-/- mutants, a failure to activate PCP signaling perturbs actin polymerization and
protrusive activity, causing the SHF cells in the caudal SpM to form compact clusters
rather than an epithelial-like sheet, thereby compromising their deployment to the OFT.
52
Supplemental Figure 1: Assessment of cell proliferation and apoptosis in the caudal
SpM. (A-C) Anti-pHH3 staining revealed that mitotic nuclei (red signals indicated by
yellow arrows in A-C) could be detected in SHF progenitors in the caudal SpM of
transversely sectioned E9.5 wild-type (A), Dvl1-/-; Dvl2-/- (B) and Wnt5a-/- (C) mutant
embryos. Quantification of the proliferation rate (the ratio of pHH3 positive nuclei to
total nuclei) revealed no significant differences between the wild-type and Dvl1/2 and
Wnt5a mutants (D). (E-G) Cell death was examined in transverse sections of the caudal
53
SpM by anti-cleaved-caspase 3 staining. No apoptotic cells were observed in the SpM of
E9.5 wild-type (E), Dvl1-/-; Dvl2-/- (F) or Wnt5a-/- (G) embryos. Few apoptotic cells were
observed in the foregut endoderm in wild-type and Dvl1-/-; Dvl2-/- embryos (green signal
indicated by red arrows in E&F) Nuclei were counterstained with DAPI (blue) in all the
panels. FG: Foregut endoderm; SpM: splanchnic mesoderm.
Acknowledgements
We are grateful to Dr. Rosa Serra, Megan Cox and Ching-Fang Chang for their help with
cryosectioning. This work was supported by NIH grant R01 HL109130, American Heart
Association Grants 0635262N and 11GRNT6980004 and start-up funds from the
University of Alabama at Birmingham to JW.
54
References
Ai, D., et al., 2007. Canonical Wnt signaling functions in second heart field to
promote right ventricular growth. Proc Natl Acad Sci U S A. 104, 9319-24.
Axelrod, J. D., et al., 1998. Differential recruitment of Dishevelled provides signaling
specificity in the planar cell polarity and Wingless signaling pathways. Genes Dev.
12, 2610-22.
Bertrand, N., et al., 2011. Hox genes define distinct progenitor sub-domains within
the second heart field. Dev Biol. 353, 266-74.
Black, B. L., 2007. Transcriptional pathways in second heart field development.
Semin Cell Dev Biol. 18, 67-76.
Boutros, M., et al., 1998. Dishevelled activates JNK and discriminates between JNK
pathways in planar polarity and wingless signaling. Cell. 94, 109-18.
Cai, C. L., et al., 2003. Isl1 identifies a cardiac progenitor population that
proliferates prior to differentiation and contributes a majority of cells to the heart.
Dev Cell. 5, 877-89.
Capelluto, D. G., et al., 2002. The DIX domain targets dishevelled to actin stress
fibres and vesicular membranes. Nature. 419, 726-9.
Chen, L., et al., 2012. Transcriptional control in cardiac progenitors: Tbx1 interacts
with the BAF chromatin remodeling complex and regulates Wnt5a. PLoS Genet. 8,
e1002571.
Chen, L., et al., 2009. Tbx1 regulates proliferation and differentiation of multipotent
heart progenitors. Circ Res. 105, 842-51.
55
Cohen, E. D., et al., 2007. Wnt/beta-catenin signaling promotes expansion of Isl-1positive cardiac progenitor cells through regulation of FGF signaling. J Clin Invest.
117, 1794-804.
de Carvalho, H. F., Taboga, S. R., 1996. Fluorescence and confocal laser scanning
microscopy imaging of elastic fibers in hematoxylin-eosin stained sections.
Histochem Cell Biol. 106, 587-92.
Devenport, D., Fuchs, E., 2008. Planar polarization in embryonic epidermis
orchestrates global asymmetric morphogenesis of hair follicles. Nat Cell Biol. 10,
1257-68.
Dyer, L. A., Kirby, M. L., 2009a. The role of secondary heart field in cardiac
development. Dev Biol. 336, 137-44.
Dyer, L. A., Kirby, M. L., 2009b. Sonic hedgehog maintains proliferation in
secondary heart field progenitors and is required for normal arterial pole
formation. Dev Biol. 330, 305-17.
Etheridge, S. L., et al., 2008. Murine dishevelled 3 functions in redundant pathways
with dishevelled 1 and 2 in normal cardiac outflow tract, cochlea, and neural tube
development. PLoS Genet. 4, e1000259.
Hamblet, N. S., et al., 2002. Dishevelled 2 is essential for cardiac outflow tract
development, somite segmentation and neural tube closure. Development. 129, 582738.
Heisenberg, C. P., et al., 2000. Silberblick/Wnt11 mediates convergent extension
movements during zebrafish gastrulation. Nature. 405, 76-81.
Henderson, D. J., et al., 2001. Cardiovascular defects associated with abnormalities
in midline development in the Loop-tail mouse mutant. Circ Res. 89, 6-12.
56
High, F. A., et al., 2009. Murine Jagged1/Notch signaling in the second heart field
orchestrates Fgf8 expression and tissue-tissue interactions during outflow tract
development. J Clin Invest. 119, 1986-96.
Hoffman, J. I., Kaplan, S., 2002. The incidence of congenital heart disease. J Am
Coll Cardiol. 39, 1890-900.
Ilagan, R., et al., 2006. Fgf8 is required for anterior heart field development.
Development. 133, 2435-45.
Jiang, X., et al., 2000. Fate of the mammalian cardiac neural crest. Development.
127, 1607-16.
Keller, R., 2002. Shaping the vertebrate body plan by polarized embryonic cell
movements. Science. 298, 1950-4.
Kelly, R. G., et al., 2001. The arterial pole of the mouse heart forms from Fgf10expressing cells in pharyngeal mesoderm. Dev Cell. 1, 435-40.
Khadka, D. K., et al., 2009. Non-redundant roles for Profilin2 and Profilin1 during
vertebrate gastrulation. Dev Biol. 332, 396-406.
Kibar, Z., et al., 2001. Ltap, a mammalian homolog of Drosophila Strabismus/Van
Gogh, is altered in the mouse neural tube mutant Loop-tail. Nat Genet. 28, 251-5.
Kilian, B., et al., 2003. The role of Ppt/Wnt5 in regulating cell shape and movement
during zebrafish gastrulation. Mech Dev. 120, 467-76.
Kioussi, C., et al., 2002. Identification of a Wnt/Dvl/beta-Catenin --> Pitx2 pathway
mediating cell-type-specific proliferation during development. Cell. 111, 673-85.
Kirby, M. L., 2008. Pulmonary atresia or persistent truncus arteriosus: is it
important to make the distinction and how do we do it? Circ Res. 103, 337-9.
57
Klaus, A., et al., 2007. Distinct roles of Wnt/beta-catenin and Bmp signaling during
early cardiogenesis. Proc Natl Acad Sci U S A. 104, 18531-6.
Kwon, C., et al., 2009. A regulatory pathway involving Notch1/beta-catenin/Isl1
determines cardiac progenitor cell fate. Nat Cell Biol. 11, 951-7.
Lakso, M., et al., 1996. Efficient in vivo manipulation of mouse genomic sequences
at the zygote stage. Proc Natl Acad Sci U S A. 93, 5860-5.
Lee, E. C., et al., 2001. A highly efficient Escherichia coli-based chromosome
engineering system adapted for recombinogenic targeting and subcloning of BAC
DNA. Genomics. 73, 56-65.
Li, D., et al., 2011. Dishevelled-associated activator of morphogenesis 1 (Daam1) is
required for heart morphogenesis. Development. 138, 303-15.
Li, P., et al., 2010. Retinoic acid regulates differentiation of the secondary heart field
and TGFbeta-mediated outflow tract septation. Dev Cell. 18, 480-5.
Lijam, N., et al., 1997. Social interaction and sensorimotor gating abnormalities in
mice lacking Dvl1. Cell. 90, 895-905.
Lin, L., et al., 2007. Beta-catenin directly regulates Islet1 expression in
cardiovascular progenitors and is required for multiple aspects of cardiogenesis.
Proc Natl Acad Sci U S A. 104, 9313-8.
Ma, Q., et al., 2008. Reassessment of Isl1 and Nkx2-5 cardiac fate maps using a
Gata4-based reporter of Cre activity. Dev Biol. 323, 98-104.
McCulley, D. J., et al., 2008. BMP4 is required in the anterior heart field and its
derivatives for endocardial cushion remodeling, outflow tract septation, and
semilunar valve development. Dev Dyn. 237, 3200-9.
58
McMahon, J. T., et al., 2002. Demonstration of immune complex deposits using
fluorescence microscopy of hematoxylin and eosin-stained sections of Hollande's
fixed renal biopsies. Mod Pathol. 15, 988-97.
Mjaatvedt, C. H., et al., 2001. The outflow tract of the heart is recruited from a
novel heart-forming field. Dev Biol. 238, 97-109.
Murdoch, J. N., et al., 2001. Severe neural tube defects in the loop-tail mouse result
from mutation of Lpp1, a novel gene involved in floor plate specification. Hum Mol
Genet. 10, 2593-601.
Park, E. J., et al., 2008. An FGF autocrine loop initiated in second heart field
mesoderm regulates morphogenesis at the arterial pole of the heart. Development.
135, 3599-610.
Park, T. J., et al., 2005. Subcellular localization and signaling properties of
dishevelled in developing vertebrate embryos. Curr Biol. 15, 1039-44.
Phillips, H. M., et al., 2005. Vangl2 acts via RhoA signaling to regulate polarized cell
movements during development of the proximal outflow tract. Circ Res. 96, 292-9.
Qian, D., et al., 2007. Wnt5a functions in planar cell polarity regulation in mice. Dev
Biol. 306, 121-33.
Rochais, F., et al., 2009a. Hes1 is expressed in the second heart field and is required
for outflow tract development. PLoS One. 4, e6267.
Rochais, F., et al., 2009b. Signaling pathways controlling second heart field
development. Circ Res. 104, 933-42.
Rothbacher, U., et al., 2000. Dishevelled phosphorylation, subcellular localization
and multimerization regulate its role in early embryogenesis. Embo J. 19, 1010-22.
59
Samanek, M., 2000. Congenital heart malformations: prevalence, severity, survival,
and quality of life. Cardiol Young. 10, 179-85.
Scambler, P. J., 2010. 22q11 deletion syndrome: a role for TBX1 in pharyngeal and
cardiovascular development. Pediatr Cardiol. 31, 378-90.
Schleiffarth, J. R., et al., 2007. Wnt5a is required for cardiac outflow tract septation
in mice. Pediatr Res. 61, 386-91.
Snider, P., et al., 2007. Cardiovascular development and the colonizing cardiac
neural crest lineage. ScientificWorldJournal. 7, 1090-113.
Sugishita, Y., et al., 2004. The development of the embryonic outflow tract provides
novel insights into cardiac differentiation and remodeling. Trends Cardiovasc Med.
14, 235-41.
Sun, Y., et al., 2007. Islet 1 is expressed in distinct cardiovascular lineages, including
pacemaker and coronary vascular cells. Dev Biol. 304, 286-96.
Tanegashima, K., et al., 2008. WGEF activates Rho in the Wnt-PCP pathway and
controls convergent extension in Xenopus gastrulation. Embo J. 27, 606-17.
Theveniau-Ruissy, M., et al., 2008. The del22q11.2 candidate gene Tbx1 controls
regional outflow tract identity and coronary artery patterning. Circ Res. 103, 142-8.
Torban, E., et al., 2008. Genetic interaction between members of the Vangl family
causes neural tube defects in mice. Proc Natl Acad Sci U S A. 105, 3449-54.
van den Berg, G., et al., 2009. A caudal proliferating growth center contributes to
both poles of the forming heart tube. Circ Res. 104, 179-88.
Verzi, M. P., et al., 2005. The right ventricle, outflow tract, and ventricular septum
comprise a restricted expression domain within the secondary/anterior heart field.
Dev Biol. 287, 134-45.
60
Waldo, K. L., et al., 2005a. Cardiac neural crest is necessary for normal addition of
the myocardium to the arterial pole from the secondary heart field. Dev Biol. 281,
66-77.
Waldo, K. L., et al., 2005b. Secondary heart field contributes myocardium and
smooth muscle to the arterial pole of the developing heart. Dev Biol. 281, 78-90.
Waldo, K. L., et al., 2001. Conotruncal myocardium arises from a secondary heart
field. Development. 128, 3179-88.
Wallingford, J. B., et al., 2000. Dishevelled controls cell polarity during Xenopus
gastrulation. Nature. 405, 81-5.
Wallingford, J. B., et al., 2001. Regulation of convergent extension in Xenopus by
Wnt5a and Frizzled-8 is independent of the canonical Wnt pathway. Int J Dev Biol.
45, 225-7.
Wang, B., et al., 2011. Disruption of PCP signaling causes limb morphogenesis and
skeletal defects and may underlie Robinow syndrome and brachydactyly type B.
Hum Mol Genet. 20, 271-85.
Wang, J., et al., 2006a. Dishevelled genes mediate a conserved mammalian PCP
pathway to regulate convergent extension during neurulation. Development. 133,
1767-78.
Wang, J., et al., 2005. Regulation of polarized extension and planar cell polarity in
the cochlea by the vertebrate PCP pathway. Nat Genet. 37, 980-5.
Wang, Y., et al., 2006b. The role of Frizzled3 and Frizzled6 in neural tube closure
and in the planar polarity of inner-ear sensory hair cells. J Neurosci. 26, 2147-56.
Wilkinson, D. G., Nieto, M. A., 1993. Detection of messenger RNA by in situ
hybridization to tissue sections and whole mounts. Methods Enzymol. 225, 361-73.
61
Yamaguchi, T. P., et al., 1999. A Wnt5a pathway underlies outgrowth of multiple
structures in the vertebrate embryo. Development. 126, 1211-23.
Ybot-Gonzalez, P., et al., 2007. Convergent extension, planar-cell-polarity signalling
and initiation of mouse neural tube closure. Development. 134, 789-99.
Yelbuz, T. M., et al., 2002. Shortened outflow tract leads to altered cardiac looping
after neural crest ablation. Circulation. 106, 504-10.
Yin, C., et al., 2008. Cooperation of polarized cell intercalations drives convergence
and extension of presomitic mesoderm during zebrafish gastrulation. J Cell Biol.
180, 221-32.
Zallen, J. A., 2007. Planar polarity and tissue morphogenesis. Cell. 129, 1051-63.
Zhang, Z., et al., 2006. Mesodermal expression of Tbx1 is necessary and sufficient
for pharyngeal arch and cardiac outflow tract development. Development. 133,
3587-95.
Zhou, W., et al., 2007. Modulation of morphogenesis by noncanonical Wnt signaling
requires ATF/CREB family-mediated transcriptional activation of TGFbeta2. Nat
Genet. 39, 1225-34.
62
3. LOSS OF WNT5A, A PUTATIVE TBX1 TARGET GENE, DISRUPTS
SECONDARY HEART FIELD DEPLOYMENT AND MAY UNDERLIE THE
OUTFLOW TRACT MALFORMATIONS IN DIGEORGE SYNDROME
by
Tanvi Sinha, Ding Li Mary Hutson, Robert Kelly and Jianbo Wang
In preparation for submission to Human Molecular Genetics
Format adapted and errata corrected for dissertation
63
Abstract:
Outflow tract (OFT) malformation accounts for ~30% of all congenital heart defects in
humans. The OFT forms, in part, from secondary heart field (SHF) progenitors that
undergo coordinated proliferation and differentiation and are subsequently recruited to
the arterial pole. While SHF proliferation and differentiation have been extensively
studied, the mechanisms underlying its recruitment to the OFT remain largely unknown.
In this study, we first demonstrate that the SHF cells in the splanchnic mesoderm (SpM)
are organized into an epithelial sheet that can promote their cohesive deployment to the
OFT. Further, this process of SHF deployment requires the non-canonical Wnt, Wnt5a.
Through lineage tracing in the mouse, we show that, in the absence of Wnt5a, SHF
deployment from the SpM to the OFT is severely impaired, resulting in a specific
reduction of the inferior OFT myocardium and its derivative, the sub-pulmonary
myocardium. Concurrently, this is accompanied by an ectopic extension of the superior
OFT and the sub-aortic myocardium in these mutants. Finally, our cell tracing
experiments in the chick embryo demonstrate that Wnt5a is required for the medio-lateral
elongation of SHF progenitors in the SpM and that interfering with this process results in
compromised SHF deployment to the OFT. Collectively, our results highlight a critical
and conserved role for Wnt5a in regulating the deployment of SHF progenitors from the
SpM to the OFT during vertebrate heart development. Given that previous studies have
identified Wnt5a as a transcriptional target of Tbx1 in the SHF, and the similar reduction
of the sub-pulmonary myocardium in Tbx1 mutant mice, our results support the idea that
perturbation of Wnt5a-mediated SHF deployment is a key pathogenic mechanism
underlying the OFT malformations in TBX1 haplo-insufficiency associated DiGeorge
syndrome in humans.
64
Introduction
The outflow tract (OFT), which gives rise to the aorta and the pulmonary
artery, is affected in approximately one third of all the congenital heart defects observed
in humans (Bruneau, 2008) Understanding the developmental mechanisms involved in
OFT morphogenesis are essential towards the design of novel diagnostic and therapeutic
approaches in humans. The OFT is initially present as a single vessel between the aortic
sac and the right ventricle and is formed by the recruitment of mesodermal progenitors
from an extra-cardiac region known as the secondary/anterior heart field (SHF). The
SHF extends from the rostral pharyngeal mesoderm to the caudal splanchnic mesoderm
(SpM) and was identified by the expression and lineage contribution of several specific
markers such as Fgf10, Mef2c, Tbx1 and the Fgf10-enhancer trap transgene, Mlc1v-24nLacZ (Cai et al., 2003; Dyer and Kirby, 2009a; Kelly et al., 2001; Li et al.; Li et al.,
2010
; Ma et al., 2008; Mjaatvedt et al., 2001; Verzi et al., 2005; Waldo et al., 2001).
Additionally, genetic analyses in the mouse have demonstrated that the SHF progenitors
are prefigured into discrete domains in the pharyngeal and splanchnic mesoderm and
give rise to distinct myocardial populations present at the base of the aorta and the
pulmonary artery (Bajolle et al., 2008).
The progenitors in the SHF are maintained in a finely balanced state of
proliferation and differentiation and are subsequently deployed to the OFT to bring about
its elongation. While proliferation and differentiation are important to provide the
sufficient number of progenitors required to form the OFT, the deployment process is
critical to ensure that these progenitors reach the OFT and allow for its lengthening.
65
Maximal elongation of the OFT is essential to complete cardiac looping and for OFT
alignment such that the invading Cardiac Neural Crest (CNC) cells can appropriately
septate the OFT into the aorta and the pulmonary artery and establish their ventricular
connections (Dyer and Kirby, 2009a; Li et al.; Li et al., 2010
). Disrupting any of the early events during OFT development can perturb its septation
and remodeling resulting in a spectrum of OFT defects such as Persistent Truncus
Arteriosus (PTA), which is a septation defect and Double Outlet Right Ventricle
(DORV), overriding aorta or transposition of the great arteries (TGA), which are
characteristic alignment and remodeling defects (Black, 2007; Dyer and Kirby, 2009a;
Kirby, 2008; Li et al.; Li et al., 2010; McCulley et al., 2008). Numerous studies have
demonstrated how SHF proliferation and differentiation are coordinately regulated by
transcriptional networks (Ai et al., 2007; Cohen et al., 2007; Dyer and Kirby, 2009b;
Goddeeris et al., 2007; High et al., 2009; Ilagan et al., 2006; Kwon et al., 2009; Lin et al.,
2007; Manisastry et al., 2006; Park et al., 2008; Zhang et al., 2008). However, the
mechanisms underlying SHF deployment to the OFT remain largely unknown.
Here, we show that the presumptive planar cell polarity (PCP) ligand, Wnt5a is
critically required for the recruitment of SHF progenitors from the SpM to the OFT. The
PCP pathway, a branch of the β-catenin independent non-canonical Wnt signaling
pathway, is an evolutionarily conserved mechanism that regulates cellular polarity and
directional tissue morphogenesis. PCP signaling in vertebrates is postulated to initiate
through the interaction of non-canonical Wnt ligands such as Wnt5a and Wnt11 with
specific transmembrane receptors including Frizzled (Fz), VanGogh-like (Vangl1/2) and
Ror2, which can then transduce the signal through various cytoplasmic effectors such as
66
Disheveled (Dvl) and Daam1. In vertebrates like Xenopus and zebrafish, PCP signaling
has been shown to play a critical role in axial elongation during gastrulation by
controlling the medio-laterally oriented intercalation and directional migration of
mesodermal cells (Heisenberg et al., 2000; Jessen et al., 2002; Keller, 2002; Yin et al.,
2008). In mice, disruption of PCP signaling results in mis-oriented stereociliary bundles
in the sensory hair cells of the cochlea (Qian et al., 2007; Wang et al., 2005; Wang et al.,
2006b), open neural tube (Kibar et al., 2001; Wang et al., 2006a; Wang et al., 2006b) as
well as defects in skeletogenesis (Wang et al., 2011), highlighting the significance of
PCP signaling during embryogenesis. Loss of function mutations in several genes
participating in the PCP pathway also result in a gamut of congenital heart defects, which
include severe OFT malformations.
Vangl2Lp/Lp and Dvl1-/-;Dvl2-/- mouse mutants
display DORV (Hamblet et al., 2002; Nassar et al., 2005; Phillips et al., 2005) whereas
Wnt5a-/- mouse embryos exhibit PTA (Schleiffarth et al., 2007).
Several studies have examined how the different OFT malformations may arise in
PCP mutants and they have mostly indicated a role for PCP signaling either in the CNC
lineage or in the OFT itself (Hamblet et al., 2002; Phillips et al., 2005; Phillips et al.,
2007; Schleiffarth et al., 2007; Zhou et al., 2007). In contrast, our previous research
showed that Dvl2-mediated planar cell polarity (PCP) signaling was specifically required
in the second heart field for OFT morphogenesis (Sinha et al., 2012) and mouse mutants
for the PCP genes Dvl1-/-;Dvl2-/-, Wnt5a-/- and Vangl2Lp/Lp displayed aberrant OFT
lengthening and alignment defects. We also demonstrated that Wnt5a genetically
interacted with Vangl2 to regulate OFT elongation and looping, suggesting that Wnt5a
may act a potential ligand to activate PCP signaling during these processes. Moreover,
67
SHF progenitors in the caudal SpM of Dvl1-/-;Dvl2-/- and Wnt5a-/- mutants displayed
abnormal cellular arrangement and filopodia formation. These observations suggested a
novel function for PCP signaling in regulation of deployment of SHF progenitors from
the SpM to the OFT. We proposed that Wnt5a activates PCP signaling through Dvl1/2 to
promote filopodia formation and the intercalation of SHF progenitors in the caudal SpM,
and this in turn provides the driving force to deploy the rostral SpM into the OFT (Sinha
et al., 2012).
With this study, we now provide direct evidence that Wnt5a function is, in fact,
necessary for the efficient deployment of SHF progenitors from the SpM to the OFT. Our
results reveal that the SHF cells in the SpM are organized into an epithelial sheet with
characteristic tight junction formation, which can facilitate their recruitment into the OFT
as a cohort. We further show that SHF progenitors are trapped in the SpM of Wnt5a
mutants resulting in their compromised deployment to the OFT. We also find that, as a
result of this compromised deployment, the inferior OFT and the sub-pulmonary
myocardium are significantly reduced in Wnt5a mutants and that the remaining OFT
myocardium largely possesses a sub-aortic identity. Finally, our vital-dye labeling
experiments in the chick embryo directly confirm that the SHF progenitors from the
caudal SpM are recruited to the OFT in a Wnt5a-dependent manner. Interfering with this
process through a function-blocking Wnt5a antibody also resulted in SHF cell elongation
and orientation defects, reminiscent of those observed in the caudal SpM of mouse
Wnt5a-/- mutants. Collectively, these results demonstrate that the process of SHF
progenitor deployment from the SpM to the OFT requires Wnt5a and appears to be
conserved across two vertebrate species.
68
While genetic variations at PCP linked gene loci such as VANGL1, ROR2 and
WNT5A have been associated with neural tube and skeletal defects in humans (Kibar et
al., 2007; Patton and Afzal, 2002; Person et al.; Person et al., 2010), there is not much
evidence for these variations in causing congenital heart defects. However, we propose
that the results obtained in the current study may explain the pathogenesis of OFT
malformations observed in the human DiGeorge syndrome (DGS). DGS is the most
common genomic micro-deletion syndrome in humans and is associated with the
haploinsufficiency of the TBX1 locus (Jerome and Papaioannou, 2001; Liao et al., 2004;
Merscher et al., 2001; Scambler, 2000; Scambler et al., 1992; Xu et al., 2004). Tbx1 has
been shown to regulate Wnt5a expression specifically in the SpM harboring the SHF
progenitors and Tbx1-/-; Wnt5a+/- compound mutants display OFT defects more severe
than those observed in Tbx1-/- mutants by themselves (Chen et al., 2012). The OFT
defects in Tbx1-/- mutants have been primarily associated with reduced proliferation and
abnormal differentiation of the SHF progenitors (Xu et al., 2004). In light of the genetic
interaction between Tbx1 and Wnt5a and the results obtained in the current study, we
propose that Tbx1 may have an additional role in the SHF to promote the deployment of
the SHF progenitors to the OFT through a Wnt5a mediated non-canonical/PCP pathway.
Subsequently, while other prospective modifiers for this deletion syndrome have been
proposed (Aggarwal and Morrow, 2008), our results suggest that WNT5A may act as an
additional novel genetic modifier in influencing the variable penetrance of OFT defects in
the TBX1 haplo-insufficiency syndrome, DGS.
69
Materials and Methods:
Mouse strains and genotyping
This study conforms to the Guide for the Care and Use of Laboratory Animals published
by the US National Institutes of Health (NIH Publication no. 85-23, revised 1996). Wnt5a
mutant mice and Rosa26-tdTomato(B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J) (R26RtdTomato) Cre reporter mice (Jackson Laboratory) were genotyped as described
(Madisen et al., 2010; Soriano, 1999; Yamaguchi et al., 1999a). The Mlc1v-24-nLacZ
(Mlc1v) and y96-myf5-16-nLacZ (y96-16) transgenic mice have been previously
described (Bajolle et al., 2006; Kelly et al., 2001) and were genotyped by PCR for the
LacZ transgene using primers LacZ F and LacZ R. Wnt11-CreER BAC transgenic mice
were generated (manuscript submitted-TS & JW) and genotyped by PCR using primers
CreA1 (CCG GGC TGC CAC GAC CAA) and CreA2 (GGC GCG GCA ACA CCA TTT
TT). All strains were maintained in a C57B6/ SJL/ FvB mixed background. Animal care
and use was approved by the Animal Care and Use Committee of the University of
Alabama at Birmingham.
Tamoxifen administration, embryo collection, imaging and X-gal staining
Wnt5a+/- mice were crossed with either Wnt5a+/-;Mlc1v or Wnt5a+/-;y96-16 mice to
obtain Wnt5a-/- embryos carrying the respective transgenes. Wnt5a+/-;Wnt11-CreER mice
were crossed with Wnt5a+/-;R26R-tdTomato mice to obtain Wnt5a-/-;Wnt11-CreER; R26R
embryos. Littermate embryos were used as controls. The morning of the plug was
designated as embryonic day (E)0.5; embryos were collected at various stages between
E9.5 to E14.5 and their yolk sacs were retained for genotyping.Wnt11-CreER transgene
bearing pregnant dams were singly gavaged with tamoxifen (Sigma, T-5648, dissolved to
10mg/ml in corn oil) at 2mg/40g body weight. Embryos were fixed in 4%
70
paraformaldehyde (PFA) at 4°C and subsequently stored in PBS before proceeding with
cryo-embedding and cryosectioning using a standard protocol (Sinha et al., 2012). X-gal
staining was performed as previously described (Kelly et al., 1995). X-gal stained
embryos were post-fixed, cryo-embedded and cryo-sectioned. Sections were counterstained with eosin and mounted in Vectashield mounting medium. Whole mount and Xgal stained embryo and section images were captured using a Leica MZ16FA
fluorescence stereomicroscope equipped with a multi-fluorescent filter set and a DFC490
CCD camera.
Chick embryo culture and injections
Fertilized chicken eggs (Charles River Avian Services, CT) were incubated in a forced
draft incubator at 39°C and 80% humidity. Shell-less cultures were set up at HH14 as
previously described (Yelbuz et al., 2002). The caudal splanchnic mesoderm of HH14
embryos
was
injected
with
either
DiI
(1,1’-dioctadecyl-3,3,3’-
tetramethylindocarbocyanine perchlorate, Molecular Probes, Inc.) alone or with 50-70 nl
of DiI+Rat IgG (2mg/ml, R&D Systems, MN) or DiI+anti-Wnt5a antibody (2mg/ml,
R&D systems, MN). Injected embryos were cultured for 45 hours and harvested at HH21.
Harvested embryos were fixed overnight in 4% PFA at 4°C and were subsequently
washed and stored in PBS. Fixed embryos were scored for the presence of the DiI label in
either the OFT or the SpM. Embryos were imaged with a Leica MZ16FA fluorescence
stereomicroscope and were processed for cryo-embedding and cryo-sectioning. For
analyzing the short term effect of anti-Wnt5a antibody injection on cellular architecture,
embryos were injected with Rat IgG or anti-Wnt5a neutralizing antibody (Blakely et al.;
Bodmer et al., 2009) caudally into the SpM. Rat IgG/anti-Wnt5a antibody was mixed
with Fast Green dye (Sigma, MO) to visualize site of injection. These embryos were
71
harvested 15 hours post-injection, cryo-embedded and cryo-sectioned. Phalloidin staining
was performed and the length to width ratios (LWR) and angles of alignment for SpM
cells were measured as depicted in Fig.4M using Adobe Photoshop CS5. Statistical
analyses were performed using Graphpad Prism 6.0. Angular measurements were plotted
using Rose.NET (Todd Thompson, http://mypage.iu.edu/~tthomps/programs/home.htm).
Fluorescent immuno-staining
Cryosections were fixed with cold 4%PFA for 5 minutes, washed with PbTX (0.1%
Tween in PBS), incubated in blocking solution (PbTX+1%BSA) followed by incubation
with primary antibodies overnight at 4°C. Subsequently, sections were washed with
PbTx, incubated with appropriate secondary antibodies for 1 hour at room temperature.
Sections were then washed with PbTx and mounted in Vectashield mounting medium
containing DAPI (Vector Labs, CA). Primary antibodies used were mouse anti-MF20
(1:15, DSHB, Iowa), Rat anti-Wnt5a (1:100, R&D systems, MN) and Phalloidin-FITC
(1:250, Sigma, MO). Alexa Fluor 647-conjugated donkey anti-mouse IgG (1:500,
Invitrogen, CA) and DyLight 488 conjugated donkey anti-mouse IgG (1:250, Jackson
ImmunoResearach, PA). All fluorescent confocal images were acquired with an Olympus
FV1000 Laser Confocal Scanning microscope and were subsequently analyzed using the
FV10-ASW software. Images were compiled and linearly adjusted for brightness,
contrast and color balance using Adobe Photoshop CS5.
72
Results
The SHF cells in the SpM are arranged in an epithelial sheet.
To gain an insight into the morphogenetic processes that drove the deployment of
SHF progenitors to the OFT, we first investigated their organization in the SpM. On
ventral view, confocal scan of whole mount phalloidin stained E9.5 mouse SpM revealed
that SHF cells in this region are organized as an epithelial-like sheet, where individual
cells display polygonal morphology and are tightly packed together with enriched F-actin
around their apical cortex (Fig.1A).
To further examine this epithelial property of the SHF, we immunostained for
Zonula Occludens 1 (ZO1), which is involved in tight junction formation in epithelial
tissues (Stevenson et al., 1986; Umeda et al., 2004). In E9.5 saggital sections, ZO1 is
localized specifically at the apical cell-cell junctions in the SpM between the OFT and
IFT (red arrows in Fig.1B, B’), indicating that SHF progenitors in this region were indeed
organized as an epithelial-like sheet with characteristic tight junction formation.
Interestingly, however, only in the caudal end of the SpM nearing the IFT, we could not
find any ZO1 expression in groups of loosely packed, multi-layered SHF cells behind this
epithelial-like sheet (white arrows in Fig.1B’). The fact that these ZO1 negative SHF
cells were only found in the caudal SpM suggested to us that they might undergo a
mesenchymal-to-epithelial transition (MET) to become incorporated into an epitheliallike sheet with up-regulation of ZO1 expression.
Our studies in mice are therefore consistent with histological studies in chick
embryos which have describe SHF cells in the rostral SpM as “a pseudo-stratified column
layer of epithelium” (Waldo et al., 2005b). Collectively, these data on cellular
73
organization suggest that SHF cells in the SpM are deployed to the OFT not as
individual, actively migrating cells, but instead as a cohesive, epithelial-like sheet.
The non-canonical Wnt, Wnt5a, is expressed by SHF cells in caudal-rostral gradient in
the SpM
To identify a potential molecular signal underlying the intercalation of the SHF
cells in the caudal SpM, we turned our attention towards PCP signaling components since
the PCP pathway has been shown to regulate directional cell intercalation (Kilian et al.,
2003). Immuno-staining for the presumptive PCP ligand, Wnt5a, revealed that Wnt5a
protein was enriched specifically in the caudal SpM (arrows in Fig.1C) where loosely
packed, ZO1 negative SHF progenitors were found, but not in the rostral SpM where
SHF cells were present as a single epithelial-like sheet. This caudally restricted
expression of Wnt5a suggested that Wnt5a may act in an auto- or paracrine fashion to
promote the intercalation of the loosely packed multi-layered SHF cells into a cohesive
epithelial sheet specifically in the caudal SpM. This would then provide the driving force
to push the SpM rostrally into the OFT, necessary for its elongation. We predict that
abolishing Wnt5a function would perturb the caudal intercalation of SHF progenitors and
would subsequently prevent normal SHF deployment and OFT morphogenesis.
SHF progenitors are trapped in the SpM of Wnt5a-/- mutants at E10.5
To test whether SHF progenitor deployment was perturbed in Wnt5a-/- mutants,
we employed the SHF-specific enhancer trap transgene Mlc1v-nLacZ-24 (Mlc1v) to
monitor progenitor SHF deployment from the SpM to the OFT. Mlc1v harbors a nuclear
lacZ (nLacZ) inserted into the Fgf10 locus. X-gal staining indicated that LacZ expression
was initially found in the SHF progenitors in the SpM at E8.5 and E9.5. At E10.5,
however, LacZ expressing cells were no longer present in the SpM, but instead were
74
found in the SHF derived OFT and right ventricle, indicating that SHF progenitors from
the SpM had been recruited to the OFT (Kelly et al., 2001). Therefore, we could asses the
role of Wnt5a in SHF deployment by crossing this transgene into Wnt5a-/-embryos and
examining the spatio-temporal pattern of LacZ expression.
X-gal staining of E9.5 embryos showed that LacZ expressing SHF progenitors are
present in the SpM in bilateral streams in both Wnt5a-/- and control embryos (Fig.2
A&B), indicating normal initial SHF specification. By E10.5, SHF progenitors have been
recruited into the heart and few LacZ expressing cells remained in the SpM of control
embryos (Fig.2 C&C’). In contrast, increased X-gal staining is observed in the SpM of
Wnt5a-/- embryos suggesting an aberrant accumulation of LacZ expressing SHF
progenitors in this region (Fig.2 D&D’). Interestingly, analysis of SHF deployment in
Tbx1-/- mutants with the MlC1v transgene also demonstrated a similar but less
pronounced accumulation of SHF progenitors in the SpM at E10.5, suggesting a
compromise in their recruitment to the OFT (Kelly and Papaioannou, 2007).
To ascertain that the increased accumulation of LacZ expressing SHF progenitors
in Wnt5a-/- SpMs was due to a deployment defect but not altered transcription of Mlc1v in
Wnt5a mutants, we performed fate map analyses of SHF progenitors by crossing Mef2cAHF-Cre transgenic mice with R26R-tdTomato Cre reporter mice. Mef2c-AHF-Cre is
expressed in the SpM where SHF progenitors are located and subsequently, after Cre
mediated recombination, reporter (tdTomato) expression is observed in the SHF cells as
well as in the SHF derived OFT and right ventricle (Verzi et al., 2005). Saggital sections
of E10.5 control embryos revealed that while the entire OFT and right ventricle expresses
tdTomato, only a small number of tdTomato expressing SHF progenitors are present in
the SpM (white dotted lines enclose tdTomato positive region in the SpM in Fig.2 E and
75
E’), indicating that a majority of the SHF cells have been deployed to the OFT by E10.5.
In contrast, in Wnt5a-/- embryos, a greater number of tdTomato expressing SHF cells are
present in the SpM as compared to the wild type (compare area enclosed by white dotted
lines in Fig. 2 F and F’ to that in Fig. 2 E and E’), confirming that there is indeed an
increased accumulation of SHF progenitors in the SpM of Wnt5a-/- mutants, as seen with
the Mlc1v transgene. Importantly, the increase in SHF progenitor number in the SpM
cannot be attributed to increased cell survival or turnover since both apoptosis and
proliferation occurred normally in the SpM of Wnt5a-/- embryos [(Sinha et al., 2012) and
data not shown].
Collectively, our tracing analyses with two different genetic systems demonstrate
an abnormal accretion of SHF progenitors in the SpM of Wnt5a-/- embryos, consistent
with the idea that Wnt5a is required for the deployment of these progenitors from the
SpM to the OFT.
The inferior OFT myocardium and the sub-pulmonary myocardium are reduced in
Wnt5a-/- mutants
To further establish a role of Wnt5a in the deployment of SHF cells, we directly
assessed how the loss of Wnt5a might affect the contribution of SHF progenitors in the
SpM to the OFT. SHF progenitors from the caudal SpM have been proposed to give rise
to the inferior myocardial wall of the OFT and subsequently, after OFT rotation and
morphogenesis, these cells were found to occupy the sub-pulmonary myocardium. This
observation was made using the y96-myf5-16-nLacZ (y96-16) enhancer trap transgene,
which expresses nLacZ in the heart under the Semaphorin 3c (Sema3c) promoter
(Theveniau-Ruissy et al., 2008). In y96-16 transgenic embryos, LacZ expressing cells are
initially observed in the inferior OFT myocardium at E9.5, indicating the contribution of
76
the caudal SpM cells and are later present in the sub-pulmonary myocardium at E14.5
after OFT rotation. Therefore, by crossing the y96-16 transgene into Wnt5a-/- embryos,
we could assess specifically if there were any alterations in the contribution of the SHF
progenitors from the SpM to the OFT by performing X-gal staining at different
embryonic stages.
X-gal staining of E9.5 control embryos showed that LacZ expressing cells are
present in the inferior region of the OFT (Fig.3 A, A’ ). Upon sectioning these embryos,
we observed that the LacZ expressing cells are present in a continuous layer in the
inferior myocardial wall of the OFT (Fig.3 A”). However, in Wnt5a-/- mutants, there are
fewer LacZ expressing cells in the OFT and sagittal sections of these embryos revealed
that these LacZ expressing cells are not present in a continuous layer like in the wildtype,
but instead appear to be intermingled with LacZ negative cells. This observation is
consistent with the idea that the deployment of the SHF progenitors is reduced in Wnt5a-/mutants resulting in fewer cells present in the OFT. (Fig.3 B,B’ and black arrows in
3B”). To examine the developmental consequence of this initial reduction in the inferior
OFT myocardial population, we performed X-gal staining on E14.5 hearts. Control hearts
show predominant LacZ expression ventrally around the base of the pulmonary artery
(Fig. 3C and C’) and transverse sections revealed that the LacZ expressing cells mainly
occupy the sub-pulmonary myocardium (Fig.3C”). In contrast, in Wnt5a-/- hearts, LacZ
expression is strikingly absent from the base of the OFT , when viewed ventrally (Fig.
3D). Superior views and sections of Wnt5a-/- hearts revealed that while a few LacZ
expressing cells are present in the dorsal and lateral regions around the OFT, they are
completely absent from the ventral region (Fig.3 D’&D”). This pattern of X-gal staining,
77
especially at E14.5 is remarkably similar to the pattern obtained with the y96-16
transgene in Tbx1-/- mutants indicating that the SpM deployment and OFT patterning
defects in Wnt5a-/- mutants strongly phenocopy those observed in Tbx1-/- mutants.
These analyses demonstrate that the SHF splanchnic mesoderm derived inferior
OFT myocardium is significantly reduced and may underlie the OFT elongation defects
in Wnt5a-/- mutants. Initial OFT elongation is essential for appropriate cardiac looping
and subsequent OFT rotation. The loss of the sub-pulmonary myocardium and the
aberrant presence of a few LacZ expressing cells dorsally in Wnt5a-/- mutants at E14.5
indicate that not only was a major population of the OFT myocardium lost in the mutant
embryos but that the OFT also fails to undergo the appropriate rotation necessary for its
development. Both, compromised SpM deployment and abnormal OFT rotation, have
been indicated to contribute towards the development of OFT malformations in Tbx1-/mutants. The strong similarity in the SHF deployment and OFT morphogenesis defects
between Tbx1 and Wnt5a mutants suggest to us that the pathogenesis of the defects in
these two mutants may be closely linked.
The superior OFT myocardium expands ectopically into the inferior OFT myocardial
wall of Wnt5a-/- embryonic hearts at E9.5
Studies using different enhancer trap transgenic lines have shown that the superior
and inferior myocardial walls of the OFT at E9.5 are already predetermined to give rise to
the sub-aortic and the sub-pulmonary myocardium, respectively (Bajolle et al., 2008).
Since the inferior OFT and the sub-pulmonary myocardium were significantly reduced
and mal-positioned in Wnt5a-/- hearts, we next sought to determine whether the superior
OFT and the sub-aortic myocardial regions were also affected in these mutants. To this
78
end, we performed lineage tracing with a Wnt11-CreER BAC transgenic line (manuscript
submitted, TS&JW) which expressed tamoxifen-inducible Cre under the Wnt11
promoter.
We crossed Wnt11-CreER transgenic mice with R26R-tdTomato Cre reporter
mice and induced Cre activity by a single dose of tamoxifen at E8.75. When control
littermates from tamoxifen-injected pregnant dams are harvested at E10.5, tdTomato
expression is observed mainly in the superior and lateral OFT myocardium (in addition to
the entire endocardium) (Fig. 3E-E”) and is specifically excluded from the inferior
myocardial wall of the OFT (white dotted lines in Fig. 3E-E. Subsequently, when theses
embryos are harvested at E12.5, tdTomato expressing cells are largely present around
sub-aortic myocardium (yellow arrows in Fig. 3G) and are distinctly absent from the
ventral sub-pulmonary myocardium (white dotted lines in Fig. 3G-G”). This contribution
of the Wnt11 lineage specifically to the superior OFT and the sub-aortic myocardium is
complementary to the contribution of the y96-16 lineage in the inferior OFT and the subpulmonary myocardium (Fig. 3A-D; (Bajolle et al., 2008)).
In contrast, Wnt5a-/- ;Wnt11-CreER; R26R-tdTomato mutant littermates harvested
at E10.5 from E8.75 tamoxifen-injected pregnant dams exhibit a few tdTomato
expressing cells ectopically in the inferior OFT myocardial region at E10.5 (arrows in
Fig. 3F; 3F’-F”).
Further, at E12.5, Wnt5a-/- embryos exhibit abnormal tdTomato
expression in the myocardium around the common arterial trunk (CAT) both dorsally and
ventrally (arrows in Fig. 3H; 3H’-H”). This suggests that the reduction in the inferior
OFT myocardium at E9.5 in Wnt5a-/- mutants results in an extension of the superior OFT
myocardial cells into this region, which in turn , along with improper OFT rotation, may
79
cause the tdTomato expressing cells to be present both dorsally and ventrally around the
CAT at E12.5
A similar complementary pattern for SHF contribution to the superior OFT and
the sub-aortic myocardium has also been described with an another enhancer trap
transgenic line, the Myf5-nLacZ-A17-T55 (T55). Additionally, analysis of Tbx1-/- mutant
OFTs showed that LacZ expression is expanded and abnormally present in the ventral
region around the CAT. This contribution of the T55 lineage resembles the contribution
of the Wnt11 lineage around the CAT in Wnt5a-/- mutants, suggesting that a close
relationship might exist between the development of the OFT malformations in these to
mutants.
Collectively, with the Mlc1v, Mef2c-Cre and y96-16 transgenic analyses, these
results suggest that not only is there a failure of SHF deployment to the OFT in Wnt5a-/mutants, but also that the superior OFT myocardial population extended ectopically into
the inferior region of the OFT. The abnormal presence of the superior OFT myocardial
cells in the inferior region and the significant reduction of the myocardial population
observed in Wnt5a-/- OFTs indicated that the initial loss in SHF recruitment to the OFT
might be responsible for the pathogenesis of the common arterial trunk phenotype
observed in these mutants.
SHF progenitors in the caudal SpM are deployed to the inferior OFT in a Wnt5adependent fashion in the chick
Our mouse studies with four different transgenic systems demonstrated that SHF
progenitors remain trapped in the SpM of Wnt5a-/- mutants and that there was a reduction
in the OFT myocardial population. Taken together, these results strongly indicated that
the deployment of SHF progenitors from the SpM to the OFT was significantly impaired
80
in Wnt5a-/- mutants. These observations, however, were made on the basis of altered
reporter expression patterns between Wnt5a-/- mutants and control littermates. In addition
to the ectopic localization of the progenitors expressing these reporters; the differential
pattern of reporter expression in a mutant background could also be attributed to a change
in their transcriptional regulation due to a global loss of Wnt5a. To address this unlikely
though possible caveat of altered transgene regulation and to definitively confirm that
SHF deployment to the OFT was directly dependent on Wnt5a, we extended our studies
to another vertebrate model, the chick embryo, which also possesses a SHF and a four
chambered heart. We reasoned that in the chick embryo, we could physically mark a
specific, restricted population of cells with the cell tracing dye,
DiI, which is
independent of genetic regulation, in contrast to gene expression-based lineage tracing
systems in the mouse. By monitoring the presence of the labeled cells at different stages
of development, we could then assess their deployment over time. Secondly, the chick
embryo develops ex utero and is extremely amenable to long term ex-ovo culturing and
extensive experimental manipulation (Ezin and Fraser, 2008). In contrast, long-term
culture of mid-gestation stage mouse embryos is technically challenging and does not
offer sufficient support required for early cardiac morphogenesis. Finally and most
importantly, like the mouse Wnt5a, chick Wnt5a is expressed in the SpM, suggesting a
conserved role for Wnt5a in regulating SHF deployment across different species
(Schleiffarth et al., 2007).
To this end, we labeled SHF progenitors in the caudal SpM of HH14 chick
embryos (equivalent to E9 in the mouse) with the fluorescent lipophilic dye, DiI (asterisk
in Fig.4A, A’). and cultured them for 45 hours to HH21. Epi-fluorescent examination of
HH21 embryos revealed intense DiI labeling in the inferior region of the OFT (arrows in
81
Fig.4B, B’) and saggital sections showed that DiI labeled cells are present in the inferior
OFT myocardial wall (yellow arrow in Fig.4B”) and co-express MF20. To our
knowledge, these results were the first to demonstrate that SHF progenitors in the caudal
SpM at HH14 are deployed uni-directionally as a cohort to give rise to the inferior OFT
myocardium,
Effect of perturbing Wnt5a signaling on caudal SpM deployment
To determine whether the recruitment of the chick SHF progenitors to the OFT
requires Wnt5a, we performed co-injections of a function-blocking rat anti-Wnt5a
antibody (Blakely et al.; Bodmer et al., 2009) along with DiI into the caudal SpM at
HH14 (Fig. 4C-F) and examined SHF progenitor deployment at HH21. In control
antibody (Rat IgG2) injected embryos (asterisk in Fig. 4C,C’), the DiI label is mainly
present in the inferior OFT myocardial wall at HH21 (whole mount in Fig. 4D and
sections in Fig. 4D’,D”), indicating that the SHF cells are recruited normally and rat IgG
per se does not interfere with SHF cell deployment in the chick. In contrast, in the antiWnt5a antibody injected embryos ( asterisk in Fig. 4E, E’), a large amount of the DiI
label is retained in the SpM behind the heart (blue arrow in Fig. 4F) at HH21. Section
analyses showed that while a few labeled cells do reach the inferior OFT (Fig. 4F’), a
vast majority of the DiI labeled cells remain trapped in the SpM (yellow arrow in Fig.
4F), indicating that Wnt5a activity is required within the SpM for efficient deployment of
SHF progenitors to the OFT.
Short term effects of anti-Wnt5a antibody treatment on SHF progenitors
We have previously shown that there are cell morphology and filopodia formation
defects in the caudal SpM region of Wnt5a-/- mutants (Sinha et al., 2012). Additionally, it
has been shown that Wnt5a regulates mesendodermal cell shape and orientation to
82
mediate convergent extension during zebrafish gastrulation (Kilian et al., 2003). To
examine whether perturbation of Wnt5a activity in the chick SpM was also associated
with similar cellular defects, HH14 injected embryos were harvested after 15 hours and
assessed for the short term effect of anti-Wnt5a antibody treatment. SpM sections were
stained with phalloidin to reveal cell shapes, which allowed us to measure length to width
ratios (LWR) and angles of alignment (AA) (Fig. 4M) of the SHF progenitors to
determine their morphology and orientation. In control antibody treated embryos, SHF
progenitors are elongated along their dorsal ventral axis (LWR=2.172) and are aligned
almost perpendicularly to the plane of the SpM (mean AA= 6.2°) (Fig. 4G-I, M-O). In
contrast, in anti-Wnt5a antibody treated embryos, the SHF progenitors are not elongated
and instead appeared to be rounded and had a lower LWR of 1.671. They also display a
more randomized orientation and are less perpendicular to the SpM (mean AA=-10°)
(Fig.4J-L, M-O).These results suggest that Wnt5a function is required in the SpM for the
SHF progenitors to acquire a polarize elongated shape in order to be deployed
competently to the OFT
Collectively, our in vivo dye labeling studies in the chick embryo demonstrated
that the caudal SpM is indeed deployed to the inferior myocardial wall of the OFT and
that this process requires Wnt5a. Finally, together with our mouse genetic studies, these
results allow us establish a role for Wnt5a in regulating the deployment of the SHF
progenitors from the SpM to the OFT.
83
Discussion
Multiple aspects of SHF progenitor development, in terms of their specification,
maintenance and differentiation, have been extensively examined since the SHF was
discovered fifteen years ago. However, how these progenitors are actually deployed to
their target destination, in this case, to the OFT and the right ventricle, has for the most
part been undescribed. We previously demonstrated that Dvl2-mediated PCP signaling
was required in the second heart field lineage for OFT morphogenesis. Our results
suggested that this pathway played a role in mediating the deployment of SHF
progenitors to the OFT.
In this study, we focus on the presumptive PCP ligand, Wnt5a, in OFT
morphogenesis and demonstrate directly a critical and specific role for Wnt5a in
regulating SHF progenitor deployment from the SpM to the OFT. We show that, in
Wnt5a null mutants, the SHF progenitors remain trapped in the SpM at E10.5 and
consequently fail to be deployed to the inferior OFT resulting in an impaired contribution
to the sub-pulmonary myocardium at later stages. Conversely, lineage analyses reveal
that the OFT in Wnt5a-/- mutants possesses mostly superior myocardial identity at E10.5
and subsequently, at E14.5, the majority of OFT myocardial cells display a sub-aortic
fate. Moreover, our cell labeling experiments in chick embryo culture system show that
Wnt5a functions specifically in the caudal SpM to promote SHF cell deployment to the
inferior wall of the OFT. Our analyses across two different species strongly indicate that
this process of SHF deployment is an essential early event that may be required for
subsequent OFT morphogenesis. Finally, we propose that due to the vast similarities in
the SHF deployment and OFT morphogenesis defects between Tbx1 and Wnt5a mutants;
84
perturbed Wnt5a signaling may, in part, mediate the pathogenesis of OFT defects in Tbx1
mutants.
Wnt5a and its role in SHF deployment
By histochemical and morphological experiments we have analyzed how SHF
progenitors are normally deployed to the OFT. Our characterization of the SpM has
allowed us to propose that the SHF progenitors in the caudal SpM are incorporated into
an epithelial sheet which can then facilitate their recruitment into the OFT as a cohort.
The predicted intercalation of ZO1 negative mesenchymal cells into an epithelial layer in
the caudal SpM coincides with the expression of the presumptive PCP ligand, Wnt5a.
This suggests that Wnt5a may act in this region to allow for a directional intercalative
process to occur in a way similar to what is observed during zebrafish gastrulation (Kilian
et al., 2003). This observation also provides a model to explain how SHF progenitors are
recruited into the OFT cohesively, instead of as individually migrating cells. Further,
with our cell labeling experiments in the chick embryo, we demonstrate that this model of
SHF deployment occurs in a Wnt5a-dependent manner and is conserved across two
different vertebrate species.
Wnt5a mutants exhibit significant shortening of the OFT as early as E9.5, which
may arise due to either reduced SHF progenitor population or due to a reduction in the
recruitment of the SHF progenitors to the OFT. Our genetic analyses with the Mlc1v and
Mef2c-AHF-Cre transgenic lines demonstrate that even though SHF specification in the
SpM initiates normally, a large proportion of SHF progenitors remain trapped in the SpM
of Wnt5a-/- embryos at E10.5, hindering their deployment. Moreover, the fact that the
85
SHF markers, Fgf10, Fgf8 and Tbx1 are expressed normally in Wnt5a-/- SpM at E9.5
(Schleiffarth et al., 2007) support our results that the accumulation of SHF progenitors in
the SpM occurs independently of SHF specification. These results also support our
previous study where we proposed that the cellular packing and filopodia formation
defects exhibited by SHF progenitors in the caudal SpM of Wnt5a-/- mutants interfered
with their deployment and resulted in a significantly shorter OFT (Sinha et al., 2012).
Interestingly, these cellular defects in the Wnt5a-/- SpM can be rescued by restoring
Wnt5a expression in the Isl1-Cre or Mef2c-AHF-Cre lineage (unpublished data,
DL&JW). These observations suggest that Wnt5a can activate PCP signaling specifically
in the SHF progenitors in an auto- or paracrine fashion to regulate cell shape and tissue
architecture to promote SHF deployment. Importantly, Tbx1-/- mutants also display SHF
deployment defects and Tbx1 activates Wnt5a expression in the SpM. Therefore, it would
be very interesting to examine if the deployment defects in Tbx1 mutants could also be
rescued by specifically expressing Wnt5a in the SHF.
Impaired SHF deployment in Wnt5a mutants affects OFT morphogenesis
One possible outcome of the impaired deployment of SHF progenitors to the OFT
would be a loss of the OFT myocardial population. Our analysis with the y96-16
transgene demonstrates a significant reduction in the inferior OFT and subsequently, in
the sub-pulmonary myocardium. Consequently, this could result in atresia or stenosis of
the pulmonary trunk similar to the OFT anomalies observed in the DGS associated
congenital heart defect, Tetralogy of Fallot. By performing lineage analyses with the
Wnt11-CreER transgene, we show that the remaining myocardium around the OFT in
Wnt5a mutants possesses mainly a sub-aortic identity, which may be attributed to the loss
86
of the sub-pulmonary myocardium in these mutants. This raises the probability that the
OFT defect present in Wnt5a mutants may be more similar to an atretic (absent)
pulmonary trunk rather than the previously described truncus arteriosus phenotype,
which arises due to an OFT septation failure. Interestingly, Tbx1 mutants also display
mal-positioning and reduced contribution of the y96-16 lineage and an abnormal ventral
contribution of the T55 lineage to the OFT myocardium (Theveniau-Ruissy et al., 2008).
While the OFT defect in Tbx1-/- mutants had also been described as PTA (Jerome and
Papaioannou, 2001; Theveniau-Ruissy et al., 2008; Xu et al., 2004), the characterization
of the y96-16 and the T55 lineage contribution to their OFTs has questioned the identity
of the prevalent OFT malformation in these mutants as PTA or pulmonary atresia (Kirby,
2008).
PTA and pulmonary atresia have different embryological origins; PTA occurs
primarily due to a failure of OFT spetation by the CNC whereas pulmonary atresia may
arise due to a loss of the sub-pulmonary region and can arise at different stages during
OFT development. The possible re-characterization of the OFT defects in both Tbx1-/and Wnt5a-/- embryos as pulmonary atresia instead of PTA, due to reduced subpulmonary myocardium, indicates that a deeper re-examination of OFT defects identified
as PTA in other mutants may be warranted. Further, several additional factors should be
taken into account while identifying gross OFT defects such as the presence or absence of
a ventricular septal defect and whether the common arterial trunk arises solely from the
right ventricle as seen in PTA or bears a connection with both the ventricles, more
common to pulmonary atresia (Kirby, 2008). Correct identification of specific OFT
malformations and their etiologies is crucial towards the development of novel diagnostic
and therapeutic approaches for treatments in human patients.
87
Wnt5a and the Cardiac Neural Crest (CNC)-mediated OFT septation
The OFT malformation in Wnt5a-/- mutants at E18.5 has most commonly been
described as PTA and was attributed, partly, to abnormal septation of the OFT by the
CNC (Schleiffarth et al., 2007). Interestingly, the OFT elongation defects in Wnt5a
mutants, arising due to compromised progenitor deployment as shown with y96-16
transgenic analaysis, are observed by E9.5, prior to CNC invasion of the OFT (Sinha et
al., 2012). The y96-16 transgene is integrated into the Sema3c locus (Theveniau-Ruissy et
al., 2008), which has been proposed to play a role during CNC mediated septation of the
OFT. Sema3c is expressed around the forming pulmonary artery at E12.5 and Sema3c
null mice display aberrant CNC patterning and a spectrum of OFT malformations such as
overriding aorta and truncus arteriosus (Brown et al., 2001; Feiner et al., 2001). The
decrease in y96-16 expressing cells in Wnt5a mutants indicated that this might result in a
reduction in Sema3c expression or Sema3c expressing cells, thereby interfering with
CNC mediated OFT septation. Concordantly, Wnt5a-/- mutants displayed reduced Sema3c
expression in the OFT (data not shown) as well as abnormal CNC patterning (Schleiffarth
et al., 2007), thereby accounting for the CNC defects proposed in these mutants. An
additional cause behind faulty OFT septation may be the failure of OFT rotation resulting
in improper CNC invasion into the OFT. However both OFT rotation and septation are
dependent on and occur after appropriate OFT elongation, which is significantly affected
in Wnt5a mutants. Therefore, these observations, along with our results showing
abnormal OFT rotation, suggest or the first time that the septation defects in Wnt5a
mutants might arise secondarily to the initial loss of OFT myocardial precursor
deployment.
88
Interestingly, Tbx1-/- mutants display not only a significant reduction and malpositioning of the y96-16 expressing cells in the OFT but also a loss of Sema3c
expression, similar to Wnt5a mutants (Theveniau-Ruissy et al., 2008). Additionally,
Wnt5a-/- , Sema3c-/- and Tbx1-/- mutants exhibit aortic arch interruption defects (Feiner et
al., 2001; Jerome and Papaioannou, 2001; Schleiffarth et al., 2007). In Sema3c-/- and
Tbx1-/- mutants, abnormal aortic arch development has been attributed to aberrant
pharyngeal arch patterning which in turn may also hinder CNC influx into the OFT. It
would be interesting to examine if the pharyngeal arches are also abnormally patterned in
Wnt5a-/- mutants especially since Wnt5a-/- OFTs fail to descend appropriately during
development (unpublished observation, TS&JW)
Perturbation of Wnt5a signaling as a significant pathogenic mechanism in DiGeorge
syndrome
We have shown that a large subset of the cardiovascular phenotypes as well as
SHF deployment and OFT morphogenesis defects observed in Tbx1 mutants are
recapitulated in Wnt5a mutants. The OFT defects in Tbx1-/- mutants are predicted to arise
due to a combination of reduced SHF progenitor proliferation and compromised
deployment of these progenitors to the OFT (Chen et al.; Chen et al., 2012; Kelly and
Papaioannou, 2007). The SHF proliferation defects in Tbx1 mutants have been attributed
to altered FGF signaling (Xu et al., 2004) Also, FGF8 conditional mutants strongly
recapitulate the spectrum of congenital birth defects, especially the OFT malformations,
associated with both the haplo-insufficiency as well as with the loss of Tbx1 (Frank et al.,
2002). However, restoring FGF signaling in the Tbx1 domain failed to rescue the OFT
defects in Tbx1-/- mutants (Vitelli et al.; Vitelli et al., 2010). This suggested that even
89
though the signaling mechanism regulating SHF proliferation may have been restored, it
was not sufficient to allow for normal OFT morphogenesis. Therefore, it appears that the
process of SHF deployment to the OFT may play a more significant role in mediating its
morphogenesis. Our studies show that Wnt5a directly regulates SHF deployment
independent of SHF differentiation and proliferation. Based on these observations and the
fact that Tbx1 can directly activate Wnt5a expression, we propose that Wnt5a acts
downstream of Tbx1 to regulate SHF deployment from the SpM to the OFT and that the
loss of Wnt5a-mediated SHF deployment in Tbx1-/- mutants may function as a key
pathogenic mechanism underlying the OFT malformations in these mutants
Cardiovascular abnormalities are the most marked and morbid feature of the
DGS, which is characterized by haploinsufficiency of the chr 22q11.2 region harboring
the TBX1 locus (Scambler, 2000). While haploinsufficiency of mouse Tbx1 does not fully
recapitulate all the associated OFT phenotypes, this may be due to the differential
requirements of and sensitivity to Tbx1 dosage across different species (Jerome and
Papaioannou, 2001; Lindsay et al., 1999). Intriguingly, WNT5A point mutations in
humans have also been associated with Robinow syndrome which infrequently includes
OFT defects (Person et al.). In any case, it would be especially interesting to determine
by genome wide association studies if genetic variations not only at the WNT5A locus but
also at other PCP associated gene loci would modify the penetrance and phenotypic
outcome of cardiovascular defects in DGS patients
While extensive efforts to characterize direct and indirect targets of Tbx1 during
SHF development have been made over a decade since its discovery as the DGS
candidate gene (Ivins et al., 2005; Liao et al., 2008; Prescott et al., 2005), the link
between Tbx1 and PCP signaling was only discovered recently. In addition to regulating
90
Wnt5a expression in the mouse SpM (Chen et al.), Tbx1 was also shown to play a role in
OFT looping and differentiation in the zebrafish through Wnt11r (Choudhry and Trede).
Wnt11r is an orthologue of the mammalian Wnt11(Garriock et al., 2005; Hardy et al.,
2008), which is also a presumptive PCP ligand (Heisenberg et al., 2000; Tada and Smith,
2000). Wnt11 is expressed in the mouse rostral pharyngeal mesoderm, as compared to the
caudal expression of Wnt5a. The Wnt11 lineage is specific to the superior OFT and the
sub-aortic myocardium and the loss of Wnt11 in mice results in PTA or TGA (Zhou et al.,
2007). Nonetheless, in the mouse, it was still not clear as to what aspect of Tbx1
mediated SHF development was the PCP pathway involved in. In this study, we have
demonstrated that Wnt5a is required for SHF deployment to the inferior OFT; a loss of
which, in turn, may be responsible for the pathogenesis of the OFT defects in Tbx1
mutants. Whether Wnt11 is required for the deployment of SHF progenitors to the
superior OFT and whether Tbx1 also regulates Wnt11 in the rostral SHF are exciting
questions that await future exploration.
Finally,
since Wnt5a is a predicted PCP ligand, this characterization of its
function during early OFT development has provided us with new avenues to develop
small molecules or to specifically apply this growth factor to spatio-temprally modulate
PCP signaling and in turn, atleast partially rescue the OFT defects associated with the
loss of Tbx1.
Acknowledgements
This work was supported by NIH grant R01 HL109130 and American Heart Association
Grants 0635262N and 11GRNT6980004 to JW and a pre-doctoral fellowship from AHA
(12PRE12060081) to TS.
91
Figures
Fig.1: The Spm of the mouse SHF is epithelial in nature and Wnt5a is expressed in
the caudal SpM The epithelial nature of the SpM was demonstrated by (1) whole mount
phalloidin staining on the dorsal pericardial region behind the heart tube (A, magnified
view of boxed area in inset) which depicts the SpM as an epithelial sheet and (2) by the
apical expression of ZO1 (green) in the ventral SpM cells on E9.5 sagittal sections (red
arrows in B, merged with nuclei (DAPI-blue) in B’). In contrast, the loosely packed cells
behind the ventral SpM did not exhibit ZO1 expression (white arrows in B’).
Fluorescence immunostaining with anti-Wnt5a antibody on saggital sections of E9.5
embryos showed the Wnt5a protein is expressed strongly in the caudal SpM (white
arrows in C). White dotted line denotes the inflow tract (IFT) which does not express
Wnt5a (C). splanchnic mesoderm (SpM).
92
Fig.2: SHF progenitors are trapped in the SpM in Wnt5a-/- embryos. Xgal staining of
E9.5 embryos indicate that the Mlc1v transgene is expressed in a bilateral fashion along
the dorsal pericardial wall and that this pattern is not significantly altered between WT
and Wnt5a-/- embryos (A,B).Subsequently, X-gal staining of E10.5 embryos demonstrates
increased LacZ expression in the SpM of Wnt5a-/- embryos as observed in both ventral
(compare LacZ expression region indicated by arrows between C and D) and lateral
views ( compare SpM region in C’ and D’). Asterisk in D’ indicates region of increased
LacZ expression in the SHF. Arrows in C’, D’ indicate the point of connection of the
OFT with the body wall. Lineage tracking with the Mef2c-AHF-Cre transgenic and the
R26R-tdTomato Cre reporter mice demonstrated that an increased number of tdTomato
expressing cells were retained behind in the lateral as well as the medial SHF region of
Wnt5a-/- embryos at E10.5 (Compare areas enclosed by white dotted lines in E and E’ to
F and F’). Outflow tract (OFT), inflow tract (IFT), right ventricle (RV)
93
Fig.3: Loss of regional OFT myocardium and ectopic expansion of the superior OFT
myocardium in Wnt5a-/- mutants. X-gal staining and subsequent histological analysis of
E9.5 Wnt5a+/+;y96-16 embryos showed that LacZ expressing cells were present
specifically in the inferior OFT myocardial wall (A-A”). In contrast, there was a
reduction in the number of LacZ expressing cells in the inferior OFT myocardium of
Wnt5a-/-;y96-16 embryos at E9.5 (B-B’, arrows in B”). Subsequently, at E14.5 LacZ
expressing cells were present mainly in sub-pulmonary myocardium of Wnt5a+/+- ;y96-16
embryos (arrows in C, top view in C’ and section analysis in C”), whereas no LacZ
expression was observed in the ventral region at the base of the CAT in Wnt5a-/- ;y96-16
hearts (arrow in D, superior view in D’ and section analysis in D”) . A few LacZ
expressing cells were observed dorsally around CAT in Wnt5a-/-; y96-16 embryos (D’,
D”). Lineage tracking from E8.75 onwards showed that tdTomato expressing cells were
mainly present in superior and lateral myocardial walls of the distal OFT at E10.5 (E-E”)
94
and subsequently occupied the sub-aortic myocardium (arrows in G) and were absent
from the ventral sub-pulmonary myocardium (white dotted line in G) at E12.5 (G-G”) in
control embryos. However, in E8.75 injected Wnt5a-/- embryos, a few tdTomato
expressing cells were ectopically present in the inferior OFT myocardium at E10.5
(arrows in F, F’ and F”) and in the myocardium around the base of the OFT at E12.5
(arrows in H, H’ and H”). TdTomato expression was also extensively observed in the
endocardium of all the Wnt11-CreER fate mapped embryos (E-H). Outflow tract (OFT),
inflow tract (IFT), right ventricle (RV), left ventricle (LV), aorta (Ao), pulmonary artery
(PA), common arterial trunk (CAT).
95
96
Fig.4: In vivo characterization of caudal SHF deployment to the OFT in the chick
embryo DiI was injected into the caudal SpM of H14 chick embryos (asterisk in A-A’).
DiI labeled cells were subsequently observed in the inferior OFT region of the injected
embryos harvested at HH21(B-B’). Saggital sections of harvested embryos showed that
DiI labeled cells co-localized with MF20 in the inferior OFT myocardium
(B”).Occasionally, some DiI label was retained at the site of injection (asterisk in B-B’).
HH14 chick embryos were co-injected caudally with a mixture of Control IgG+DiI
(arrow in C-C’) and were harvested at HH21. In HH21 embryos, DiI labeled cells were
observed in the inferior OFT myocardium (D,D’) and were absent from SpM region (D”)
behind the heart. In contrast, in anti-Wnt5a IgG+DiI co-injected embryos (E-E’), a large
proportion of DiI labeled cells were retained in SpM region behind the heart (blue arrow
in F, yellow arrow in F”). A few DiI labeled cells were present in the OFT (F’). (G-O)
HH14 embryos injected with Control IgG or anti-Wnt5a IgG were harvested 15 hours
later to assess cellular defects in the SpM. Phalloidin staining showed that in Control IgG
injected embryos, the SpM cells along with their nuclei appeared to be elongated along
their apical-basal axis (G-I) perpendicular to the SpM; whereas in anti-Wnt5a IgG
injected embryos, the SpM cells appeared to be more rounded and appeared to be
randomly oriented in relation to their SpM (J-L). Panels I’ and L’ display the orientation
of the SpM cells in boxed areas in I and L respectively. Length to width ratios (LWR)
and the angularity of SpM cells were calculated as depicted (M). The SpM cells of
control IgG injected embryos showed a mean LWR of 2.172 whereas in anti-Wnt5a
injected embryos, the rounded cells showed significantly reduced elongation and had a
mean LWR of 1.671 (N, p=0.004). Rose diagrams depicted that control SpM cells were
largely aligned perpendicular to the SpM whereas the cells in the anti-Wnt5a IgG injected
97
embryos showed a greater variation in their alignment with the SpM (O). Outflow tract
(OFT), inflow tract (IFT), splanchnic mesoderm (SpM), hamburger-Hamilton (HH).
98
Table1:
Injection
solution
Percentage
DiI label
Number of
DiI label of embryos
detected
DiI label
embryos
in inferior with DiI
in embryo
in SpM
injected
OFT
label
in
at HH21
OFT
DiI + Rat
16
IgG
DiI + anti18
Wnt5a IgG
Percentage
of embryos
with DiI
label
in
SpM
14
12
75%
2
12.5%
15
3
16%
12
66%
Table1: Number of chick embryos injected to analyze the effect of Wnt5a on SHF
deployment to the OFT.
99
References
Ai, D., Fu, X., Wang, J., Lu, M. F., Chen, L., Baldini, A., Klein, W. H., Martin, J. F.,
2007. Canonical Wnt signaling functions in second heart field to promote right
ventricular growth. Proc Natl Acad Sci U S A. 104, 9319-24.
Bajolle, F., Zaffran, S., Kelly, R. G., Hadchouel, J., Bonnet, D., Brown, N. A.,
Buckingham, M. E., 2006. Rotation of the myocardial wall of the outflow tract is
implicated in the normal positioning of the great arteries. Circ Res. 98, 421-8.
Bajolle, F., Zaffran, S., Meilhac, S. M., Dandonneau, M., Chang, T., Kelly, R. G.,
Buckingham, M. E., 2008. Myocardium at the base of the aorta and pulmonary trunk is
prefigured in the outflow tract of the heart and in subdomains of the second heart field.
Dev Biol. 313, 25-34.
Black, B. L., 2007. Transcriptional pathways in second heart field development. Semin
Cell Dev Biol. 18, 67-76.
Blakely, B. D., Bye, C. R., Fernando, C. V., Horne, M. K., Macheda, M. L., Stacker, S.
A., Arenas, E., Parish, C. L., Wnt5a regulates midbrain dopaminergic axon growth and
guidance. PLoS One. 6, e18373.
Bodmer, D., Levine-Wilkinson, S., Richmond, A., Hirsh, S., Kuruvilla, R., 2009. Wnt5a
mediates nerve growth factor-dependent axonal branching and growth in developing
sympathetic neurons. J Neurosci. 29, 7569-81.
Brown, C. B., Feiner, L., Lu, M. M., Li, J., Ma, X., Webber, A. L., Jia, L., Raper, J. A.,
Epstein, J. A., 2001. PlexinA2 and semaphorin signaling during cardiac neural crest
development. Development. 128, 3071-80.
100
Cai, C. L., Liang, X., Shi, Y., Chu, P. H., Pfaff, S. L., Chen, J., Evans, S., 2003. Isl1
identifies a cardiac progenitor population that proliferates prior to differentiation and
contributes a majority of cells to the heart. Dev Cell. 5, 877-89.
Chen, L., Fulcoli, F. G., Ferrentino, R., Martucciello, S., Illingworth, E. A., Baldini, A.,
Transcriptional control in cardiac progenitors: Tbx1 interacts with the BAF chromatin
remodeling complex and regulates Wnt5a. PLoS Genet. 8, e1002571.
Choudhry, P., Trede, N. S., DiGeorge syndrome gene tbx1 functions through wnt11r to
regulate heart looping and differentiation. PLoS One. 8, e58145.
Cohen, E. D., Wang, Z., Lepore, J. J., Lu, M. M., Taketo, M. M., Epstein, D. J.,
Morrisey, E. E., 2007. Wnt/beta-catenin signaling promotes expansion of Isl-1-positive
cardiac progenitor cells through regulation of FGF signaling. J Clin Invest. 117, 1794804.
Dyer, L. A., Kirby, M. L., 2009a. The role of secondary heart field in cardiac
development. Dev Biol. 336, 137-44.
Dyer, L. A., Kirby, M. L., 2009b. Sonic hedgehog maintains proliferation in secondary
heart field progenitors and is required for normal arterial pole formation. Dev Biol. 330,
305-17.
Ezin, M., Fraser, S., 2008. Time-lapse imaging of the early avian embryo. Methods Cell
Biol. 87, 211-36.
Feiner, L., Webber, A. L., Brown, C. B., Lu, M. M., Jia, L., Feinstein, P., Mombaerts, P.,
Epstein, J. A., Raper, J. A., 2001. Targeted disruption of semaphorin 3C leads to
persistent truncus arteriosus and aortic arch interruption. Development. 128, 3061-70.
101
Garriock, R. J., D'Agostino, S. L., Pilcher, K. C., Krieg, P. A., 2005. Wnt11-R, a protein
closely related to mammalian Wnt11, is required for heart morphogenesis in Xenopus.
Dev Biol. 279, 179-92.
Goddeeris, M. M., Schwartz, R., Klingensmith, J., Meyers, E. N., 2007. Independent
requirements for Hedgehog signaling by both the anterior heart field and neural crest
cells for outflow tract development. Development. 134, 1593-604.
Hardy, K. M., Garriock, R. J., Yatskievych, T. A., D'Agostino, S. L., Antin, P. B., Krieg,
P. A., 2008. Non-canonical Wnt signaling through Wnt5a/b and a novel Wnt11 gene,
Wnt11b, regulates cell migration during avian gastrulation. Dev Biol. 320, 391-401.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R.,
Stemple, D. L., Smith, J. C., Wilson, S. W., 2000. Silberblick/Wnt11 mediates
convergent extension movements during zebrafish gastrulation. Nature. 405, 76-81.
High, F. A., Jain, R., Stoller, J. Z., Antonucci, N. B., Lu, M. M., Loomes, K. M.,
Kaestner, K. H., Pear, W. S., Epstein, J. A., 2009. Murine Jagged1/Notch signaling in the
second heart field orchestrates Fgf8 expression and tissue-tissue interactions during
outflow tract development. J Clin Invest. 119, 1986-96.
Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y. P., Jiao, K., Schwartz, R. J., Klingensmith,
J., Meyers, E. N., 2006. Fgf8 is required for anterior heart field development.
Development. 133, 2435-45.
Jerome, L. A., Papaioannou, V. E., 2001. DiGeorge syndrome phenotype in mice mutant
for the T-box gene, Tbx1. Nat Genet. 27, 286-91.
Jessen, J. R., Topczewski, J., Bingham, S., Sepich, D. S., Marlow, F., Chandrasekhar, A.,
Solnica-Krezel, L., 2002. Zebrafish trilobite identifies new roles for Strabismus in
gastrulation and neuronal movements. Nat Cell Biol. 4, 610-5.
102
Keller, R., 2002. Shaping the vertebrate body plan by polarized embryonic cell
movements. Science. 298, 1950-4.
Kelly, R., Alonso, S., Tajbakhsh, S., Cossu, G., Buckingham, M., 1995. Myosin light
chain 3F regulatory sequences confer regionalized cardiac and skeletal muscle expression
in transgenic mice. J Cell Biol. 129, 383-96.
Kelly, R. G., Brown, N. A., Buckingham, M. E., 2001. The arterial pole of the mouse
heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell. 1, 435-40.
Kelly, R. G., Papaioannou, V. E., 2007. Visualization of outflow tract development in the
absence of Tbx1 using an FgF10 enhancer trap transgene. Dev Dyn. 236, 821-8.
Kibar, Z., Vogan, K. J., Groulx, N., Justice, M. J., Underhill, D. A., Gros, P., 2001. Ltap,
a mammalian homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse
neural tube mutant Loop-tail. Nat Genet. 28, 251-5.
Kilian, B., Mansukoski, H., Barbosa, F. C., Ulrich, F., Tada, M., Heisenberg, C. P., 2003.
The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish
gastrulation. Mech Dev. 120, 467-76.
Kirby, M. L., 2008. Pulmonary atresia or persistent truncus arteriosus: is it important to
make the distinction and how do we do it? Circ Res. 103, 337-9.
Kwon, C., Qian, L., Cheng, P., Nigam, V., Arnold, J., Srivastava, D., 2009. A regulatory
pathway involving Notch1/beta-catenin/Isl1 determines cardiac progenitor cell fate. Nat
Cell Biol. 11, 951-7.
Li, P., Pashmforoush, M., Sucov, H. M., Retinoic acid regulates differentiation of the
secondary heart field and TGFbeta-mediated outflow tract septation. Dev Cell. 18, 480-5.
Lin, L., Cui, L., Zhou, W., Dufort, D., Zhang, X., Cai, C. L., Bu, L., Yang, L., Martin, J.,
Kemler, R., Rosenfeld, M. G., Chen, J., Evans, S. M., 2007. Beta-catenin directly
103
regulates Islet1 expression in cardiovascular progenitors and is required for multiple
aspects of cardiogenesis. Proc Natl Acad Sci U S A. 104, 9313-8.
Lindsay, E. A., Botta, A., Jurecic, V., Carattini-Rivera, S., Cheah, Y. C., Rosenblatt, H.
M., Bradley, A., Baldini, A., 1999. Congenital heart disease in mice deficient for the
DiGeorge syndrome region. Nature. 401, 379-83.
Ma, Q., Zhou, B., Pu, W. T., 2008. Reassessment of Isl1 and Nkx2-5 cardiac fate maps
using a Gata4-based reporter of Cre activity. Dev Biol. 323, 98-104.
Madisen, L., Zwingman, T. A., Sunkin, S. M., Oh, S. W., Zariwala, H. A., Gu, H., Ng, L.
L., Palmiter, R. D., Hawrylycz, M. J., Jones, A. R., Lein, E. S., Zeng, H., 2010. A robust
and high-throughput Cre reporting and characterization system for the whole mouse
brain. Nat Neurosci. 13, 133-40.
Manisastry, S. M., Han, M., Linask, K. K., 2006. Early temporal-specific responses and
differential sensitivity to lithium and Wnt-3A exposure during heart development. Dev
Dyn. 235, 2160-74.
McCulley, D. J., Kang, J. O., Martin, J. F., Black, B. L., 2008. BMP4 is required in the
anterior heart field and its derivatives for endocardial cushion remodeling, outflow tract
septation, and semilunar valve development. Dev Dyn. 237, 3200-9.
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J.,
Eisenberg, C. A., Turner, D., Markwald, R. R., 2001. The outflow tract of the heart is
recruited from a novel heart-forming field. Dev Biol. 238, 97-109.
Park, E. J., Watanabe, Y., Smyth, G., Miyagawa-Tomita, S., Meyers, E., Klingensmith,
J., Camenisch, T., Buckingham, M., Moon, A. M., 2008. An FGF autocrine loop initiated
in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart.
Development. 135, 3599-610.
104
Person, A. D., Beiraghi, S., Sieben, C. M., Hermanson, S., Neumann, A. N., Robu, M. E.,
Schleiffarth, J. R., Billington, C. J., Jr., van Bokhoven, H., Hoogeboom, J. M., Mazzeu, J.
F., Petryk, A., Schimmenti, L. A., Brunner, H. G., Ekker, S. C., Lohr, J. L., WNT5A
mutations in patients with autosomal dominant Robinow syndrome. Dev Dyn. 239, 32737.
Qian, D., Jones, C., Rzadzinska, A., Mark, S., Zhang, X., Steel, K. P., Dai, X., Chen, P.,
2007. Wnt5a functions in planar cell polarity regulation in mice. Dev Biol. 306, 121-33.
Scambler, P. J., 2000. The 22q11 deletion syndromes. Hum Mol Genet. 9, 2421-6.
Schleiffarth, J. R., Person, A. D., Martinsen, B. J., Sukovich, D. J., Neumann, A., Baker,
C. V., Lohr, J. L., Cornfield, D. N., Ekker, S. C., Petryk, A., 2007. Wnt5a is required for
cardiac outflow tract septation in mice. Pediatr Res. 61, 386-91.
Sinha, T., Wang, B., Evans, S., Wynshaw-Boris, A., Wang, J., 2012. Disheveled
mediated planar cell polarity signaling is required in the second heart field lineage for
outflow tract morphogenesis. Dev Biol. 370, 135-44.
Soriano, P., 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat
Genet. 21, 70-1.
Stevenson, B. R., Siliciano, J. D., Mooseker, M. S., Goodenough, D. A., 1986.
Identification of ZO-1: a high molecular weight polypeptide associated with the tight
junction (zonula occludens) in a variety of epithelia. J Cell Biol. 103, 755-66.
Tada, M., Smith, J. C., 2000. Xwnt11 is a target of Xenopus Brachyury: regulation of
gastrulation movements via Dishevelled, but not through the canonical Wnt pathway.
Development. 127, 2227-38.
105
Theveniau-Ruissy, M., Dandonneau, M., Mesbah, K., Ghez, O., Mattei, M. G., Miquerol,
L., Kelly, R. G., 2008. The del22q11.2 candidate gene Tbx1 controls regional outflow
tract identity and coronary artery patterning. Circ Res. 103, 142-8.
Umeda, K., Matsui, T., Nakayama, M., Furuse, K., Sasaki, H., Furuse, M., Tsukita, S.,
2004. Establishment and characterization of cultured epithelial cells lacking expression of
ZO-1. J Biol Chem. 279, 44785-94.
Verzi, M. P., McCulley, D. J., De Val, S., Dodou, E., Black, B. L., 2005. The right
ventricle, outflow tract, and ventricular septum comprise a restricted expression domain
within the secondary/anterior heart field. Dev Biol. 287, 134-45.
Vitelli, F., Lania, G., Huynh, T., Baldini, A., Partial rescue of the Tbx1 mutant heart
phenotype by Fgf8: genetic evidence of impaired tissue response to Fgf8. J Mol Cell
Cardiol. 49, 836-40.
Waldo, K. L., Hutson, M. R., Ward, C. C., Zdanowicz, M., Stadt, H. A., Kumiski, D.,
Abu-Issa, R., Kirby, M. L., 2005. Secondary heart field contributes myocardium and
smooth muscle to the arterial pole of the developing heart. Dev Biol. 281, 78-90.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H.,
Kirby, M. L., 2001. Conotruncal myocardium arises from a secondary heart field.
Development. 128, 3179-88.
Wang, B., Sinha, T., Jiao, K., Serra, R., Wang, J., Disruption of PCP signaling causes
limb morphogenesis and skeletal defects and may underlie Robinow syndrome and
brachydactyly type B. Hum Mol Genet. 20, 271-85.
Wang, J., Hamblet, N. S., Mark, S., Dickinson, M. E., Brinkman, B. C., Segil, N., Fraser,
S. E., Chen, P., Wallingford, J. B., Wynshaw-Boris, A., 2006a. Dishevelled genes
106
mediate a conserved mammalian PCP pathway to regulate convergent extension during
neurulation. Development. 133, 1767-78.
Wang, J., Mark, S., Zhang, X., Qian, D., Yoo, S. J., Radde-Gallwitz, K., Zhang, Y., Lin,
X., Collazo, A., Wynshaw-Boris, A., Chen, P., 2005. Regulation of polarized extension
and planar cell polarity in the cochlea by the vertebrate PCP pathway. Nat Genet. 37,
980-5.
Wang, Y., Guo, N., Nathans, J., 2006b. The role of Frizzled3 and Frizzled6 in neural tube
closure and in the planar polarity of inner-ear sensory hair cells. J Neurosci. 26, 2147-56.
Xu, H., Morishima, M., Wylie, J. N., Schwartz, R. J., Bruneau, B. G., Lindsay, E. A.,
Baldini, A., 2004. Tbx1 has a dual role in the morphogenesis of the cardiac outflow tract.
Development. 131, 3217-27.
Yamaguchi, T. P., Bradley, A., McMahon, A. P., Jones, S., 1999. A Wnt5a pathway
underlies outgrowth of multiple structures in the vertebrate embryo. Development. 126,
1211-23.
Yelbuz, T. M., Waldo, K. L., Kumiski, D. H., Stadt, H. A., Wolfe, R. R., Leatherbury, L.,
Kirby, M. L., 2002. Shortened outflow tract leads to altered cardiac looping after neural
crest ablation. Circulation. 106, 504-10.
Yin, C., Kiskowski, M., Pouille, P. A., Farge, E., Solnica-Krezel, L., 2008. Cooperation
of polarized cell intercalations drives convergence and extension of presomitic mesoderm
during zebrafish gastrulation. J Cell Biol. 180, 221-32.
Zhang, J., Lin, Y., Zhang, Y., Lan, Y., Lin, C., Moon, A. M., Schwartz, R. J., Martin, J.
F., Wang, F., 2008. Frs2alpha-deficiency in cardiac progenitors disrupts a subset of FGF
signals required for outflow tract morphogenesis. Development. 135, 3611-22.
107
Zhang, Z., Huynh, T., Baldini, A., 2006. Mesodermal expression of Tbx1 is necessary
and sufficient for pharyngeal arch and cardiac outflow tract development. Development.
133, 3587-95.
Zhou, W., Lin, L., Majumdar, A., Li, X., Zhang, X., Liu, W., Etheridge, L., Shi, Y.,
Martin, J., Van de Ven, W., Kaartinen, V., Wynshaw-Boris, A., McMahon, A. P.,
Rosenfeld, M. G., Evans, S. M., 2007. Modulation of morphogenesis by noncanonical
Wnt signaling requires ATF/CREB family-mediated transcriptional activation of
TGFbeta2. Nat Genet. 39, 1225-34.
108
4. MAPPING THE DYNAMIC EXPRESSION OF WNT11 AND THE
LINEAGE CONTRIBUTION OF WNT11-EXPRESSING CELLS DURING
EARLY MOUSE DEVELOPMENT
by
Tanvi Sinha, Lizhu Lin, Sylvia Evans, Anthony Wynshaw-Boris, Jianbo Wang
Submitted to Developmental Biology
Format adapted and errata corrected for dissertation
109
Abstract:
Planar cell polarity (PCP) signaling is an evolutionarily conserved mechanism
that coordinates polarized cell behavior to regulate tissue morphogenesis during
vertebrate gastrulation, neurulation and organogenesis. In Xenopus and zebrafish, PCP
signaling is activated by non-canonical Wnts such as Wnt11, and detailed understanding
of Wnt11 expression has provided important clues on when, where and how PCP may be
activated to regulate tissue morphogenesis. To explore the role of PCP signaling in
mammalian development, we established a Wnt11 expression and lineage map with high
spatial and temporal resolution by creating and analyzing a tamoxifen-inducible Wnt11CreER BAC (bacterial artificial chromosome) transgenic mouse line. Our short- and
long-term lineage tracing experiments indicated that Wnt11-CreER could faithfully
recapitulate endogenous Wnt11 expression, and revealed for the first time that cells
transiently expressing Wnt11 at early gastrulation were fated to become specifically the
progenitors of the entire endoderm. During mid-gastrulation, Wnt11-CreER expressing
cells also contribute extensively to the endothelium in both embryonic and
extraembryonic compartments, and the endocardium in all chambers of the developing
heart. In contrast, Wnt11-CreER expression in the myocardium starts from lategastrulation, and occurs in three transient, sequential waves: first in the precursors of the
left ventricular (LV) myocardium from E7.0 to 8.0; subsequently in the right ventricular
(RV) myocardium from E8.0 to 9.0; and finally in the superior wall of the outflow tract
(OFT) myocardium from E8.5 to 10.5. These results provide formal genetic proof that the
majority of the endocardium and myocardium diverge by mid-gastrulation in the mouse,
and suggest a tight spatial and temporal control of Wnt11 expression in the myocardial
lineage to coordinate with myocardial differentiation in the first and second heart field
110
progenitors to form the LV, RV and OFT. The insights gained from this study will also
guide future investigations to decipher the role of non-canonical Wnt/ PCP signaling in
endoderm development, vasculogenesis and heart formation.
Highlights:
1) A Wnt11-CreER BAC transgene was created to recapitulate endogenous Wnt11
expression;
2) Lineage tracing revealed specific expression of Wnt11 in endodermal and
endothelial progenitors;
3) Wnt11 expressing cells contribute to the three major cardiac lineages, the
endocardium, myocardium and epicardium, in a spatio-temporally regulated
manner;
4) Endocardium and myocardium are diverged by mid-gastrulation in the mouse.
Key Words: Wnt11;
Planar cell polarity;
Fate mapping;
Gastrulation;
Endoderm specification;
Endothelial/ endocardial specification;
Heart development
111
Introduction:
Wnt ligands are a large family of 19 secreted glycoproteins that have diverse and
critical roles during embryonic development, in adult tissue homoeostasis and in human
diseases. They can be broadly divided into two classes: canonical Wnts such as Wnt1 and
Wnt3a, and non-canonical Wnts such as Wnt5a and Wnt11. Canonical Wnts bind to
Frizzled (Fz) receptors and the Lrp5/6 family of co-receptors to activate cytoplasmic
protein Dishevelled (Dsh/Dvl), which in turn stabilizes β-catenin to activate gene
transcription. Non-canonical Wnts, on the other hand, share certain components with the
canonical Wnt pathway such as Fz and Dsh/Dvl, but signal through multiple β-catenin
independent branches that include the Wnt/Ca 2+ and the planar cell polarity (PCP)
pathways (Angers and Moon, 2009; MacDonald et al., 2009; van Amerongen and Nusse,
2009; Wallingford et al., 2000).
Of these non-canonical Wnt signaling branches, the PCP pathway appears to be
the most evolutionarily conserved and has been best characterized in various vertebrate
and invertebrate model organisms. In epithelial cells, PCP signaling coordinates cellular
polarity in the plane of the epithelium, whereas in gastrulating mesodermal and
endodermal cells PCP signaling regulates polarized cell behavior such as mediolateral
(M-L) cell intercalation and directional migration during convergent extension (CE)
tissue morphogenesis (Keller, 2002; Zallen, 2007). In addition to Fz and Dsh/Dvl, the
PCP pathway requires a set of distinct “core” proteins such as the tetraspan membrane
protein Van Gogh (Vang/Vangl) and the atypical cadherin Flamingo (Fmi). What
functions downstream of these core proteins as PCP effectors remains elusive and is
likely to be context- and tissue- dependent, and may include JNK, small GTPase
112
Rho/Rac/Cdc42 and the formin protein Daam1 (Goodrich and Strutt, 2011; Habas et al.,
2001; Tree et al., 2002; Wallingford, 2012).
Studies in Xenopus and zebrafish have identified Wnt5a and Wnt11 as the two
primary non-canonical Wnts required for activating PCP-mediated tissue morphogenesis
during gastrulation (Heisenberg et al., 2000; Kilian et al., 2003; Tada and Smith, 2000;
Wallingford et al., 2001). In particular, Wnt11 acts in both cell-autonomous and cell-nonautonomous fashion to regulate polarized cell intercalation and directional migration of
mesodermal and endodermal cells (Heisenberg et al., 2000; Ulrich et al., 2003; Witzel et
al., 2006). Consequently, loss of Wnt11 results in failure of axial elongation and midline
convergence of foregut endoderm in frog and zebrafish embryos (Heisenberg et al., 2000;
Li et al., 2008; Matsui et al., 2005; Tada and Smith, 2000).
In the mouse, PCP signaling has so far been implicated in a number of processes
such as neurulation and cardiovascular and limb development (van Amerongen, 2012;
Wang et al., 2012). PCP-mediated tissue morphogenesis is likely to have even broader
impact on mammalian development and human diseases. Given the essential roles of
Wnt5a/Wnt11 in initiating PCP signaling and the fact that they act in paracrine or
autocrine fashion, determining their spatial and temporal expression pattern will shed
light on where and when PCP signaling is potentially activated, and provide hints on
what additional processes and tissues may require PCP function. Indeed, in situ
hybridization studies of Wnt5a expression have led to novel models as to how PCP
signaling could be operative in mammals to regulate heart and limb development (Gao et
al., 2011; Gros et al., 2010; Sinha et al., 2012; Yamaguchi et al., 1999a).
In comparison, our understanding of Wnt11 in the mouse is more limited. In situ
studies indicate that Wnt11 is expressed first in a scattered pattern around the primitive
113
streak at early gastrulation, and later on in the developing heart, posterior trunk and
urogenital system (Kispert et al., 1996). Wnt11-/- mouse embryos display no major
gastrulation defects, but die in-utero or shortly after birth with multiple cardiac defects
(Majumdar et al., 2003; Nagy et al., 2010; Zhou et al., 2007). Due to limited spatial and
temporal resolution, the existing RNA in situ data do not provide sufficient information
as to which cardiac lineage(s) express Wnt11 and the duration of Wnt11 expression in that
lineage, and therefore the spatio-temporal requirement for Wnt11 in heart development
remain to be elucidated. Moreover, in situ based expression studies often cannot inform
us of the potential fate and lineage of the cells that express the gene of interest, for
example the scattered Wnt11-expressing cells during early gastrulation in the mouse
(Kispert et al., 1996).
To overcome the limitations of in situ hybridization, and to establish a Wnt11
expression map with high spatial and temporal resolution and lineage information, we
generated a tamoxifen inducible Wnt11-CreER transgene using BAC (Bacterial Artificial
Chromosome) recombineering technology. Because of their large size (150-300 kb),
BAC transgenes have been shown to recapitulate endogenous gene expression patterns
(Lee et al., 2001). CreER-T2 encodes a fusion protein between a Cre and a mutated
estrogen receptor (ER) (Feil et al., 1997; Leone et al., 2003). CreER is normally
sequestered in the cytoplasm by the ER domain. Exposure to tamoxifen leads to a
temporary relief of this sequestration, allowing CreER to enter the nucleus to induce
recombination. By crossing Wnt11-CreER with Rosa26 Cre reporters (R26R) (Madisen et
al., 2010; Soriano, 1999) and administering tamoxifen during gestation, we can
transiently induce Cre activation to permanently label Wnt11 expressing cells and their
descendents. By analyses of embryos shortly after tamoxifen-induction, we can establish
114
a high-resolution expression map of Wnt11-CreER and compare it with the existing in
situ data. Alternatively, we can trace the fate of Wnt11-CreER expressing cells by
collecting and analyzing embryos after a more extended period.
In the current study, we focused on using our Wnt11-CreER BAC transgene to
perform detailed expression and lineage analyses during gastrulation and heart
development. Our results uncovered strikingly specific and dynamic expression of Wnt11
in progenitors of the endodermal and endothelial lineages during early and midgastrulation. In the heart, we demonstrated that not only did the Wnt11-CreER expressing
cells contribute to three major cardiac lineages (the endocardium, myocardium and
epicardium), but they did so in a highly spatio-temporally controlled fashion.
Collectively, our results provide novel and significant insights and open up multiple
avenues to explore the involvement of Wnt11/PCP signaling during early endoderm
development, vasculogenesis and heart formation.
115
Materials and Methods:
Cloning and BAC recombineering to generate Wnt11-CreER BAC transgenic mice
To create an efficient system to target the tamoxifen-inducible CreER T2 into BACs, we
cloned the CreER T2 fragment into the pIGCN21 vector, in front of an Frt-kanamycin
(kan)-Frt cassette that contains an EM7 promoter to drive kan transcription in bacteria.
BAC clone RP23-122D14 was acquired from BACPAC Resource Center at Children’s
Hospital Oakland Research Institute. This 196.9kb BAC contains the 19.6kb mouse
Wnt11 locus as well as 102.7kb genomic sequence 5’ and 74.5kb genomic sequence 3’ of
Wnt11 (Fig.1A). To target CreER T2 into the Wnt11 region, CreER T2- Frt-kan-Frt
cassette was amplified using primers Wnt11 CreER F
(GCGGTGGCCTGCAGGCGGCGGAGTTCGGTGCGGCTCCTGCAGGGTGCGACC
CCCGGGAGCGCCGGGCGCGCGCGACGATGTCCAATTTACTGACCGTA) and
Wnt11 CreER R
(TCGCAGATTTTGGTGGGCTCACCCAACCTCTCCAGCTTCTCGCCCAATGGCC
CATTGGAGTGAAAACGGAGTCCTACTCTATTCCAGAAGTAGTGAGGA) to add
78 bp homology arms on each end. RP23-122D14 BAC DNA was purified and
electroporated into EL250 cells, and standard BAC recombineering procedures (Lee et
al., 2001) were carried out using the Wnt11 CreER T2-Frt-kan-Frt targeting cassette. LB
agar plates containing 12.5 ug/ ml chloramphenicol and 25 ug/ ml kanamycin were used
to select for successfully targeted clones. PCR and sequencing reactions were performed
to confirm that CreER T2 was properly targeted into Wnt11 locus. Since EL250 cells also
contain arabinose-inducible Flpe (Lee et al., 2001), the Frt flanked kan could also be
deleted. The resulting Wnt11-CreER T2 BAC DNA was purified and used for pro-nuclear
injection to create Wnt11-CreER transgenic founders.
116
Mouse strains and genotyping
Wnt11-CreER BAC transgenic mice were genotyped by PCR using primers CreA1 (CCG
GGC TGC CAC GAC CAA) and CreA2 (GGC GCG GCA ACA CCA TTT TT). Wnt5a
mutant mice, Rosa26-tdTomato(B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J) (R26RtdTomato)and Rosa26-lacz(B6.129S4-Gt(ROSA)26Sortm1Sor/J) (R26R-lacZ) Cre reporter
mice were obtained from the Jackson Laboratory and genotyped as described (Madisen
et al., 2010; Soriano, 1999; Yamaguchi et al., 1999a). All strains were maintained in a
C57B6/ SJL/ FvB mixed background. Animal care and use was in accordance with NIH
guidelines and was approved by the Animal Care and Use Committee of the University of
Alabama at Birmingham.
Tamoxifen administration, embryo collection, imaging and X-gal staining
Wnt11-CreER mice were crossed with Rosa26-Cre reporter (R26R-lacz and R26RtdTomato) mice to obtain Wnt11-CreER; R26R embryos. Pregnant dams were singly
gavaged with tamoxifen (Sigma, T-5648, dissolved to 10mg/ml in corn oil) at 2-6mg/ 40g
body weight. Embryos were retrieved 6 hours to 6 days post gavage and the yolk sac was
retained for PCR genotyping. Embryos were temporarily fixed in 4% paraformaldehyde
(PFA) at 4°C for 20 to 60 minutes depending on embryo stage and subsequently stored in
PBS. X-gal staining was performed using as a standard protocol as previously
described(Nagy et al., 2007). Bright-field and epi-fluorescent whole mount embryo
images were captured using a Leica MZ16FA fluorescence stereomicroscope equipped
with a multi-fluorescent filter set and a DFC490 CCD camera.
Fluorescent immuno-staining
Fixed embryos/tissues were processed through sucrose gradients and embedded in OCT
(Tissue-Tek/Sakura, Torrance, CA) for cryo-sectioning. Briefly, OCT embedded samples
117
were cryo-sectioned at 10um-25um, air-dried at room temperature, fixed with 4%PFA,
permeabilized with PbTX (0.1% Tween in PBS), incubated in blocking solution
(PbTX+1%BSA) followed by incubation with primary antibodies overnight at 4°C.
Sections were washed with PbTx the next day, incubated with appropriate secondary
antibodies for 1hour at room temperature followed by washing with PbTx and mounting
in Vectashield mounting medium containing DAPI (Vector Labs, Burlingame, CA).
Primary antibodies used were mouse anti-MF20 (1:15, DSHB, Iowa) and antiCD31(PECAM)(1:200, BD Biosciences, San Jose, CA). Alexa Fluor 647-conjugated
donkey anti-mouse IgG (1:500, Invitrogen, Carlsbad,CA), Dylight-488 conjugated
donkey anti-mouse IgG, FITC conjugated Donkey anti-rat IgG (1:400 and 1:200, Jackson
ImmunoResearch, West Grove, PA) and HRP-conjugated goat anti-rat IgG (1:200,
SCBT, Dallas, TX) were used as secondary antibodies. A tyramide signal amplification
kit (PerkinElmer, Covina, CA, #NEL741E001KT) was used for anti-CD31 detection. All
fluorescent confocal images were acquired with an Olympus FV1000 Laser Confocal
Scanning microscope and were subsequently analyzed using the FV10-ASW software.
Images were compiled and linearly adjusted for brightness, contrast and color balance
using Adobe Photoshop CS5.
118
Results
Generation of Wnt11-CreER BAC transgene
We identified a 197kb BAC clone (RP23-122D14) that contained the 19.6kb
mouse Wnt11 locus as well as 102.7kb and 74.5kb genomic sequence 5’ and 3’ of Wnt11,
respectively (Fig. 1A). To establish an efficient system to target the tamoxifen-inducible
CreER T2 into the BAC, we first created a construct in which CreER T2 was linked to an
Frt flanked kanamycin (kan) cassette (Fig. 1B). This cassette allows direct selection of
kan resistant clones that have also co-incorporated CreER T2 through BAC
recombineering, and can be deleted by induction of flpe activity in EL250 cells that
harbor an arabinose-inducible flpe (Lee et al., 2001).
Using PCR, we added 78bp homology arms at each end of the CreER T2-Frt-kanFrt cassette to target it into Wnt11 locus in the BAC. The inserted CreER T2 replaced
part of the first coding exon of Wnt11, exon3, from the ATG start codon to the splicing
donor sequence immediately behind exon3 (Fig. 1B). The resulting Wnt11-CreER BAC,
therefore, would express CreER T2 under the control of Wnt11 promoter and regulatory
sequences, but was expected not to produce Wnt11 protein due to the deletion of the start
codon in exon3 (Fig.1C). Moreover, even if a truncated Wnt11 transcript could be made
and a cryptic start codon could be used to initiate translation, we predict that no
functional Wnt11 ligand can be made from Wnt11-CreER BAC transgene owing to the
deletion of the first 83 codons in exon3, which encode the signal peptide required for
Wnt11 secretion.
119
Establishment and characterization of a Wnt11-CreER transgenic line
We established one transgenic line from pronuclear injection of the Wnt11-CreER
BAC DNA. To determine how faithfully the transgene could recapitulate endogenous
Wnt11 expression, we first analyzed the spatial pattern of Wnt11-CreER expression at
several embryonic stages. This was achieved by crossing Wnt11-CreER mice with
Rosa26 Cre reporter (R26R-LacZ) mice to visualize Cre-activated reporter gene (LacZ)
expression shortly (6 to 12 hours) after tamoxifen administration, which allowed transient
nuclear translocation of Cre to induce homologous recombination.
When we performed tamoxifen administration by oral gavage at E6.25, and
dissected and stained embryos with X-gal 6 hours later (~E6.5), we observed LacZpositive cells in the proximal extraembryonic region near the ectoplacental cone (EPC),
and in the posterior region of the embryo proper, adjacent to the primitive streak at this
stage (Fig.1D). This pattern closely resembled the reported endogenous Wnt11 gene
expression at E6.5 revealed by in situ hybridization (Kispert et al., 1996). Tamoxifen
induction at E7.25 and X-gal staining 6 hours later at E7.5 resulted in labeled cells in the
node and the posterior end of the embryo, around the primitive streak and at the base of
the allantois (Fig.1E and F). This pattern again mimics E7.5 Wnt11 in situ results (Kispert
et al., 1996). Lastly, when we injected tamoxifen at E9.0 and stained the embryos 12
hours later at E9.5, we observed labeled cells in the posterior trunk/ tailbud region and in
the nephric duct (Fig.1H). Anteriorly, labeled cells are found primarily in the OFT and
the second pharyngeal arch, where second heart field (SHF) progenitors are located
(Fig.1G). The pattern of the labeled cells also closely matched Wnt11 in situ
hybridization studies performed at E9.5 (Kispert et al., 1996; Zhou et al., 2007).
120
Collectively, our analyses of CreER induced LacZ expression shortly after
tamoxifen induction indicate that the Wnt11-CreER BAC transgene faithfully
recapitulates endogenous Wnt11 expression.
Cells expressing Wnt11-CreER during gastrulation contribute to specific endodermal
and mesodermal tissues in the embryonic and extra-embryonic compartments
Given that Wnt11-CreER expressing cells appeared to occupy distinct domains
during gastrulation (Fig.1D-F), we sought first to determine which lineages they would
contribute to by performing long term lineage tracing (2-6 days) after a single tamoxifen
adminstration, either before gastrulation (E5.5 and earlier) or at the early (E6.0), mid
(E6.5) or late (E7.5) streak stages. For the long term tracing experiments, we utilized the
fluorescent Rosa26 Cre reporter R26R-tdTomato. R26R-tdTomato was constructed
similarly as R26R-LacZ except that Cre-mediated recombination led to the permanent
expression of tdTomato, a fast maturing, remarkably bright and photo-stable red
fluorescent protein (Madisen et al., 2010; Shaner et al., 2007). These properties of
tdTomato allowed direct and instantaneous visualization of labeled cells upon embryo
dissection, and eliminated potential problems with LacZ staining in older embryos.
Furthermore, co-immunofluorescent staining could be performed to determine the
identity of the tdTomato positive cells.
Activation of Wnt11-CreER prior to gastrulation (E5.5 or earlier)
When pregnant dams were induced with tamoxifen at E5.5 or earlier and embryos
were collected at E8.5 or later, only a few labeled cells were detected that were scattered
around the embryos with no consistent pattern (data not shown). This result indicated that
121
Wnt11-CreER was not expressed at significant levels prior to the onset of gastrulation in
mice.
Activation of Wnt11-CreER at the early streak stage (E6.0)
Interestingly, when we administered a single dose of tamoxifen at E6.0, we found
that Wnt11-CreER expressing cells contributed to specific lineages in both the extraembryonic and embryonic regions. Most strikingly, when these E6.0 tamoxifen-induced
embryos were harvested at E8.25 (Fig.2A & B – whole mount), the tdTomato labeled
cells occupied almost the entire embryonic endoderm, from the anterior foregut
endoderm that had already closed to form a lumen (red arrows in 2C,C’, E, and E”), to
the posterior endoderm that was still open (upper red arrow in Fig.2E and E’).
Secondly, we found that in E6.0 tamoxifen-induced embryos harvested at E8.25, a
small number of tdTomato labeled cells also co-expressed the endothelial marker
PECAM (Platelet endothelial cell adhesion molecule) (green arrows in 2D&F). In the
extra-embryonic region, these tdTomato/PECAM double positive cells were present as a
few small clusters on the yolk sac (green arrows in Fig.2F &F’); whereas in the embryo
proper, these cells were located along the dorsal aorta (green arrows in Fig.2D &D’).
Overall, these results indicated that at the onset of gastrulation, Wnt11-CreER was
expressed in the progenitors of the entire embryonic endoderm and a small portion of the
endothelial mesoderm that would give rise to the vasculature in both the embryonic and
extra-embryonic compartments.
Activation of Wnt11-CreER at the mid streak stage (E6.5)
Embryos induced at E6.5 and harvested at E8.5 resulted in tdTomato labeling of a
majority of endodermal cells along the entire A-P axis (Fig.3), similar to E6.0-tamoxifen
induced embryos (Fig.2). Since the endoderm is known to give rise specifically to the
122
epithelial lining of the respiratory and the digestive systems (Zorn and Wells, 2009), we
also performed longer term tracing to determine the developmental potential and
specificity of these tdTomato-labeled cells. When we retrieved E6.5-tamoxifen induced
embryos at E12.5, we observed that tdTomato expressing cells colonized most of the
endoderm-derived internal organs including the trachea, esophagus, lung, stomach and
intestines (Fig.4E, E’, G, G’ and data not shown). Sectioning of these organs further
confirmed that tdTomato labeled cells were present almost exclusively in the epithelial
linings of these organs (Fig.4 F-F”, H-H”).
Compared to the E6.0-tamoxifen induced embryos, the E6.5-tamoxifen induced
Wnt11-CreER; R26R-tdTomato embryos harvested at E8.5 had greater number of
tdTomato labeled cells contributing to the endothelial lineage. In the embryo proper,
more tdTomato-expressing cells could be observed in the dorsal aortae (compare Fig.3D’
to Fig.2D’). This trend was even more evident in the extra-embryonic region, where
tdTomato labeled cells occupied many more patches of the vasculature in the yolk sac
(Fig.3A-C) and the allantois (Fig.3F). When these E6.5-tamoxifen induced embryos were
harvested at E12.5, we found many tdTomato positive cells lining the blood vessels in the
yolk sac (Fig.4A-B”) and co-expressing the endothelial marker PECAM. A large
numbers of tdTomato-expressing cells could also be found in the allantois-derived tissues
in the placenta, including the fetal vasculature in the labyrinth (Fig.4C-D”) and the
supporting chorio-allanatoic mesenchyme (yellow arrows in Fig.4D, D”) at the base of
the placenta.
Endocardium is a specialized layer of endothelial cells lining the myocardium of
the heart. In E6.5 tamoxifen-induced Wnt11-CreER; R26R-tdTomato embryos harvested
at E8.5, we found that tdTomato-expressing cells also contributed extensively to the
123
endocardium (Fig.7A, B & B’). We will discuss this finding in more detail in the later
sections where we examined the dynamic contribution of Wnt11-CreER cells to the heart.
Activation of Wnt11-CreER at the late streak stage (E7.5)
To assess the expression of the Wnt11-CreER transgene at the late primitive
streak stage, we administered tamoxifen at E7.5 and retrieved embryos at E8.5-8.75. In
these embryos, we continued to see tdTomato expressing cells in the hindgut endoderm
(red arrows in Fig.5B & C”) and embryonic vasculature including the dorsal aortae
(green arrows, Fig.5C”), the inter-somitic vessels (green arrows, Fig.5B) and the
omphalomesenteric vein (lower green arrow in Fig. 5C”). When E7.5-induced embryos
were harvested at E12.5, Wnt11-CreER lineages were observed in the yolk sac and
allantoic vasculature, and lining the elaborate fetal vasculature in the yolk sac (Suppl.
Fig.1A&A’) and placenta (Suppl. Fig.1B & B’).
Compared to earlier inductions, inductions at E7.5 resulted in additional
tdTomato-labeling of distinct mesodermal tissues including the notochordal plate (white
arrow in Fig.5C”), the posterior intermediate and lateral plate mesoderm (yellow arrows;
Fig.5C-C”) and the myocardium of the left ventricle (LV, see later). This is consistent
with previous in situ analyses demonstrating that endogenous Wnt11 is expressed
strongly in the node, posterior trunk mesoderm and the cardiac crescent (Kispert et al.,
1996).
Together, these genetic labeling and tracking studies reveal a highly dynamic and
temporally-ordered pattern of Wnt11-CreER expression during gastrulation. At the early
streak stage (E6.0), Wnt11-CreER expression is initiated primarily in the progenitors of
the endoderm, expands progressively to the mesodermal progenitors of the endothelial/
endocardial lineage at the mid streak stage (E6.5), and finally to distinct mesoderm of the
124
cardiac, notochord, posterior intermediate and lateral plate lineages. The timing of
Wnt11-CreER expression in the endoderm and mesoderm suggests that these lineages
may sequentially activate Wnt11 expression as they transit the primitive streak during
gastrulation, suggesting a potential role for Wnt11/ PCP signaling in egression of
progenitors during germ layer formation.
Wnt11-CreER expression terminates in the embryonic endoderm and extra-embryonic
vasculature shortly after gastrulation
Our analyses indicated that cells expressing Wnt11-CreER during gastrulation
(E6.0-7.5) contributed extensively to the endodermal lineage, but endogenous Wnt11
expression was not detected in the endoderm of E8.5-10.5 mouse embryos (Kispert et al.,
1996). A possible explanation for this apparent discrepancy is that Wnt11 expression is
only transiently activated in endodermal progenitors, but is terminated in their descendent
shortly after gastrulation. To test this hypothesis, we administered tamoxifen at E8.5-9.0
and harvested Wnt11-CreER; R26R-tdTomato embryos between E10.5 and E12.5.
Interestingly, we found that in these E8.5-9.0 tamoxifen induced embryos, no tdTomato
expressing cells were found in the epithelial linings of the fore-, mid- and hindgut
endoderm (white arrows, Fig.6E-H). In fact, when we carefully re-examined the embryos
induced at E7.5, we found that although some tdTomato expressing cell could be found in
the midgut (Fig.6B) and hindgut endoderm (Fig.5B, 5C’ and 6C), they were already
absent from the foregut endoderm (Fig.6A & D).
Furthermore, we found that in E8.5-9.0 tamoxifen induced embryos, the
contribution of tdTomato expressing cells to the extra-embryonic vasculature of the yolk
sac and placenta was also diminished (Fig.6 E-H). These results together indicated that
125
Wnt11-CreER was transiently expressed in the progenitors of the embryonic endoderm
and extra-embryonic endothelium during gastrulation, but was turned off shortly
afterward. This temporal analysis of Wnt11-CreER transgene during gastrulation also
highlighted the significant advantage of CreER, which enabled us to determine not only
the lineage contribution of Wnt11 expressing cells with high spatial resolution, but also
the specific timing and duration of Wnt11 expression in each lineage.
Wnt11-CreER expressing cells contribute to multiple cardiac lineages in a spatiotemporally regulated manner
The most severe defect in Wnt11 mutant mice is malformation of the heart (Zhou
et al., 2007), which can be further enhanced by simultaneous mutation of another noncanonical Wnt gene Wnt5a (Cohen et al., 2012). To more thoroughly understand how
non-canonical Wnt signaling might promote cardiac development, we used Wnt11-CreER
to investigate the specific spatial and temporal expression of Wnt11 in each lineage in the
heart.
The Wnt11-CreER expression is initiated first in endocardial progenitors and maintained
in the differentiated endocardium
The endocardium is a specialized layer of endothelial cells lining the
myocardium. In Wnt11-CreER; R26R-tdTomato embryos induced at E6.5 and harvested
at E8.5, tdTomato-labeled cells contributed not only to endothelial cells in the embryonic
and extra-embryonic compartments (Fig.3), but also to the entire endocardium lining all
chambers of the forming heart tube, including the inflow tract (IFT), the LV, the right
ventricle (RV) and OFT (Fig.7A&A’; green arrows in Fig.7B & B’). In stark contrast,
however, tdTomato-expressing cells did not contribute significantly to the myocardium in
126
these embryos, and negligible numbers of tdTomato positive cells were found in the LV
(Fig.7B, B’, white arrows). Therefore, the earliest onset of Wnt11 expression in cardiac
progenitors appears to be within the progenitors of the endocardium during midgastrulation, and these Wnt11-expressing endocardial progenitors have already diverged
from myocardial progenitors that will give rise to the first heart field (FHF) and SHF.
Unlike the transient expression of Wnt11-CreER in endothelial progenitors in the
extra-embryonic compartment (Fig.6), Wnt11-CreER expression in the endocardium
persisted for an extended period. When we performed tamoxifen inductions from E7.0 to
10.5, we continued to detect robust contribution of tdTomato labeled cells to the
endocardium throughout the heart (Fig.7C-F’). This result suggests that Wnt11 is
expressed not only in early endocardial progenitors at gastrulation, but also in the
differentiated endocardium within the heart during organogenesis, and is consistent with
reported expression of endogenous Wnt11 in the endocardium at E10.5 (Cohen et al.,
2012).
Sequential activation of Wnt11-CreER expression in the progenitors of the ventricular
myocardium
Interestingly, when Wnt11-CreER; R26R-tdTomato embryos were induced with
tamoxifen at different time points between E7.0 and 9.0 and harvested 1-4 days later, we
observed a highly dynamic contribution of tdTomato-expressing cells to the ventricular
myocardium. First, when tamoxifen was administered at E7.0-7.5, tdTomato-labeled cells
contributed extensively to the myocardium in the LV and the inter-ventricular septum,
but not to the myocardium of the RV, OFT or atrium (Fig.8A-D, Suppl. Fig.2A & A’,
Suppl. Fig.3A & B). This pattern of contribution suggests that Wnt11 is expressed
specifically in the myocardial progenitors of the FHF at E7.0-7.5, consistent with the in
127
situ analysis showing that endogenous Wnt11 is expressed in the cardiac crescent (Kispert
et al., 1996).
Subsequently, when we administered tamoxifen at E8.0, we found that tdTomatopositive cells contributed to both the LV and the RV myocardium (Fig.8E & F), but not
to the OFT myocardium (Fig.8 G & H). On the other hand, when tamoxifen was
administered at E8.5, we found extensive contribution of tdTomato labeled cells to the
RV and OFT myocardium (Fig.8I & K), but their contribution to the LV myocardium
was diminished (Fig.8J & L, Suppl. Fig.2B&B’).
Finally, when we performed tamoxifen induction at E9.5, we found that the
contribution of tdTomato-positive cells to the RV myocardium was also diminished
(Fig.8 M-P), and following inductions at E10.5, we could no longer find any tdTomato
expressing cells in the myocardium of either ventricles (Fig.7 E-F’). Collectively, our
analyses suggest Wnt11 is expressed in a highly dynamic and transient fashion, first in
FHF precursors that give rise to the LV myocardium, and then in the SHF progenitors of
the RV myocardium.
Spatially restricted contribution of Wnt11-CreER expressing cells to the OFT
myocardium
When we administered tamoxifen at E8.5 and harvested embryos at E9.5, we
found that in addition to the RV myocardium, tdTomato expressing cells were also
present in the 2nd pharyngeal arch mesoderm known to harbor the SHF progenitors of the
OFT myocardium (Kelly et al., 2001) (Fig. 9A and black arrows in Fig. 9B), and the
contiguous superior wall of the OFT myocardium (Fig.9C). This spatially restricted
contribution of Wnt11-CreER expressing cells to the superior wall of the OFT
myocardium could be visualized also when we collected these E8.5-9.0 tamoxifen128
induced embryos at E10.5. Sagittal and transverse sectioning and immunostaining with
MF20 in these embryos clearly indicated that tdTomato expressing cells were present
only in the myocardium of the superior wall of the OFT (white arrow in Fig. 9D-I), but
absent from the inferior ¼ region of the OFT myocardial wall (yellow arrow in Fig.9F-I).
The specific contribution of the Wnt11-CreER lineage to the superior wall of the
OFT myocardium also prompted us to determine its long-term developmental potential.
Previous lineage tracing studies, using enhancer trap transgene y96-myf5-nlacz-16 (y9616) and a set of Hox Cre lines, indicated that cells initially occupying the inferior wall of
the OFT myocardium gave rise specifically to the cardiomyocytes at the base of the
pulmonary artery (Bajolle et al., 2006; Bertrand et al., 2011; Theveniau-Ruissy et al.,
2008). In contrast, when we performed longer term tracing, we found that the Wnt11CreER lineage, which initially occupied the superior wall of the OFT myocardium,
contributed primarily to the cardiomyocytes around the base of the aorta (arrows in
Fig.9J-0), but not the pulmonary artery (white dotted lines in Fig.9J-O).
Therefore, together with the previous literature (Bajolle et al., 2008; Bertrand et
al., 2011; Rochais et al., 2009b; Theveniau-Ruissy et al., 2008), our results indicate that
the superior and inferior wall of the early OFT myocardium are molecularly distinct and
pre-determined to contribute specifically to the sub-aortic and -pulmonary myocardium,
respectively.
Wnt11-CreER lineages contribute to the epicardium
In addition to the myocardium and endocardium, the heart contains a third lineage
know as the epicardium. The epicardium is derived from cells in the pro-epicardial organ
situated over the septum transversum caudal to the heart tube. Pro-epicardial cells extend
and attach onto the myocardial layer of the forming atria and ventricles from E9.5
129
onward and rapidly spread over the heart to form a contiguous epicardial layer covering
the entire myocardium by E11.5 (Reese et al., 2002) .
When tamoxifen was administered at E8.5 or earlier, we detected only few
tdTomato-expressing cells in the epicardial layer (yellow arrow in Fig. 8F). However,
when tamoxifen induction was performed at E9.5 (Fig.8I-P), E10.5 (Fig.7E, F, G&H) or
later (data not shown), the entire epicardial layer was consisted of tdTomato-expressing
cells. Consistent with our Wnt11-CreER analysis in the epicardium, a previous report by
Cohen et. al. showed endogenous Wnt11 transcripts in the epicardium of the developing
heart (Cohen et al., 2012).
Collectively, as summarized in Table 1, our lineage analysis with the Wnt11CreER BAC transgene provided a high-resolution expression and fate map of Wnt11
expressing cells in the heart. Whereas Wnt11-CreER expression in the endocardial and
epicardial lineages is more persistent and present throughout all chambers of the heart, its
expression in the myocardium is highly dynamic and present only transiently and
successively in precursors of the LV, RV and OFT myocardium. Notably, the only
regions where we detected no contribution of Wnt11-CreER expressing cells were the
atrial myocardium (Supp. Fig. 3) and the inferior wall of the OFT myocardium (Fig.9DI).
130
Discussion:
In recent years, the PCP pathway has been recognized as a key signaling
mechanism that regulates tissue morphogenesis in diverse animal species, and has
garnered attention from investigators across different disciplines. Activation of PCPmediated morphogenetic processes requires non-canonical Wnts as ligands, and Wnt11
has been identified as one of the primary PCP ligands during zebrafish and Xenopus
gastrulation (Heisenberg et al., 2000; Li et al., 2008; Schambony and Wedlich, 2007;
Tada and Smith, 2000). The potential role of Wnt11 as a PCP ligand in mammals,
however, has remained less clear because Wnt11 mutant mice do not display some of the
characteristic phenotypes observed consequent to mutation of core PCP genes Vangl2,
Dvl and Celsr. Phenotypic differences may be due to altered expression patterns during
evolution, or redundancy of other non-canonical Wnts. Therefore, expression maps with
high spatial and temporal resolution need to be established for mammalian non-canonical
Wnt genes. Secondly, whereas PCP signaling is best known for regulating gastrulation in
zebrafish and Xenopus, its function in mammals has only been found in neurulation and
development of specific organs, and its involvement in mammalian gastrulation has not
been examined extensively. In the current study, we attempted to establish a framework
to further define the role of Wnt11 in mammals and explore the potential involvement of
PCP in mammalian gastrulation, by generating both a high-resolution expression map of
Wnt11 and a fate map of Wnt11 expressing cells. To this end, we created a tamoxifeninducible Wnt11-CreER BAC transgene in the mouse. Analysis of this transgene over the
course of gastrulation uncovered surprisingly dynamic and specific expression of Wnt11
in the progenitors of the endodermal, endothelial and cardiac lineages, which had not
been recognized from previous in situ studies.
131
A Wnt11-CreER BAC transgene faithfully recapitulates endogenous Wnt11 expression
Due to their large size, BAC transgenes have been known to recapitulate
endogenous gene expression patterns (Lee et al., 2001). The BAC clone we used to create
Wnt11-CreER transgene contained 75-100 kb genomic sequence flanking each end of the
mouse Wnt11 locus. Our analyses of CreER-induced reporter gene expression shortly
after a pulse of tamoxifen revealed that Wnt11-CreER expression closely mimicked the
reported endogenous Wnt11 expression from gastrulation to mid-gestation (Fig.1 and
(Kispert et al., 1996). Our longer term tracing experiments further revealed expression of
Wnt11-CreER in tissues such as the endocardium, epicardium, and nephric duct (Fig.6C,
7&8), in which expression of endogenous Wnt11 has also been reported (Cohen et al.,
2012; Kispert et al., 1996). Finally, the same BAC clone (RP23-122D14) used in our
study was also used to create a separate Wnt11-Cre BAC transgenic line (Wnt11myrTagRFP-IRES-CE) as part of the GUDMAP Consortium (the GenitoUrinary
Development Molecular Anatomy Project). Although the analyses of Wnt11myrTagRFP-IRES-CE focuses on genito-urinary development, and its expression during
early
embryogenesis
has
not
been
reported
(https://www.gudmap.org/Docs/Mouse_Strains/18_Wnt11_allele_characterisation.pdf),
its ability to faithfully recapitulate endogenous Wnt11 expression in the developing
mesonephros between E11.5-15.5 supports the idea that BAC clone RP23-122D14
contains most, if not all, of the elements required to regulate Wnt11 expression.
Therefore, we predict that the expression and lineage tracing analyses performed in
gastrulation stage embryos with our Wnt11-CreER transgene reflect endogenous Wnt11
expression. The observations and conclusions that we made in the current study can be
further validated with the Wnt11-myrTagRFP-IRES-CE BAC transgene in the future.
132
Transient expression of Wnt11 in endodermal progenitors during early gastrulation
Coordinated morphogenetic movements during gastrulation result in the
establishment of the three germ layers: the endoderm, mesoderm and ectoderm. At the
onset of zebrafish gastrulation, Wnt11 is expressed in the epiblast around the germ ring
and activates PCP signaling in involuted mesendodermal cells to enable their directed
migration (Ulrich et al., 2003). Together with its closely related homolog Wnt11-r
(Wnt11-related) and Wnt4, Wnt11 also activates PCP signaling in endoderm precursors
to promote their migration toward the midline and fusion of the foregut (Matsui et al.,
2005).
In the mouse, in situ analysis indicates that at the onset of gastrulation (E6.0-6.5),
Wnt11 is expressed in scattered cells in the posterior part of the embryo around the
primitive streak (Kispert et al., 1996), but the identity and fate of these cells are
unknown. In our short-term tracing experiments, we foud that the Wnt11-CreER
transgene faithfully recapitulated this scattered expression pattern around the primitive
streak (Fig.1D). Most interestingly, our long-term tracing experiments revealed that these
Wnt11-expressing cells were predominantly progenitors of the embryonic endoderm
(Fig.2, 3 and 4). Their scattered distribution around the primitive streak suggests that
Wnt11 expression may be initiated either in the epiblast cells prior to traversing the
primitive streak, or in the specified endodermal progenitors that have exited the primitive
streak. Wnt11-CreER will be a useful tool for time-lapse imaging to track and investigate
cellular behaviors that underlie the morphogenesis of endodermal lineage.
In Xenopus gastrula, Wnt11 is also expressed in the foregut endoderm progenitors
and is proposed to act through both the canonical Wnt pathway to suppress the foregut
fate and the non-canonical pathway to promote foregut morphogenesis (Li et al., 2008).
133
Intriguingly, we found that Wnt11 expression in the mouse endodermal lineage was
transient, with expression first diminished in foregut endoderm progenitors by E7.5.
Whether the transient expression of Wnt11 is functionally required for mouse foregut
specification and morphogenesis as in Xenopus, or directed migration of endodermal cells
as in zebrafish, needs to be determined in the future. Wnt11 null mice die between E12.5
and P2 and analysis of their endodermal development has not been reported (Majumdar
et al., 2003; Nagy et al., 2010).
Early Wnt11-expressing mesodermal cells contribute to the endothelial lineage
During mid- to late gastrulation in zebrafish and Xenopus, the most prominent
expression of Wnt11 occurs in the organizers and the involuting mesoderm, where Wnt11
activates PCP signaling to regulate medio-lateral cell intercalation and promote axial
elongation (Heisenberg et al., 2000; Li et al., 2008; Schambony and Wedlich, 2007; Tada
and Smith, 2000). Studies in Xenopus further indicate that Wnt11 transcription is
activated directly by Brachyury (Xbra; T in mammals), an evolutionarily conserved
transcription factor that confers mesodermal identity to the epiblast. Consequently, Wnt11
and Xbra expression patterns are almost identical in Xenopus (Tada and Smith, 2000).
Intriguingly, although the Xbra ortholog T is also highly expressed in the mouse
organizer, the primitive streak, previous in situ studies do not detect significant Wnt11
expression in the primitive streak (Kispert et al., 1996). Our short term tracing
experiments using Wnt11-CreER indicated that Wnt11 expression was indeed absent from
the primitive streak (Fig.1D-F), and our long-term tracing experiments further revealed
that Wnt11-CreER expressing cells during gastrulation did not contribute to the paraxial
mesoderm, which T-CreER expressing cells give rise to (Anderson et al., 2013).
134
Therefore, in contrast to zebrafish and Xenopus Wnt11, mouse Wnt11 lacks expression in
the organizer, and is not transcriptionally activated by T in the primitive streak.
Whereas there is only one Wnt11 in mammals, there are two Wnt11 genes in
zebrafish, Xenopus and chick: Wnt11 and Wnt11-r. Based on sequence conservation and
synteny, it has been proposed that the two Wnt11 genes arose from an ancient
duplication, the true otholog of fish/ frog Wnt11 was lost in mammals, and the remaining
mammalian Wnt11 is in fact the ortholog of Wnt11-r (Garriock et al., 2005; Garriock et
al., 2007; Hardy et al., 2008). The lack of mouse Wnt11 expression in the primitive streak
and its strong expression in the cardiac fields like Xenopus Wnt11-r strongly support this
idea. On the other hand, the expression of mouse Wnt11 in the endoderm during early
gastrulation appears to resemble that of Xenopus Wnt11, but differ from that of Xenopus
Wnt11-r, which is not initiated until late gastrula (Garriock et al., 2005). Furthermore,
Xenopus Wnt11-r is not expressed in the node, but both previous in situ studies and our
analyses with Wnt11-CreER reveal specific expression of mouse Wnt11 in the node
(Fig.1E&F), where T is expressed (Kispert et al., 1996; Wang et al., 2006a; Yamaguchi et
al., 1999b). Therefore, it is likely that in some contexts, mouse Wnt11 could still be
transcriptionally activated by T, like Xenopus Wnt11. Collectively, these data imply that
whereas Xenopus Wnt11 and 11-r have evolved distinct expression patterns over time, the
sole Wnt11 gene in mammals has retained some features of both Wnt11 and Wnt11-r,
likely resembling the ancestral Wnt11 prior to gene duplication.
An unexpected finding from our studies with Wnt11-CreER is that during
gastrulation, the first group of mesodermal cells expressing Wnt11 contributes
specifically to the endothelial lineages in the embryonic and extra-embryonic
compartments (Fig.2, 3 & 4). This finding is important because emerging evidence
135
implicates a critical role for PCP/ non-canonical Wnt signaling in angiogenesis (Cirone et
al., 2008; Descamps et al., 2012; Korn et al., 2014; Masckauchan et al., 2006; Stefater et
al., 2011). Cell culture and zebrafish studies suggest that PCP signaling induced by noncanonical Wnts coordinates cellular polarity in endothelial cells to promote their
migration, proliferation and survival during angiogenesis (Cirone et al., 2008;
Masckauchan et al., 2006). Mouse genetic studies further reveal that endothelial cellderived non-canonical Wnts act in an autocrine fashion to promote angiogenesis in
postnatal retina and in tumors (Korn et al., 2014). Our analyses with Wnt11-CreER
extend these findings by showing that Wnt11 is not only expressed in the endothelial
lineage, but more importantly, its onset of expression occurs at early to mid-gastrulation,
when endothelial progenitors first emerge from the posterior primitive streak. Therefore,
our data raise the intriguing possibility that, in addition to angiogenesis, PCP/ noncanonical Wnt signaling may have earlier roles in endothelial progenitors prior to or
during vasculogenesis, when formation of the primitive vascular plexus takes place. In
support of this idea, mice lacking Fz2 and Fz7, two Fz receptors thought to signal
through the PCP/ non-canonical Wnt pathway, fail to form an organized vascular plexus
by E9.5, and die by E10.5 with the yolk sac engorged with blood (Yu et al., 2012). In
addition to Wnt11, Wnt5a expression has also been reported in endothelial cells (Ishikawa
et al., 2001) and Wnt11-/-; Wnt5a-/- mutants also die before E10.5 (Cohen et al., 2012). It
will be interesting to determine in the future whether Wnt11-/-; Wnt5a-/- mutants display
vascular abnormalities in addition to the reported heart defects.
Lastly, the onset of our Wnt11-CreER expression in the endothelial lineage
appears to be earlier than the widely used Tie2-Cre (Kisanuki et al., 2001). With a single
dose of tamoxifen administration at E6.5, we are able to detect extensive endothelial136
labeling in the embryonic and extra-embryonic vasculature of Wnt11-CreER; R26tdTomato embryos (Fig.3 and 4). Therefore, this Cre line can be a valuable tool for
visualizing and investigating the early morphogenetic events associated with
vasculogenesis, when groups of endothelial progenitor cells first differentiate and
assemble into a network of small capillary vessels (Udan et al., 2013).
Wnt11 in the heart
The indispensable role of mammalian Wnt11 in heart development and function is
clearly demonstrated by the severe heart defects in Wnt11-/- mutants (Cohen et al., 2012;
Majumdar et al., 2003; Nagy et al., 2010; Zhou et al., 2007). Mouse and Xenopus studies
have led to several models as to how Wnt11 functions in the heart, including promoting
myocardial specification by antagonizing canonical Wnt signaling (Cohen et al., 2012) or
activating PCP signaling to increase cardiogenic gene expression (Afouda et al., 2008;
Pandur et al., 2002), enhancing cell adhesion among ventricular cardiomyocytes
(Garriock et al., 2005; Nagy et al., 2010), and activating
expression to regulate OFT
morphogenesis (Zhou et al., 2007). Our analyses with Wnt11-CreER revealed highly
dynamic expression of Wnt11 in three major lineages of the heart, and highlight the
challenges and potential approaches to further decipher the role of Wnt11 and noncanonical Wnt/ PCP signaling in mammalian heart formation.
Among the three cardiac lineages, our fate mapping analyses with Wnt11-CreER
indicate that Wnt11 is expressed first in the progenitors of the endocardium. Extensive
contribution of tdTomato-expressing cells to the endocardium was found when tamoxifen
induction was performed at E6.5 (Fig.7), but their contribution to the myocardium did not
occur until tamoxifen induction was performed at E7.0 and later (Fig.8). This result
provides the genetic proof that in mouse, the majority of the endocardial and myocardial
137
lineages have already diverged by mid-gastrulation, before they form the cardiac
crescent. A similar conclusion was also reached in the chick by retroviral labeling of
single cells (Wei and Mikawa, 2000). Moreover, in E6.5 tamoxifen-induced embryos the
endothelium can also be labeled together with endocardium (Figs.3 and 4). Therefore, the
endocardium and endothelium may arise either from a common pool of progenitors, as
previously proposed (Milgrom-Hoffman et al., 2011), or from distinct epiblast precursors
that happen to be specified and initiate Wnt11 expression at about the same time. Time
lapse imaging with Wnt11-CreER embryos will help define the lineage relationship
between the endothelium and endocardium in the future.
In contrast to its persistent expression in the endocardium throughout all
chambers of the heart (Table 1), we found that Wnt11-CreER expression in the
myocardium was highly dynamic and occurred in three waves: first in the precursors of
the LV myocardium from E7.0 to 8.0; subsequently in the RV myocardium from E8.0 to
9.0; and finally in the OFT myocardium from E8.5 to 10.5. Its timing of expression
coincides with the timing at which the progenitors in the FHF and SHF undergo
myocardial differentiation to form the LV, RV and OFT. The expression pattern of
mouse Wnt11 in the myocardium also resembles that of Xenopus Wnt11-r (Garriock et
al., 2005).
In Xenopus, the close timing between the onset of Wnt11-r expression and
myocardial differentiation, together with the lack of myocardial specification defect in
the Wnt11-r morphant, have led to the proposal that Wnt11-r may not function by
inducing cardiac specification (Garriock et al., 2005). In contrast, mouse genetic studies
have concluded that non-canonical Wnt signaling is required for myocardial
differentiation, since Wnt11-/- mutants have smaller OFT and RV and Wnt11-/-; Wnt5a-/138
mutants display severe loss of SHF progenitors and SHF-derived heart structures (Cohen
et al., 2012). Given our finding that Wnt11 is expressed earlier in the foregut endoderm
from E6.0 and the proximity between the endoderm and the SHF, it remains possible that
endoderm-derived Wnt11 can act in a paracrine fashion to promote cardiac differentiation
in the adjacent SHF progenitors in the mouse. Consistent with this idea, Xenopus Wnt11
is transcriptionally activated directly by Gata4/6 and mediates the cardiomyogenic effect
of Gata4/6 (Afouda et al., 2008), and in the mouse Gata4/6 are expressed in the early
endoderm (Morrisey et al., 1998; Rojas et al., 2009; Rojas et al., 2010). Therefore, in the
future it will be important to investigate a potential Gata4/6 Wnt11 pathway in the
early endoderm for cardiac specification and differentiation in mouse.
The highly temporally specific and transient expression of Wnt11 in the mouse
myocardium is interesting, and may have additional implications for the potential
functions of Wnt11 in the heart. For instance, Wnt11 may act in an autocrine fashion to
enhance cell adhesion among cardiomyocytes as Xenopus Wnt11-r (Garriock et al.,
2005), and we have found recently that as SHF progenitors enter the heart tube, they
undergo a rapid up-regulation of cell cohesion (unpublished data, D.L. & J.W.).
Alternatively, Wnt11 may activate PCP signaling to induce the morphogenetic events
required for deploying myocardial progenitors from the SHF to the heart, as we have
proposed previously for another non-canonical Wnt, Wnt5a (Sinha et al., 2012). Further
manipulation of myocardial Wnt11 expression through both gain- and loss-of-function
approaches will help elucidate its role in heart development and function.
Finally, our analyses indicate that Wnt11 is also expressed in the epicardial
lineage from E9.0 onwards. The functional importance of this expression is unclear. We
note, however, that the ventricular myocardium in Wnt11-/- mutants displays reduced cell
139
adhesion and aberrant cellular arrangement at E10.5 -12.5, when Wnt11 expression
within the ventricular myocardium is already diminished (Fig.8, (Cohen et al., 2012;
Nagy et al., 2010). Therefore, it is possible that Wnt11 secreted from the epicardium
and/or endocardium can signal to the myocardium to regulate proper ventricular
formation and function.
In conclusion, our expression and lineage tracing studies with Wnt11-CreER have
revealed unexpected early and specific expression of Wnt11 in endodermal and
endothelial progenitors during mammalian gastrulation, and outlined highly dynamic and
ordered expression of Wnt11 in various cardiac lineages during heart development. The
insights gained from these findings will guide future investigations to further decipher the
role of non-canonical Wnt/ PCP signaling in gastrulation and cardiovascular
development.
Acknowledgements
This work was supported by NIH grant R01 HL109130 and American Heart Association
Grants 0635262N and 11GRNT6980004 to JW and a pre-doctoral fellowship from AHA
(12PRE12060081) to TS.
140
Figures:
Fig. 1. Generation and characterization of Wnt11-CreER BAC transgene. (A)
Schematic diagram of BAC clone RP23-122D14 that contains the 19.6 kb mouse Wnt11
locus, and 102.7 kb and 74.5 kb genomic sequence flanking the 5’ and 3’ of Wnt11,
respectively. (B, C) A CreER-T2 targeting cassette was used to partially replace the first
coding exon (exon3) of Wnt11 by BAC recombineering to create the tamoxifen-inducible
Wnt11-CreER BAC transgene. (D-H) Wnt11-CreER BAC transgenic mice were crossed
with Cre reporter R26R-LacZ and the expression pattern of Wnt11-CreER was
determined by X-gal staining to examine Cre-induced LacZ expression 6-12 hours after
tamoxifen injection. (D) When tamoxifen was injected at E6.25 and X-gal staining was
141
performed 6 hours later at E6.5, labeled cells were observed in the proximal extraembryonic region near the ectoplacental cone, and in the posterior region of the embryo
adjacent to the embryonic/extraembryonic border and the primitive streak. (E, F)
Tamoxifen injection at E7.25 and X-gal staining at E7.5 resulted in labeled cells in the
node (arrows in (E) and (F)) and the posterior end of the embryo, surrounding the
primitive streak and at the base of the allantois. (G, H) Tamoxifen administration at E9.0
and X-gal staining at E9.5 resulted in labeled cells in the posterior trunk/ tailbud region
and the nephric duct (ND, arrow in H) and in the outflow tract and the second pharyngeal
arch anteriorly (G). A (anterior); EPC (ectoplacental cone); HT (heart tube); ND (nephric
duct (ND); P (posterior); PM (pharyngeal mesoderm).
142
Fig. 2. Cells expressing Wnt11-CreER at the onset of gastrulation contribute to the
endodermal and endothelial lineages. Wnt11-CreER mediated recombination and
activation of tdTomato expression was induced by a single dose of tamoxifen
administration at E6.0, and embryos were harvested and analyzed at E8.5. (A) Epifluorescence of tdTomato alone, and (B) merged with brightfield. Saggital (C-D’) and
transverse (E-F’) sections of the embryos co-stained with DAPI (nucleus) revealed that
tdTomato expressing cells (red) were present along the endoderm from the anterior
foregut endoderm (FG, red arrows in (C) & (E); magnified images in (C’) & (E’/E”)
respectively) to the posterior endoderm (lower red arrow in (C) and upper red arrow in
(E); magnified in (E’)). A very small number of tdTomato expressing cells also coexpressed the endothelial marker PECAM (D & F) and were present in the dorsal aorta in
the embryo proper (green arrow in (D); magnified in (D’)) and as a few clusters in the
yolk sac vasculature (green arrow in (F); magnified in (F’)). The dotted line in (B)
indicates the plane of sectioning in (E) and (F). ant NT (anterior neural tube); DA (dorsal
aorta); FG endoderm (foregut endoderm); Post. endoderm (posterior endoderm); post NT
(posterior neural tube); YSV (yolk sac vasculature).
143
Fig. 3. Cells expressing Wnt11-CreER at the mid streak stage contribute to the
endodermal and mesodermal lineages. Wnt11-CreER mediated recombination and
activation of tdTomato expression was induced by a single dose of tamoxifen
administration at E6.5, and embryos were harvested and analyzed at E8.5. (A, B) Epifluorescence of tdTomato alone, and (A’, B’) merged with brightfield. (C-F) Embryo
sections co-stained with PECAM (green) and DAPI (blue) revealed that tdTomato
expressing cells occupied many more patches of the vasculature in the yolk sac (C) and
the allantois (F) when compared to E6.0 tamoxifen induced embryos (Fig.2F). Increased
contribution of tdTomato expressing cells to the endothelial lineage was also evident in
the dorsal aorta (green arrows in (D) & (D’)). TdTomato expressing cells also occupied
the entire endoderm, from the anterior to the posterior endoderm (red arrows in (C)
&(E)). Dotted lines in (A’) & (B’) indicate the plane of sectioning in (C-E). ant NT
(anterior neural tube); DA (dorsal aorta); FG (foregut); post NT (posterior neural tube);
YSV (yolk sac vasculature).
144
Fig. 4. Contribution of E6.5 Wnt11-CreER expressing cells to the endothelium and
endodermally derived internal organs in E12.5 embryos. Wnt11-CreER mediated
recombination and activation of tdTomato expression was induced by a single dose of
tamoxifen administration at E6.5, and embryos were harvested and analyzed at E12.5.
(A-D”) Whole mount epi-fluorescent analysis showed that tdTomato expressing cells
were lining the yolk-sac vasculature (A and A’), and co-expressed the endothelial marker
PECAM (B, B’ and B”). Bisection of the placenta revealed that widespread tdTomato
expression could also be observed in the placental labyrinthe (C and C’). In the placenta,
tdTomato expression was present mainly in the endothelial cells in the fetal vasculature
145
(D’ and D”) as well as the supporting chorio-allanatoic mesenchyme (yellow arrows in D
and D”) surrounding the larger placental vessels. (E-H”) In the embryo proper, tdTomato
expressing cells contributed to the endodermally derived internal organs, namely the
lungs and the gastro-intestinal tract. (E, E’, G, G’) whole mount epifluorescent analysis.
Sectioning along the indicated planes in E’ and G’ (dashed white lines) revealed that the
tdTomato expressing cells were present mostly in the epithelial lining of the lungs (white
arrows in F and F’; magnified view in F”) and stomach (white arrow in H and H’;
magnified view in H”). Eso: esophagus, GIT: gastro-intestinal tract.
146
Fig. 5. Cells expressing Wnt11-CreER at late streak stage contribute to the posterior
endoderm and distinct mesodermal tissues. Wnt11-CreER mediated recombination and
activation of tdTomato expression was induced by a single dose of tamoxifen
administration at E7.5, and embryos were harvested and analyzed at E8.75. (A) Epifluorescence of tdTomato alone, and (A’) merged with brightfield. (B) Saggital section of
the embryonic region (yellow box in (A’) revealed the contribution of tdTomato
expressing cell to the endoderm (red arrow in B), the inter-somitic vessels (ISV, green
arrows in B), the dorsal aorta (DA) and the posterior lateral plate mesoderm (tdTomatopositive cells between dorsal aorta and endoderm). (C-C”) Transverse sectioning of these
embryos along the dotted line in (A’) and co-staining with nuclear marker DAPI (blue)
and endothelial cell marker PECAM (green) showed that tdTomato expressing cells
colonized the posterior lateral plate and intermediate mesoderm (yellow arrows in C”),
147
the hindgut endoderm (red arrow in (C”)), the notochordal plate (white arrow in C”) and
the endothelial lining of the dorsal aortae (paired green arrows in C”) and the
omphalomesenteric vein (lower green arrow in C”). DA (dorsal aortae); HG (hindgut);
ISV (inter-somitic vessels); LPM (lateral plate mesoderm); NP (notochordal plate); OV
(omphalomesenteric vein).
148
Fig. 6. Wnt11-CreER expression terminates in the embryonic endoderm and the
extra-embryonic vasculature shortly after gastrulation. (A-D) In embryos in which a
single dose of tamoxifen was administered at E7.5, the contribution of tdTomato
expressing cells to the mid- (B) and hindgut (C) endoderm was reduced, and could no
longer be found in the foregut endoderm (A & D). In contrast, abundant contribution of
tdTomato expressing cells could be found in the splanchnic mesenchyme (SM)
surrounding the hindgut (C) and various vasculature. (E-L) When tamoxifen was
administered at E8.5-9.0, tdTomato expressing cells were completely absent from the
foregut (white arrows in E and H), midgut (white arrows in F) and hindgut (white arrow
149
in G) endoderm, but contributed specifically to the nephric duct (ND in G). The
contribution of tdTomato expressing cells to the extra-embryonic vasculature in the yolk
sac and placenta was also diminished. (I) Whole mount epi-fluorescence alone, and (J)
merged image with brightfield revealed no tdTomato expressing cells in the yolk sac. (K
and L) Bisection of the placenta revealed that tdTomato expressing cells also could no
longer be found in the fetal vasculature (compare to Fig.4C-D”). The limited remaining
tdTomato expression appeared to be in the extra-embryonic Reichert’s membrane. ND
(nephric duct); NT (neural tube); SM (splanchnic mesenchyme).
150
Fig. 7. Wnt11-CreER expression is initiated in the endocardial progenitors during
gastrulation and maintained in the differentiated endocardium. (A-B’) Activation of
tdTomato expression by Wnt11-CreER was induced with tamoxifen at E6.5, and embryos
were analyzed at E8.5. (A) Whole mount epi-fluorescent image of tdTomato alone, and
151
(A’), merged with brightfield. (B, B’) Transverse sectioning and co-immunostaining with
PECAM revealed that tdTomato expressing cells occupied almost the entire endocardium
lining all chamber of the forming heart tube (outlined by dotted white line), including the
inflow tract (IFT), the left ventricle and the right ventricle/OFT. By contrast, only few
tdTomato expressing cells could be found in the LV myocardium (white arrows in B and
B’). (C, C’) Tamoxifen induction at E7.5 revealed that tdTomato expressing cells
contributed exclusive to the endocardium (green arrows in C & C’), but not the
myocardium, in the OFT and RV. (D-F’) When tamoxifen induction was performed at
E10.5 and the resulting embryos analyzed at E12.5, tdTomato expressing cells could still
contribute to the entire endocardium of both the right and the left ventricles, indicating
that Wnt11-CreER expression was maintained in the differentiated endocardium. In these
embryos, tdTomato expressing cells also contributed to the epicardial layer around the
ventricles (yellow arrows in E, E’, F & F’). en (endocardium); epi (epicardium); IFT
(inflow tract); LV (left ventricle); myo (myocardium); OFT (outflow tract); RV (right
ventricle).
152
Fig. 8. Sequential activation of dynamic expression of Wnt11-CreER in the
progenitors of the ventricular myocardium. (A-D) When tamoxifen was administered
at E7.0 (A, B) and 7.5 (C, D), tdTomato-labeled cells contributed extensively to the
myocardium (MF20 positive, green) in the left ventricle and the inter-ventricular septum,
but were absent from the myocardium of the right ventricle and OFT. (E-H) When
tamoxifen was administered at E8.0, tdTomato-positive cells contributed to both the left
153
and the right ventricular myocardium, but not to the atrial or OFT myocardium (F, H). (IL) On the hand, when tamoxifen was administered at E8.5, tdTomato labeled cells
contributed to the right ventricular myocardium (K), but their contribution to the left
ventricular myocardium became diminished (L). (M-P) Finally, when tamoxifen was
administered at E9.5, the contribution of tdTomato-positive cells to the left (P) and the
right (O) ventricular myocardium was diminished. In all the stages analyzed above,
tdTomato positive cells contributed extensively to the endocardium in all chambers.
Additionally, sporadic tdTomato expressing cells were present in the epicardium of
embryos that were tamoxifen-induced at E8.5 (yellow arrow in J). The entire epicardium
became tdTomato positive when tamoxifen was administered at E9.5 (yellow arrows in
M-P). Insets in K, L, O & P showed a magnified view of tdTomato expressing cells and
MF20 positive myocardium. en (endocardium); epi (epicardium); IFT (Inflow tract); LV
(left ventricle); myo (myocardium); OFT(outflow tract); RV (right ventricle).
154
155
Fig. 9. Spatially restricted contribution of Wnt11-CreER expressing cells to the OFT
myocardium. (A-C) Whole mount epi-fluorescent analysis showed that when tamoxifen
was administered at E8.5, in the resulting E9.5 embryos tdTomato expressing cells were
largely present in the mesoderm of the 2nd pharyngeal arch (black box in A and magnified
view in B), the myocardium of the OFT superior wall and the right ventricle (blue box in
A and magnified view in C), and the endocardium of the OFT, RV and IFT. (D-I) When
embryos were harvested at E10.5 after tamoxifen induction at E9.0, tdTomato expressing
cells were observed along the proximo-distal axis of the superior myocardial wall of the
OFT (white arrow in D & F), which also co-expressed myocardial marker MF20.
Transverse section of the OFT (G-I) indicated that the tdTomato expressing cells
occupied ~3/4 of the superior and lateral OFT myocardial wall and were missing from the
inferior OFT wall (white dotted line in G-I). When E9.0 tamoxifen induced embryos
were harvested at E12.5, transverse sectioning and co-staining with MF-20 indicated that
tdTomato labeled cells were present specifically in the sub-aortic myocardium (white
arrows in J, L, M & O), but absent from sub-pulmonary myocardium (white dotted lines
in J-O). In contrast, co-staining with PECAM indicated that tdTomato labeled cells
contributed to the endocardium/endothelium in both the aorta and pulmonary artery. Ao
(aorta), BA (branchial arch); en (endocadium); IFT (inflow tract); OFT (outflow tract);
PA (pulmonary artery); PhA (pharyngeal arch); RV (right ventricle).
156
Tables:
Tamoxifen
Myocardium
Endocardium
Dissection
administration
Epi(Embryoni
(Embryonic
c Day –E)
OF
LV
RV
A
LV
RV
OFT
A
cardium
T
Day-E)
6.5
8.5
-
-
-
-
++
++
++
++
-
7.0
9.0
++
-
-
-
+++
+++
+++
++
-
7.5
9.5/10.5
+++
-
-
-
+++
+++
+++
++
-
8.0
9.5
++
++
+/-
-
+++
+++
+++
++
-
8.5
12.5/16.5
+
+++
++
-
+++
+++
+++
++
+
9.0
10.5/12.5
+/-
++
+++
-
+++
+++
+++
++
++
9.5
12.5
-
+
++
-
+++
+++
+++
++
+++
10.5
12.5
-
-
+
-
+++
+++
+++
++
+++
Table1: Summary of the spatio-temporally specific contribution of the Wnt11CreER expressing cells to the embryonic heart: Cre activity was transiently induced in
Wnt11-CreER; R26R-tdTomato embryos by a single tamoxifen administration at E6.510.5, and embryos were harvested and analyzed at E8.5-12.5 to determine the
contribution of tdTomato labeled cell in the epicardium and the myocardium and
endocardium in the left ventricle (LV), right ventricle (RV), outflow tract (OFT) and
atrium (A). The (+) and (-) indicate the presence and absence of tdTomato expressing cell
in each compartment, respectively, with (+++) indicating highest levels of tdTomato
expressing cells present.
Supplementary Data
157
Suppl. Fig. 1. Cells expressing Wnt11-CreER at E7.5 contributes to the extraembryonic vasculature. When tamoxifen induction was performed at E7.5 and the
embryos were recovered at E12.5, tdTomato expressing cells were found to line the
vasculature in the yolk sac (tdTomato fluorescence alone (A) and merged with brightfied
(A’)) and the placenta (tdTomato fluorescence alone (B) and merged with brightfield
(B’)).
158
Suppl. Fig. 2. Dynamic contribution of Wnt11-CreER expressing cells to the
ventricles. (A, A’) When tamoxifen was administered at E7.5, the resulting hearts
displayed stronger tdTomato fluorescence in the left ventricle due to specific contribution
of tdTomato cells to the left ventricular myocardium. (B, B’) Conversely, when
tamoxifen was administered at E8.5, stronger tdTomato fluorescence was observed in the
right ventricle due to specific contribution of tdTomato cells to the right ventricular
myocardium.
159
Suppl. Fig. 3. Wnt11-CreER lineage does not contribute to the inflow tract/atrial
myocardium. When tamoxifen was administered at E7.0 (A, B) or E9.0 (C, D) and
embryos were harvested at E9.0 and E10.5 respectively, no tdTomato expressing cells
were observed in the MF20 positive myocardial layer in the inflow tract/atria, but could
be found in the endocardial and epicardial layers throughout the heart. AV canal
(atrioventricular canal); IFT (inflow tract); LV (left ventricle); OFT (outflow tract).
160
References:
Aanhaanen, W. T., Brons, J. F., Dominguez, J. N., Rana, M. S., Norden, J., Airik, R., Wakker, V., de Gierde Vries, C., Brown, N. A., Kispert, A., Moorman, A. F., Christoffels, V. M., 2009. The Tbx2+
primary myocardium of the atrioventricular canal forms the atrioventricular node and the base of
the left ventricle. Circ Res. 104, 1267-74.
Abu-Issa, R., Kirby, M. L., 2008. Patterning of the heart field in the chick. Dev Biol. 319, 223-33.
Afouda, B. A., Martin, J., Liu, F., Ciau-Uitz, A., Patient, R., Hoppler, S., 2008. GATA transcription factors
integrate Wnt signalling during heart development. Development. 135, 3185-90.
Aggarwal, V. S., Morrow, B. E., 2008. Genetic modifiers of the physical malformations in velo-cardiofacial syndrome/DiGeorge syndrome. Dev Disabil Res Rev. 14, 19-25.
Ai, D., Fu, X., Wang, J., Lu, M. F., Chen, L., Baldini, A., Klein, W. H., Martin, J. F., 2007. Canonical Wnt
signaling functions in second heart field to promote right ventricular growth. Proc Natl Acad Sci
U S A. 104, 9319-24.
Anderson, M. J., Naiche, L. A., Wilson, C. P., Elder, C., Swing, D. A., Lewandoski, M., 2013. TCreERT2,
a transgenic mouse line for temporal control of Cre-mediated recombination in lineages emerging
from the primitive streak or tail bud. PLoS One. 8, e62479.
Angers, S., Moon, R. T., 2009. Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol. 10,
468-77.
Axelrod, J. D., Miller, J. R., Shulman, J. M., Moon, R. T., Perrimon, N., 1998a. Differential recruitment of
Dishevelled provides signaling specificity in the planar cell polarity and Wingless signaling
pathways. Genes Dev. 12, 2610-22.
Axelrod, J. D., Miller, J. R., Shulman, J. M., Moon, R. T., Perrimon, N., 1998b. Differential recruitment of
Dishevelled provides signaling specificity in the planar cell polarity and Wingless signaling
pathways. Genes Dev. 12, 2610-22.
Bajolle, F., Zaffran, S., Kelly, R. G., Hadchouel, J., Bonnet, D., Brown, N. A., Buckingham, M. E., 2006.
Rotation of the myocardial wall of the outflow tract is implicated in the normal positioning of the
great arteries. Circ Res. 98, 421-8.
161
Bajolle, F., Zaffran, S., Meilhac, S. M., Dandonneau, M., Chang, T., Kelly, R. G., Buckingham, M. E.,
2008. Myocardium at the base of the aorta and pulmonary trunk is prefigured in the outflow tract
of the heart and in subdomains of the second heart field. Dev Biol. 313, 25-34.
Bertrand, N., Roux, M., Ryckebusch, L., Niederreither, K., Dolle, P., Moon, A., Capecchi, M., Zaffran, S.,
Hox genes define distinct progenitor sub-domains within the second heart field. Dev Biol. 353,
266-74.
Bertrand, N., Roux, M., Ryckebusch, L., Niederreither, K., Dolle, P., Moon, A., Capecchi, M., Zaffran, S.,
2011. Hox genes define distinct progenitor sub-domains within the second heart field. Dev Biol.
353, 266-74.
Black, B. L., 2007. Transcriptional pathways in second heart field development. Semin Cell Dev Biol. 18,
67-76.
Blakely, B. D., Bye, C. R., Fernando, C. V., Horne, M. K., Macheda, M. L., Stacker, S. A., Arenas, E.,
Parish, C. L., Wnt5a regulates midbrain dopaminergic axon growth and guidance. PLoS One. 6,
e18373.
Bodmer, D., Levine-Wilkinson, S., Richmond, A., Hirsh, S., Kuruvilla, R., 2009. Wnt5a mediates nerve
growth factor-dependent axonal branching and growth in developing sympathetic neurons. J
Neurosci. 29, 7569-81.
Boutros, M., Paricio, N., Strutt, D. I., Mlodzik, M., 1998a. Dishevelled activates JNK and discriminates
between JNK pathways in planar polarity and wingless signaling. Cell. 94, 109-18.
Boutros, M., Paricio, N., Strutt, D. I., Mlodzik, M., 1998b. Dishevelled activates JNK and discriminates
between JNK pathways in planar polarity and wingless signaling. Cell. 94, 109-18.
Brown, C. B., Feiner, L., Lu, M. M., Li, J., Ma, X., Webber, A. L., Jia, L., Raper, J. A., Epstein, J. A.,
2001. PlexinA2 and semaphorin signaling during cardiac neural crest development. Development.
128, 3071-80.
Bruneau, B. G., 2008. The developmental genetics of congenital heart disease. Nature. 451, 943-8.
Buckingham, M., Meilhac, S., Zaffran, S., 2005. Building the mammalian heart from two sources of
myocardial cells. Nat Rev Genet. 6, 826-35.
162
Cai, C. L., Liang, X., Shi, Y., Chu, P. H., Pfaff, S. L., Chen, J., Evans, S., 2003. Isl1 identifies a cardiac
progenitor population that proliferates prior to differentiation and contributes a majority of cells to
the heart. Dev Cell. 5, 877-89.
Capelluto, D. G., Kutateladze, T. G., Habas, R., Finkielstein, C. V., He, X., Overduin, M., 2002. The DIX
domain targets dishevelled to actin stress fibres and vesicular membranes. Nature. 419, 726-9.
Chen, L., Fulcoli, F. G., Ferrentino, R., Martucciello, S., Illingworth, E. A., Baldini, A., Transcriptional
control in cardiac progenitors: Tbx1 interacts with the BAF chromatin remodeling complex and
regulates Wnt5a. PLoS Genet. 8, e1002571.
Chen, L., Fulcoli, F. G., Ferrentino, R., Martucciello, S., Illingworth, E. A., Baldini, A., 2012.
Transcriptional control in cardiac progenitors: Tbx1 interacts with the BAF chromatin remodeling
complex and regulates Wnt5a. PLoS Genet. 8, e1002571.
Chen, L., Fulcoli, F. G., Tang, S., Baldini, A., 2009. Tbx1 regulates proliferation and differentiation of
multipotent heart progenitors. Circ Res. 105, 842-51.
Choudhry, P., Trede, N. S., DiGeorge syndrome gene tbx1 functions through wnt11r to regulate heart
looping and differentiation. PLoS One. 8, e58145.
Cirone, P., Lin, S., Griesbach, H. L., Zhang, Y., Slusarski, D. C., Crews, C. M., 2008. A role for planar cell
polarity signaling in angiogenesis. Angiogenesis. 11, 347-60.
Cohen, E. D., Miller, M. F., Wang, Z., Moon, R. T., Morrisey, E. E., 2012. Wnt5a and Wnt11 are essential
for second heart field progenitor development. Development. 139, 1931-40.
Cohen, E. D., Wang, Z., Lepore, J. J., Lu, M. M., Taketo, M. M., Epstein, D. J., Morrisey, E. E., 2007.
Wnt/beta-catenin signaling promotes expansion of Isl-1-positive cardiac progenitor cells through
regulation of FGF signaling. J Clin Invest. 117, 1794-804.
David, R., Brenner, C., Stieber, J., Schwarz, F., Brunner, S., Vollmer, M., Mentele, E., Muller-Hocker, J.,
Kitajima, S., Lickert, H., Rupp, R., Franz, W. M., 2008. MesP1 drives vertebrate cardiovascular
differentiation through Dkk-1-mediated blockade of Wnt-signalling. Nat Cell Biol. 10, 338-45.
de Carvalho, H. F., Taboga, S. R., 1996. Fluorescence and confocal laser scanning microscopy imaging of
elastic fibers in hematoxylin-eosin stained sections. Histochem Cell Biol. 106, 587-92.
163
de la Cruz, M. V., Sanchez Gomez, C., Arteaga, M. M., Arguello, C., 1977. Experimental study of the
development of the truncus and the conus in the chick embryo. J Anat. 123, 661-86.
Descamps, B., Sewduth, R., Ferreira Tojais, N., Jaspard, B., Reynaud, A., Sohet, F., Lacolley, P., Allieres,
C., Lamaziere, J. M., Moreau, C., Dufourcq, P., Couffinhal, T., Duplaa, C., 2012. Frizzled 4
regulates arterial network organization through noncanonical Wnt/planar cell polarity signaling.
Circ Res. 110, 47-58.
Devenport, D., Fuchs, E., 2008. Planar polarization in embryonic epidermis orchestrates global asymmetric
morphogenesis of hair follicles. Nat Cell Biol. 10, 1257-68.
Diman, N. Y., Remacle, S., Bertrand, N., Picard, J. J., Zaffran, S., Rezsohazy, R., A retinoic acid
responsive Hoxa3 transgene expressed in embryonic pharyngeal endoderm, cardiac neural crest
and a subdomain of the second heart field. PLoS One. 6, e27624.
Dominguez, J. N., Meilhac, S. M., Bland, Y. S., Buckingham, M. E., Brown, N. A., Asymmetric fate of the
posterior part of the second heart field results in unexpected left/right contributions to both poles
of the heart. Circ Res. 111, 1323-35.
Dyer, L. A., Kirby, M. L., 2009a. The role of secondary heart field in cardiac development. Dev Biol. 336,
137-44.
Dyer, L. A., Kirby, M. L., 2009b. Sonic hedgehog maintains proliferation in secondary heart field
progenitors and is required for normal arterial pole formation. Dev Biol. 330, 305-17.
Dyer, L. A., Makadia, F. A., Scott, A., Pegram, K., Hutson, M. R., Kirby, M. L., BMP signaling modulates
hedgehog-induced secondary heart field proliferation. Dev Biol. 348, 167-76.
Etheridge, S. L., Ray, S., Li, S., Hamblet, N. S., Lijam, N., Tsang, M., Greer, J., Kardos, N., Wang, J.,
Sussman, D. J., Chen, P., Wynshaw-Boris, A., 2008. Murine dishevelled 3 functions in redundant
pathways with dishevelled 1 and 2 in normal cardiac outflow tract, cochlea, and neural tube
development. PLoS Genet. 4, e1000259.
Ezin, M., Fraser, S., 2008. Time-lapse imaging of the early avian embryo. Methods Cell Biol. 87, 211-36.
Feil, R., Wagner, J., Metzger, D., Chambon, P., 1997. Regulation of Cre recombinase activity by mutated
estrogen receptor ligand-binding domains. Biochem Biophys Res Commun. 237, 752-7.
164
Feiner, L., Webber, A. L., Brown, C. B., Lu, M. M., Jia, L., Feinstein, P., Mombaerts, P., Epstein, J. A.,
Raper, J. A., 2001. Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and
aortic arch interruption. Development. 128, 3061-70.
Frank, D. U., Fotheringham, L. K., Brewer, J. A., Muglia, L. J., Tristani-Firouzi, M., Capecchi, M. R.,
Moon, A. M., 2002. An Fgf8 mouse mutant phenocopies human 22q11 deletion syndrome.
Development. 129, 4591-603.
Galli, D., Dominguez, J. N., Zaffran, S., Munk, A., Brown, N. A., Buckingham, M. E., 2008. Atrial
myocardium derives from the posterior region of the second heart field, which acquires left-right
identity as Pitx2c is expressed. Development. 135, 1157-67.
Gao, B., Song, H., Bishop, K., Elliot, G., Garrett, L., English, M. A., Andre, P., Robinson, J., Sood, R.,
Minami, Y., Economides, A. N., Yang, Y., 2011. Wnt signaling gradients establish planar cell
polarity by inducing Vangl2 phosphorylation through Ror2. Dev Cell. 20, 163-76.
Garriock, R. J., D'Agostino, S. L., Pilcher, K. C., Krieg, P. A., 2005. Wnt11-R, a protein closely related to
mammalian Wnt11, is required for heart morphogenesis in Xenopus. Dev Biol. 279, 179-92.
Garriock, R. J., Warkman, A. S., Meadows, S. M., D'Agostino, S., Krieg, P. A., 2007. Census of vertebrate
Wnt genes: isolation and developmental expression of Xenopus Wnt2, Wnt3, Wnt9a, Wnt9b,
Wnt10a, and Wnt16. Dev Dyn. 236, 1249-58.
Goddeeris, M. M., Schwartz, R., Klingensmith, J., Meyers, E. N., 2007. Independent requirements for
Hedgehog signaling by both the anterior heart field and neural crest cells for outflow tract
development. Development. 134, 1593-604.
Goodrich, L. V., Strutt, D., 2011. Principles of planar polarity in animal development. Development. 138,
1877-92.
Gros, J., Hu, J. K., Vinegoni, C., Feruglio, P. F., Weissleder, R., Tabin, C. J., 2010. WNT5A/JNK and
FGF/MAPK pathways regulate the cellular events shaping the vertebrate limb bud. Curr Biol. 20,
1993-2002.
Guo, C., Sun, Y., Zhou, B., Adam, R. M., Li, X., Pu, W. T., Morrow, B. E., Moon, A., A Tbx1-Six1/Eya1Fgf8 genetic pathway controls mammalian cardiovascular and craniofacial morphogenesis. J Clin
Invest. 121, 1585-95.
165
Habas, R., Dawid, I. B., He, X., 2003. Coactivation of Rac and Rho by Wnt/Frizzled signaling is required
for vertebrate gastrulation. Genes Dev. 17, 295-309.
Habas, R., Kato, Y., He, X., 2001. Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and
requires a novel Formin homology protein Daam1. Cell. 107, 843-54.
Hamblet, N. S., Lijam, N., Ruiz-Lozano, P., Wang, J., Yang, Y., Luo, Z., Mei, L., Chien, K. R., Sussman,
D. J., Wynshaw-Boris, A., 2002. Dishevelled 2 is essential for cardiac outflow tract development,
somite segmentation and neural tube closure. Development. 129, 5827-38.
Hardy, K. M., Garriock, R. J., Yatskievych, T. A., D'Agostino, S. L., Antin, P. B., Krieg, P. A., 2008. Noncanonical Wnt signaling through Wnt5a/b and a novel Wnt11 gene, Wnt11b, regulates cell
migration during avian gastrulation. Dev Biol. 320, 391-401.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R., Stemple, D. L., Smith, J.
C., Wilson, S. W., 2000. Silberblick/Wnt11 mediates convergent extension movements during
zebrafish gastrulation. Nature. 405, 76-81.
Henderson, D. J., Conway, S. J., Greene, N. D., Gerrelli, D., Murdoch, J. N., Anderson, R. H., Copp, A. J.,
2001. Cardiovascular defects associated with abnormalities in midline development in the Looptail mouse mutant. Circ Res. 89, 6-12.
High, F. A., Jain, R., Stoller, J. Z., Antonucci, N. B., Lu, M. M., Loomes, K. M., Kaestner, K. H., Pear, W.
S., Epstein, J. A., 2009. Murine Jagged1/Notch signaling in the second heart field orchestrates
Fgf8 expression and tissue-tissue interactions during outflow tract development. J Clin Invest.
119, 1986-96.
Ho, H. Y., Susman, M. W., Bikoff, J. B., Ryu, Y. K., Jonas, A. M., Hu, L., Kuruvilla, R., Greenberg, M. E.,
Wnt5a-Ror-Dishevelled signaling constitutes a core developmental pathway that controls tissue
morphogenesis. Proc Natl Acad Sci U S A. 109, 4044-51.
Hoffman, J. I., Kaplan, S., 2002. The incidence of congenital heart disease. J Am Coll Cardiol. 39, 1890900.
Hutson, M. R., Kirby, M. L., 2003. Neural crest and cardiovascular development: a 20-year perspective.
Birth Defects Res C Embryo Today. 69, 2-13.
166
Hutson, M. R., Kirby, M. L., 2007. Model systems for the study of heart development and disease. Cardiac
neural crest and conotruncal malformations. Semin Cell Dev Biol. 18, 101-10.
Hutson, M. R., Zeng, X. L., Kim, A. J., Antoon, E., Harward, S., Kirby, M. L., Arterial pole progenitors
interpret opposing FGF/BMP signals to proliferate or differentiate. Development. 137, 3001-11.
Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y. P., Jiao, K., Schwartz, R. J., Klingensmith, J., Meyers, E. N.,
2006. Fgf8 is required for anterior heart field development. Development. 133, 2435-45.
Inagaki, T., Garcia-Martinez, V., Schoenwolf, G. C., 1993. Regulative ability of the prospective
cardiogenic and vasculogenic areas of the primitive streak during avian gastrulation. Dev Dyn.
197, 57-68.
Ishikawa, T., Tamai, Y., Zorn, A. M., Yoshida, H., Seldin, M. F., Nishikawa, S., Taketo, M. M., 2001.
Mouse Wnt receptor gene Fzd5 is essential for yolk sac and placental angiogenesis. Development.
128, 25-33.
Ivins, S., Lammerts van Beuren, K., Roberts, C., James, C., Lindsay, E., Baldini, A., Ataliotis, P.,
Scambler, P. J., 2005. Microarray analysis detects differentially expressed genes in the pharyngeal
region of mice lacking Tbx1. Dev Biol. 285, 554-69.
Jerome, L. A., Papaioannou, V. E., 2001. DiGeorge syndrome phenotype in mice mutant for the T-box
gene, Tbx1. Nat Genet. 27, 286-91.
Jessen, J. R., Topczewski, J., Bingham, S., Sepich, D. S., Marlow, F., Chandrasekhar, A., Solnica-Krezel,
L., 2002. Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal
movements. Nat Cell Biol. 4, 610-5.
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P., Sucov, H. M., 2000a. Fate of the mammalian
cardiac neural crest. Development. 127, 1607-16.
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P., Sucov, H. M., 2000b. Fate of the mammalian
cardiac neural crest. Development. 127, 1607-16.
Keller, R., 2002. Shaping the vertebrate body plan by polarized embryonic cell movements. Science. 298,
1950-4.
167
Kelly, R., Alonso, S., Tajbakhsh, S., Cossu, G., Buckingham, M., 1995. Myosin light chain 3F regulatory
sequences confer regionalized cardiac and skeletal muscle expression in transgenic mice. J Cell
Biol. 129, 383-96.
Kelly, R. G., 2012
The second heart field. Curr Top Dev Biol. 100, 33-65.
Kelly, R. G., Brown, N. A., Buckingham, M. E., 2001. The arterial pole of the mouse heart forms from
Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell. 1, 435-40.
Kelly, R. G., Buckingham, M. E., 2002. The anterior heart-forming field: voyage to the arterial pole of the
heart. Trends Genet. 18, 210-6.
Kelly, R. G., Papaioannou, V. E., 2007. Visualization of outflow tract development in the absence of Tbx1
using an FgF10 enhancer trap transgene. Dev Dyn. 236, 821-8.
Khadka, D. K., Liu, W., Habas, R., 2009. Non-redundant roles for Profilin2 and Profilin1 during vertebrate
gastrulation. Dev Biol. 332, 396-406.
Kibar, Z., Torban, E., McDearmid, J. R., Reynolds, A., Berghout, J., Mathieu, M., Kirillova, I., De Marco,
P., Merello, E., Hayes, J. M., Wallingford, J. B., Drapeau, P., Capra, V., Gros, P., 2007. Mutations
in VANGL1 associated with neural-tube defects. N Engl J Med. 356, 1432-7.
Kibar, Z., Vogan, K. J., Groulx, N., Justice, M. J., Underhill, D. A., Gros, P., 2001. Ltap, a mammalian
homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse neural tube mutant Looptail. Nat Genet. 28, 251-5.
Kilian, B., Mansukoski, H., Barbosa, F. C., Ulrich, F., Tada, M., Heisenberg, C. P., 2003. The role of
Ppt/Wnt5 in regulating cell shape and movement during zebrafish gastrulation. Mech Dev. 120,
467-76.
Kioussi, C., Briata, P., Baek, S. H., Rose, D. W., Hamblet, N. S., Herman, T., Ohgi, K. A., Lin, C.,
Gleiberman, A., Wang, J., Brault, V., Ruiz-Lozano, P., Nguyen, H. D., Kemler, R., Glass, C. K.,
Wynshaw-Boris, A., Rosenfeld, M. G., 2002. Identification of a Wnt/Dvl/beta-Catenin --> Pitx2
pathway mediating cell-type-specific proliferation during development. Cell. 111, 673-85.
Kirby, M. L., 2008. Pulmonary atresia or persistent truncus arteriosus: is it important to make the
distinction and how do we do it? Circ Res. 103, 337-9.
168
Kisanuki, Y. Y., Hammer, R. E., Miyazaki, J., Williams, S. C., Richardson, J. A., Yanagisawa, M., 2001.
Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol.
230, 230-42.
Kispert, A., Vainio, S., Shen, L., Rowitch, D. H., McMahon, A. P., 1996. Proteoglycans are required for
maintenance of Wnt-11 expression in the ureter tips. Development. 122, 3627-37.
Klaus, A., Saga, Y., Taketo, M. M., Tzahor, E., Birchmeier, W., 2007. Distinct roles of Wnt/beta-catenin
and Bmp signaling during early cardiogenesis. Proc Natl Acad Sci U S A. 104, 18531-6.
Klingensmith, J., Yang, Y., Axelrod, J. D., Beier, D. R., Perrimon, N., Sussman, D. J., 1996. Conservation
of dishevelled structure and function between flies and mice: isolation and characterization of
Dvl2. Mech Dev. 58, 15-26.
Korn, C., Scholz, B., Hu, J., Srivastava, K., Wojtarowicz, J., Arnsperger, T., Adams, R. H., Boutros, M.,
Augustin, H. G., Augustin, I., 2014. Endothelial cell-derived non-canonical Wnt ligands control
vascular pruning in angiogenesis. Development. 141, 1757-66.
Kwon, C., Arnold, J., Hsiao, E. C., Taketo, M. M., Conklin, B. R., Srivastava, D., 2007. Canonical Wnt
signaling is a positive regulator of mammalian cardiac progenitors. Proc Natl Acad Sci U S A.
104, 10894-9.
Kwon, C., Qian, L., Cheng, P., Nigam, V., Arnold, J., Srivastava, D., 2009. A regulatory pathway involving
Notch1/beta-catenin/Isl1 determines cardiac progenitor cell fate. Nat Cell Biol. 11, 951-7.
Lakso, M., Pichel, J. G., Gorman, J. R., Sauer, B., Okamoto, Y., Lee, E., Alt, F. W., Westphal, H., 1996.
Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad
Sci U S A. 93, 5860-5.
Laugwitz, K. L., Moretti, A., Lam, J., Gruber, P., Chen, Y., Woodard, S., Lin, L. Z., Cai, C. L., Lu, M. M.,
Reth, M., Platoshyn, O., Yuan, J. X., Evans, S., Chien, K. R., 2005. Postnatal isl1+ cardioblasts
enter fully differentiated cardiomyocyte lineages. Nature. 433, 647-53.
Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A.,
Copeland, N. G., 2001. A highly efficient Escherichia coli-based chromosome engineering system
adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics. 73, 56-65.
169
Leone, D. P., Genoud, S., Atanasoski, S., Grausenburger, R., Berger, P., Metzger, D., Macklin, W. B.,
Chambon, P., Suter, U., 2003. Tamoxifen-inducible glia-specific Cre mice for somatic
mutagenesis in oligodendrocytes and Schwann cells. Mol Cell Neurosci. 22, 430-40.
Li, D., Hallett, M. A., Zhu, W., Rubart, M., Liu, Y., Yang, Z., Chen, H., Haneline, L. S., Chan, R. J.,
Schwartz, R. J., Field, L. J., Atkinson, S. J., Shou, W., Dishevelled-associated activator of
morphogenesis 1 (Daam1) is required for heart morphogenesis. Development. 138, 303-15.
Li, D., Hallett, M. A., Zhu, W., Rubart, M., Liu, Y., Yang, Z., Chen, H., Haneline, L. S., Chan, R. J.,
Schwartz, R. J., Field, L. J., Atkinson, S. J., Shou, W., 2011. Dishevelled-associated activator of
morphogenesis 1 (Daam1) is required for heart morphogenesis. Development. 138, 303-15.
Li, P., Pashmforoush, M., Sucov, H. M., Retinoic acid regulates differentiation of the secondary heart field
and TGFbeta-mediated outflow tract septation. Dev Cell. 18, 480-5.
Li, P., Pashmforoush, M., Sucov, H. M., 2010. Retinoic acid regulates differentiation of the secondary heart
field and TGFbeta-mediated outflow tract septation. Dev Cell. 18, 480-5.
Li, Y., Rankin, S. A., Sinner, D., Kenny, A. P., Krieg, P. A., Zorn, A. M., 2008. Sfrp5 coordinates foregut
specification and morphogenesis by antagonizing both canonical and noncanonical Wnt11
signaling. Genes Dev. 22, 3050-63.
Liao, J., Aggarwal, V. S., Nowotschin, S., Bondarev, A., Lipner, S., Morrow, B. E., 2008. Identification of
downstream genetic pathways of Tbx1 in the second heart field. Dev Biol. 316, 524-37.
Liao, J., Kochilas, L., Nowotschin, S., Arnold, J. S., Aggarwal, V. S., Epstein, J. A., Brown, M. C., Adams,
J., Morrow, B. E., 2004. Full spectrum of malformations in velo-cardio-facial syndrome/DiGeorge
syndrome mouse models by altering Tbx1 dosage. Hum Mol Genet. 13, 1577-85.
Lijam, N., Paylor, R., McDonald, M. P., Crawley, J. N., Deng, C. X., Herrup, K., Stevens, K. E.,
Maccaferri, G., McBain, C. J., Sussman, D. J., Wynshaw-Boris, A., 1997. Social interaction and
sensorimotor gating abnormalities in mice lacking Dvl1. Cell. 90, 895-905.
Lin, L., Cui, L., Zhou, W., Dufort, D., Zhang, X., Cai, C. L., Bu, L., Yang, L., Martin, J., Kemler, R.,
Rosenfeld, M. G., Chen, J., Evans, S. M., 2007. Beta-catenin directly regulates Islet1 expression in
cardiovascular progenitors and is required for multiple aspects of cardiogenesis. Proc Natl Acad
Sci U S A. 104, 9313-8.
170
Lindsay, E. A., Botta, A., Jurecic, V., Carattini-Rivera, S., Cheah, Y. C., Rosenblatt, H. M., Bradley, A.,
Baldini, A., 1999. Congenital heart disease in mice deficient for the DiGeorge syndrome region.
Nature. 401, 379-83.
Liu, W., Sato, A., Khadka, D., Bharti, R., Diaz, H., Runnels, L. W., Habas, R., 2008. Mechanism of
activation of the Formin protein Daam1. Proc Natl Acad Sci U S A. 105, 210-5.
Logan, C. Y., Nusse, R., 2004. The Wnt signaling pathway in development and disease. Annu Rev Cell
Dev Biol. 20, 781-810.
Ma, Q., Zhou, B., Pu, W. T., 2008. Reassessment of Isl1 and Nkx2-5 cardiac fate maps using a Gata4-based
reporter of Cre activity. Dev Biol. 323, 98-104.
MacDonald, B. T., Tamai, K., He, X., 2009. Wnt/beta-catenin signaling: components, mechanisms, and
diseases. Dev Cell. 17, 9-26.
Madisen, L., Zwingman, T. A., Sunkin, S. M., Oh, S. W., Zariwala, H. A., Gu, H., Ng, L. L., Palmiter, R.
D., Hawrylycz, M. J., Jones, A. R., Lein, E. S., Zeng, H., 2010. A robust and high-throughput Cre
reporting and characterization system for the whole mouse brain. Nat Neurosci. 13, 133-40.
Majumdar, A., Vainio, S., Kispert, A., McMahon, J., McMahon, A. P., 2003. Wnt11 and Ret/Gdnf
pathways cooperate in regulating ureteric branching during metanephric kidney development.
Development. 130, 3175-85.
Manisastry, S. M., Han, M., Linask, K. K., 2006. Early temporal-specific responses and differential
sensitivity to lithium and Wnt-3A exposure during heart development. Dev Dyn. 235, 2160-74.
Masckauchan, T. N., Agalliu, D., Vorontchikhina, M., Ahn, A., Parmalee, N. L., Li, C. M., Khoo, A.,
Tycko, B., Brown, A. M., Kitajewski, J., 2006. Wnt5a signaling induces proliferation and survival
of endothelial cells in vitro and expression of MMP-1 and Tie-2. Mol Biol Cell. 17, 5163-72.
Matsui, T., Raya, A., Kawakami, Y., Callol-Massot, C., Capdevila, J., Rodriguez-Esteban, C., Izpisua
Belmonte, J. C., 2005. Noncanonical Wnt signaling regulates midline convergence of organ
primordia during zebrafish development. Genes Dev. 19, 164-75.
McCulley, D. J., Kang, J. O., Martin, J. F., Black, B. L., 2008. BMP4 is required in the anterior heart field
and its derivatives for endocardial cushion remodeling, outflow tract septation, and semilunar
valve development. Dev Dyn. 237, 3200-9.
171
McMahon, J. T., Myles, J. L., Tubbs, R. R., 2002. Demonstration of immune complex deposits using
fluorescence microscopy of hematoxylin and eosin-stained sections of Hollande's fixed renal
biopsies. Mod Pathol. 15, 988-97.
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J., Demay, M. B.,
Russell, R. G., Factor, S., Tokooya, K., Jore, B. S., Lopez, M., Pandita, R. K., Lia, M., Carrion,
D., Xu, H., Schorle, H., Kobler, J. B., Scambler, P., Wynshaw-Boris, A., Skoultchi, A. I., Morrow,
B. E., Kucherlapati, R., 2001. TBX1 is responsible for cardiovascular defects in velo-cardiofacial/DiGeorge syndrome. Cell. 104, 619-29.
Mikels, A. J., Nusse, R., 2006. Purified Wnt5a protein activates or inhibits beta-catenin-TCF signaling
depending on receptor context. PLoS Biol. 4, e115.
Milgrom-Hoffman, M., Harrelson, Z., Ferrara, N., Zelzer, E., Evans, S. M., Tzahor, E., 2011. The heart
endocardium is derived from vascular endothelial progenitors. Development. 138, 4777-87.
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J., Eisenberg, C. A., Turner,
D., Markwald, R. R., 2001. The outflow tract of the heart is recruited from a novel heart-forming
field. Dev Biol. 238, 97-109.
Moon, A., 2008. Mouse models of congenital cardiovascular disease. Curr Top Dev Biol. 84, 171-248.
Moorman, A., Webb, S., Brown, N. A., Lamers, W., Anderson, R. H., 2003. Development of the heart: (1)
formation of the cardiac chambers and arterial trunks. Heart. 89, 806-14.
Morrisey, E. E., Tang, Z., Sigrist, K., Lu, M. M., Jiang, F., Ip, H. S., Parmacek, M. S., 1998. GATA6
regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo.
Genes Dev. 12, 3579-90.
Murdoch, J. N., Doudney, K., Paternotte, C., Copp, A. J., Stanier, P., 2001. Severe neural tube defects in
the loop-tail mouse result from mutation of Lpp1, a novel gene involved in floor plate
specification. Hum Mol Genet. 10, 2593-601.
Nagy, II, Railo, A., Rapila, R., Hast, T., Sormunen, R., Tavi, P., Rasanen, J., Vainio, S. J., 2010. Wnt -11
signalling controls ventricular myocardium development by patterning N-cadherin and betacatenin expression. Cardiovasc Res. 85, 100-9.
172
Nagy, A., Gertsenstein, M., Vintersten, K., Behringer, R., 2007. Staining Whole Mouse Embryos for
{beta}-Galactosidase (lacZ) Activity. CSH Protoc. 2007, pdb prot4725.
Nassar, H., Paul, M., Ahmad, I., Berkovits, D., Bettan, M., Collon, P., Dababneh, S., Ghelberg, S., Greene,
J. P., Heger, A., Heil, M., Henderson, D. J., Jiang, C. L., Kappeler, F., Koivisto, H., O'Brien, S.,
Pardo, R. C., Patronis, N., Pennington, T., Plag, R., Rehm, K. E., Reifarth, R., Scott, R., Sinha, S.,
Tang, X., Vondrasek, R., 2005. Stellar (n,gamma) cross section of 62Ni. Phys Rev Lett. 94,
092504.
Nishita, M., Itsukushima, S., Nomachi, A., Endo, M., Wang, Z., Inaba, D., Qiao, S., Takada, S., Kikuchi,
A., Minami, Y., Ror2/Frizzled complex mediates Wnt5a-induced AP-1 activation by regulating
Dishevelled polymerization. Mol Cell Biol. 30, 3610-9.
Olson, E. N., 2006. Gene regulatory networks in the evolution and development of the heart. Science. 313,
1922-7.
Pandur, P., Lasche, M., Eisenberg, L. M., Kuhl, M., 2002. Wnt-11 activation of a non-canonical Wnt
signalling pathway is required for cardiogenesis. Nature. 418, 636-41.
Park, E. J., Watanabe, Y., Smyth, G., Miyagawa-Tomita, S., Meyers, E., Klingensmith, J., Camenisch, T.,
Buckingham, M., Moon, A. M., 2008. An FGF autocrine loop initiated in second heart field
mesoderm regulates morphogenesis at the arterial pole of the heart. Development. 135, 3599-610.
Park, T. J., Gray, R. S., Sato, A., Habas, R., Wallingford, J. B., 2005. Subcellular localization and signaling
properties of dishevelled in developing vertebrate embryos. Curr Biol. 15, 1039-44.
Patton, M. A., Afzal, A. R., 2002. Robinow syndrome. J Med Genet. 39, 305-10.
Patwardhan, V., Fernandez, S., Montgomery, M., Litvin, J., 2000. The rostro-caudal position of cardiac
myocytes affect their fate. Dev Dyn. 218, 123-35.
Person, A. D., Beiraghi, S., Sieben, C. M., Hermanson, S., Neumann, A. N., Robu, M. E., Schleiffarth, J.
R., Billington, C. J., Jr., van Bokhoven, H., Hoogeboom, J. M., Mazzeu, J. F., Petryk, A.,
Schimmenti, L. A., Brunner, H. G., Ekker, S. C., Lohr, J. L., WNT5A mutations in patients with
autosomal dominant Robinow syndrome. Dev Dyn. 239, 327-37.
173
Phillips, H. M., Murdoch, J. N., Chaudhry, B., Copp, A. J., Henderson, D. J., 2005. Vangl2 acts via RhoA
signaling to regulate polarized cell movements during development of the proximal outflow tract.
Circ Res. 96, 292-9.
Phillips, H. M., Rhee, H. J., Murdoch, J. N., Hildreth, V., Peat, J. D., Anderson, R. H., Copp, A. J.,
Chaudhry, B., Henderson, D. J., 2007. Disruption of planar cell polarity signaling results in
congenital heart defects and cardiomyopathy attributable to early cardiomyocyte disorganization.
Circ Res. 101, 137-45.
Prescott, K., Ivins, S., Hubank, M., Lindsay, E., Baldini, A., Scambler, P., 2005. Microarray analysis of the
Df1 mouse model of the 22q11 deletion syndrome. Hum Genet. 116, 486-96.
Qian, D., Jones, C., Rzadzinska, A., Mark, S., Zhang, X., Steel, K. P., Dai, X., Chen, P., 2007. Wnt5a
functions in planar cell polarity regulation in mice. Dev Biol. 306, 121-33.
Redkar, A., Montgomery, M., Litvin, J., 2001. Fate map of early avian cardiac progenitor cells.
Development. 128, 2269-79.
Reese, D. E., Mikawa, T., Bader, D. M., 2002. Development of the coronary vessel system. Circ Res. 91,
761-8.
Roarty, K., Baxley, S. E., Crowley, M. R., Frost, A. R., Serra, R., 2009. Loss of TGF-beta or Wnt5a results
in an increase in Wnt/beta-catenin activity and redirects mammary tumour phenotype. Breast
Cancer Res. 11, R19.
Robertson, E. J., Charatsi, I., Joyner, C. J., Koonce, C. H., Morgan, M., Islam, A., Paterson, C., Lejsek, E.,
Arnold, S. J., Kallies, A., Nutt, S. L., Bikoff, E. K., 2007. Blimp1 regulates development of the
posterior forelimb, caudal pharyngeal arches, heart and sensory vibrissae in mice. Development.
134, 4335-45.
Rochais, F., Dandonneau, M., Mesbah, K., Jarry, T., Mattei, M. G., Kelly, R. G., 2009a. Hes1 is expressed
in the second heart field and is required for outflow tract development. PLoS One. 4, e6267.
Rochais, F., Mesbah, K., Kelly, R. G., 2009b. Signaling pathways controlling second heart field
development. Circ Res. 104, 933-42.
174
Rojas, A., Schachterle, W., Xu, S. M., Black, B. L., 2009. An endoderm-specific transcriptional enhancer
from the mouse Gata4 gene requires GATA and homeodomain protein-binding sites for function
in vivo. Dev Dyn. 238, 2588-98.
Rojas, A., Schachterle, W., Xu, S. M., Martin, F., Black, B. L., 2010. Direct transcriptional regulation of
Gata4 during early endoderm specification is controlled by FoxA2 binding to an intronic
enhancer. Dev Biol. 346, 346-55.
Rosenquist, G. C., 1970. Location and movements of cardiogenic cells in the chick embryo: the heartforming portion of the primitive streak. Dev Biol. 22, 461-75.
Rothbacher, U., Laurent, M. N., Deardorff, M. A., Klein, P. S., Cho, K. W., Fraser, S. E., 2000.
Dishevelled phosphorylation, subcellular localization and multimerization regulate its role in early
embryogenesis. Embo J. 19, 1010-22.
Ryu, Y. K., Collins, S. E., Ho, H. Y., Zhao, H., Kuruvilla, R., An autocrine Wnt5a-Ror signaling loop
mediates sympathetic target innervation. Dev Biol. 377, 79-89.
Samanek, M., 2000. Congenital heart malformations: prevalence, severity, survival, and quality of life.
Cardiol Young. 10, 179-85.
Scambler, P. J., 2000. The 22q11 deletion syndromes. Hum Mol Genet. 9, 2421-6.
Scambler, P. J., 2010. 22q11 deletion syndrome: a role for TBX1 in pharyngeal and cardiovascular
development. Pediatr Cardiol. 31, 378-90.
Scambler, P. J., Kelly, D., Lindsay, E., Williamson, R., Goldberg, R., Shprintzen, R., Wilson, D. I.,
Goodship, J. A., Cross, I. E., Burn, J., 1992. Velo-cardio-facial syndrome associated with
chromosome 22 deletions encompassing the DiGeorge locus. Lancet. 339, 1138-9.
Schambony, A., Wedlich, D., 2007. Wnt-5A/Ror2 regulate expression of XPAPC through an alternative
noncanonical signaling pathway. Dev Cell. 12, 779-92.
Schleiffarth, J. R., Person, A. D., Martinsen, B. J., Sukovich, D. J., Neumann, A., Baker, C. V., Lohr, J. L.,
Cornfield, D. N., Ekker, S. C., Petryk, A., 2007. Wnt5a is required for cardiac outflow tract
septation in mice. Pediatr Res. 61, 386-91.
Shaner, N. C., Patterson, G. H., Davidson, M. W., 2007. Advances in fluorescent protein technology. J Cell
Sci. 120, 4247-60.
175
Sinha, T., Wang, B., Evans, S., Wynshaw-Boris, A., Wang, J., 2012. Disheveled mediated planar cell
polarity signaling is required in the second heart field lineage for outflow tract morphogenesis.
Dev Biol. 370, 135-44.
Snider, P., Olaopa, M., Firulli, A. B., Conway, S. J., 2007. Cardiovascular development and the colonizing
cardiac neural crest lineage. ScientificWorldJournal. 7, 1090-113.
Soriano, P., 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-1.
Stalsberg, H., DeHaan, R. L., 1969. The precardiac areas and formation of the tubular heart in the chick
embryo. Dev Biol. 19, 128-59.
Stefater, J. A., 3rd, Lewkowich, I., Rao, S., Mariggi, G., Carpenter, A. C., Burr, A. R., Fan, J., Ajima, R.,
Molkentin, J. D., Williams, B. O., Wills-Karp, M., Pollard, J. W., Yamaguchi, T., Ferrara, N.,
Gerhardt, H., Lang, R. A., 2011. Regulation of angiogenesis by a non-canonical Wnt-Flt1 pathway
in myeloid cells. Nature. 474, 511-5.
Stevenson, B. R., Siliciano, J. D., Mooseker, M. S., Goodenough, D. A., 1986. Identification of ZO-1: a
high molecular weight polypeptide associated with the tight junction (zonula occludens) in a
variety of epithelia. J Cell Biol. 103, 755-66.
Sugishita, Y., Leifer, D. W., Agani, F., Watanabe, M., Fisher, S. A., 2004a. Hypoxia-responsive signaling
regulates the apoptosis-dependent remodeling of the embryonic avian cardiac outflow tract. Dev
Biol. 273, 285-96.
Sugishita, Y., Watanabe, M., Fisher, S. A., 2004b. The development of the embryonic outflow tract
provides novel insights into cardiac differentiation and remodeling. Trends Cardiovasc Med. 14,
235-41.
Sugishita, Y., Watanabe, M., Fisher, S. A., 2004c. Role of myocardial hypoxia in the remodeling of the
embryonic avian cardiac outflow tract. Dev Biol. 267, 294-308.
Sun, Y., Liang, X., Najafi, N., Cass, M., Lin, L., Cai, C. L., Chen, J., Evans, S. M., 2007. Islet 1 is
expressed in distinct cardiovascular lineages, including pacemaker and coronary vascular cells.
Dev Biol. 304, 286-96.
176
Tada, M., Smith, J. C., 2000. Xwnt11 is a target of Xenopus Brachyury: regulation of gastrulation
movements via Dishevelled, but not through the canonical Wnt pathway. Development. 127,
2227-38.
Tam, P. P., Behringer, R. R., 1997. Mouse gastrulation: the formation of a mammalian body plan. Mech
Dev. 68, 3-25.
Tanegashima, K., Zhao, H., Dawid, I. B., 2008. WGEF activates Rho in the Wnt-PCP pathway and controls
convergent extension in Xenopus gastrulation. Embo J. 27, 606-17.
Theveniau-Ruissy, M., Dandonneau, M., Mesbah, K., Ghez, O., Mattei, M. G., Miquerol, L., Kelly, R. G.,
2008. The del22q11.2 candidate gene Tbx1 controls regional outflow tract identity and coronary
artery patterning. Circ Res. 103, 142-8.
Tirosh-Finkel, L., Elhanany, H., Rinon, A., Tzahor, E., 2006. Mesoderm progenitor cells of common origin
contribute to the head musculature and the cardiac outflow tract. Development. 133, 1943-53.
Topol, L., Jiang, X., Choi, H., Garrett-Beal, L., Carolan, P. J., Yang, Y., 2003. Wnt-5a inhibits the
canonical Wnt pathway by promoting GSK-3-independent beta-catenin degradation. J Cell Biol.
162, 899-908.
Torban, E., Patenaude, A. M., Leclerc, S., Rakowiecki, S., Gauthier, S., Andelfinger, G., Epstein, D. J.,
Gros, P., 2008. Genetic interaction between members of the Vangl family causes neural tube
defects in mice. Proc Natl Acad Sci U S A. 105, 3449-54.
Tree, D. R., Ma, D., Axelrod, J. D., 2002. A three-tiered mechanism for regulation of planar cell polarity.
Semin Cell Dev Biol. 13, 217-24.
Udan, R. S., Vadakkan, T. J., Dickinson, M. E., 2013. Dynamic responses of endothelial cells to changes in
blood flow during vascular remodeling of the mouse yolk sac. Development. 140, 4041-50.
Ulrich, F., Concha, M. L., Heid, P. J., Voss, E., Witzel, S., Roehl, H., Tada, M., Wilson, S. W., Adams, R.
J., Soll, D. R., Heisenberg, C. P., 2003. Slb/Wnt11 controls hypoblast cell migration and
morphogenesis at the onset of zebrafish gastrulation. Development. 130, 5375-84.
Ulrich, F., Krieg, M., Schotz, E. M., Link, V., Castanon, I., Schnabel, V., Taubenberger, A., Mueller, D.,
Puech, P. H., Heisenberg, C. P., 2005. Wnt11 functions in gastrulation by controlling cell cohesion
through Rab5c and E-cadherin. Dev Cell. 9, 555-64.
177
Umeda, K., Matsui, T., Nakayama, M., Furuse, K., Sasaki, H., Furuse, M., Tsukita, S., 2004. Establishment
and characterization of cultured epithelial cells lacking expression of ZO-1. J Biol Chem. 279,
44785-94.
van Amerongen, R., 2012. Alternative Wnt pathways and receptors. Cold Spring Harb Perspect Biol. 4.
van Amerongen, R., Nusse, R., 2009. Towards an integrated view of Wnt signaling in development.
Development. 136, 3205-14.
van den Berg, G., Abu-Issa, R., de Boer, B. A., Hutson, M. R., de Boer, P. A., Soufan, A. T., Ruijter, J. M.,
Kirby, M. L., van den Hoff, M. J., Moorman, A. F., 2009. A caudal proliferating growth center
contributes to both poles of the forming heart tube. Circ Res. 104, 179-88.
Veeman, M. T., Axelrod, J. D., Moon, R. T., 2003. A second canon. Functions and mechanisms of betacatenin-independent Wnt signaling. Dev Cell. 5, 367-77.
Verzi, M. P., McCulley, D. J., De Val, S., Dodou, E., Black, B. L., 2005. The right ventricle, outflow tract,
and ventricular septum comprise a restricted expression domain within the secondary/anterior
heart field. Dev Biol. 287, 134-45.
Vincent, S. D., Buckingham, M. E., How to make a heart: the origin and regulation of cardiac progenitor
cells. Curr Top Dev Biol. 90, 1-41.
Viragh, S., Challice, C. E., 1973. Origin and differentiation of cardiac muscle cells in the mouse. J
Ultrastruct Res. 42, 1-24.
Vitelli, F., Lania, G., Huynh, T., Baldini, A., Partial rescue of the Tbx1 mutant heart phenotype by Fgf8:
genetic evidence of impaired tissue response to Fgf8. J Mol Cell Cardiol. 49, 836-40.
Waldo, K. L., Hutson, M. R., Stadt, H. A., Zdanowicz, M., Zdanowicz, J., Kirby, M. L., 2005a. Cardiac
neural crest is necessary for normal addition of the myocardium to the arterial pole from the
secondary heart field. Dev Biol. 281, 66-77.
Waldo, K. L., Hutson, M. R., Ward, C. C., Zdanowicz, M., Stadt, H. A., Kumiski, D., Abu-Issa, R., Kirby,
M. L., 2005b. Secondary heart field contributes myocardium and smooth muscle to the arterial
pole of the developing heart. Dev Biol. 281, 78-90.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H., Kirby, M. L., 2001.
Conotruncal myocardium arises from a secondary heart field. Development. 128, 3179-88.
178
Wallingford, J. B., 2012. Planar cell polarity and the developmental control of cell behavior in vertebrate
embryos. Annu Rev Cell Dev Biol. 28, 627-53.
Wallingford, J. B., Habas, R., 2005. The developmental biology of Dishevelled: an enigmatic protein
governing cell fate and cell polarity. Development. 132, 4421-36.
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbacher, U., Fraser, S. E., Harland, R. M., 2000.
Dishevelled controls cell polarity during Xenopus gastrulation. Nature. 405, 81-5.
Wallingford, J. B., Vogeli, K. M., Harland, R. M., 2001. Regulation of convergent extension in Xenopus by
Wnt5a and Frizzled-8 is independent of the canonical Wnt pathway. Int J Dev Biol. 45, 225-7.
Wang, B., Sinha, T., Jiao, K., Serra, R., Wang, J., Disruption of PCP signaling causes limb morphogenesis
and skeletal defects and may underlie Robinow syndrome and brachydactyly type B. Hum Mol
Genet. 20, 271-85.
Wang, B., Sinha, T., Jiao, K., Serra, R., Wang, J., 2011. Disruption of PCP signaling causes limb
morphogenesis and skeletal defects and may underlie Robinow syndrome and brachydactyly type
B. Hum Mol Genet. 20, 271-85.
Wang, J., Hamblet, N. S., Mark, S., Dickinson, M. E., Brinkman, B. C., Segil, N., Fraser, S. E., Chen, P.,
Wallingford, J. B., Wynshaw-Boris, A., 2006a. Dishevelled genes mediate a conserved
mammalian PCP pathway to regulate convergent extension during neurulation. Development. 133,
1767-78.
Wang, J., Mark, S., Zhang, X., Qian, D., Yoo, S. J., Radde-Gallwitz, K., Zhang, Y., Lin, X., Collazo, A.,
Wynshaw-Boris, A., Chen, P., 2005. Regulation of polarized extension and planar cell polarity in
the cochlea by the vertebrate PCP pathway. Nat Genet. 37, 980-5.
Wang, J., Sinha, T., Wynshaw-Boris, A., 2012. Wnt signaling in mammalian development: lessons from
mouse genetics. Cold Spring Harb Perspect Biol. 4.
Wang, Y., Guo, N., Nathans, J., 2006b. The role of Frizzled3 and Frizzled6 in neural tube closure and in
the planar polarity of inner-ear sensory hair cells. J Neurosci. 26, 2147-56.
Warrington, S. J., Strutt, H., Strutt, D., The Frizzled-dependent planar polarity pathway locally promotes Ecadherin turnover via recruitment of RhoGEF2. Development. 140, 1045-54.
179
Wei, Y., Mikawa, T., 2000. Fate diversity of primitive streak cells during heart field formation in ovo. Dev
Dyn. 219, 505-13.
Wilkinson, D. G., Nieto, M. A., 1993. Detection of messenger RNA by in situ hybridization to tissue
sections and whole mounts. Methods Enzymol. 225, 361-73.
Winter, C. G., Wang, B., Ballew, A., Royou, A., Karess, R., Axelrod, J. D., Luo, L., 2001. Drosophila Rhoassociated kinase (Drok) links Frizzled-mediated planar cell polarity signaling to the actin
cytoskeleton. Cell. 105, 81-91.
Wirtz-Peitz, F., Zallen, J. A., 2009. Junctional trafficking and epithelial morphogenesis. Curr Opin Genet
Dev. 19, 350-6.
Witzel, S., Zimyanin, V., Carreira-Barbosa, F., Tada, M., Heisenberg, C. P., 2006. Wnt11 controls cell
contact persistence by local accumulation of Frizzled 7 at the plasma membrane. J Cell Biol. 175,
791-802.
Wong, G. T., Gavin, B. J., McMahon, A. P., 1994. Differential transformation of mammary epithelial cells
by Wnt genes. Mol Cell Biol. 14, 6278-86.
Xu, H., Morishima, M., Wylie, J. N., Schwartz, R. J., Bruneau, B. G., Lindsay, E. A., Baldini, A., 2004.
Tbx1 has a dual role in the morphogenesis of the cardiac outflow tract. Development. 131, 321727.
Yamaguchi, T. P., Bradley, A., McMahon, A. P., Jones, S., 1999a. A Wnt5a pathway underlies outgrowth
of multiple structures in the vertebrate embryo. Development. 126, 1211-23.
Yamaguchi, T. P., Takada, S., Yoshikawa, Y., Wu, N., McMahon, A. P., 1999b. T (Brachyury) is a direct
target of Wnt3a during paraxial mesoderm specification. Genes Dev. 13, 3185-90.
Ybot-Gonzalez, P., Savery, D., Gerrelli, D., Signore, M., Mitchell, C. E., Faux, C. H., Greene, N. D., Copp,
A. J., 2007. Convergent extension, planar-cell-polarity signalling and initiation of mouse neural
tube closure. Development. 134, 789-99.
Yelbuz, T. M., Waldo, K. L., Kumiski, D. H., Stadt, H. A., Wolfe, R. R., Leatherbury, L., Kirby, M. L.,
2002. Shortened outflow tract leads to altered cardiac looping after neural crest ablation.
Circulation. 106, 504-10.
180
Yin, C., Kiskowski, M., Pouille, P. A., Farge, E., Solnica-Krezel, L., 2008. Cooperation of polarized cell
intercalations drives convergence and extension of presomitic mesoderm during zebrafish
gastrulation. J Cell Biol. 180, 221-32.
Yu, H., Ye, X., Guo, N., Nathans, J., 2012. Frizzled 2 and frizzled 7 function redundantly in convergent
extension and closure of the ventricular septum and palate: evidence for a network of interacting
genes. Development. 139, 4383-94.
Zaffran, S., Kelly, R. G., Meilhac, S. M., Buckingham, M. E., Brown, N. A., 2004. Right ventricular
myocardium derives from the anterior heart field. Circ Res. 95, 261-8.
Zallen, J. A., 2007. Planar polarity and tissue morphogenesis. Cell. 129, 1051-63.
Zhang, J., Lin, Y., Zhang, Y., Lan, Y., Lin, C., Moon, A. M., Schwartz, R. J., Martin, J. F., Wang, F., 2008.
Frs2alpha-deficiency in cardiac progenitors disrupts a subset of FGF signals required for outflow
tract morphogenesis. Development. 135, 3611-22.
Zhang, Z., Huynh, T., Baldini, A., 2006. Mesodermal expression of Tbx1 is necessary and sufficient for
pharyngeal arch and cardiac outflow tract development. Development. 133, 3587-95.
Zhou, W., Lin, L., Majumdar, A., Li, X., Zhang, X., Liu, W., Etheridge, L., Shi, Y., Martin, J., Van de Ven,
W., Kaartinen, V., Wynshaw-Boris, A., McMahon, A. P., Rosenfeld, M. G., Evans, S. M., 2007.
Modulation of morphogenesis by noncanonical Wnt signaling requires ATF/CREB familymediated transcriptional activation of TGFbeta2. Nat Genet. 39, 1225-34.
Zhu, Y., Gramolini, A. O., Walsh, M. A., Zhou, Y. Q., Slorach, C., Friedberg, M. K., Takeuchi, J. K., Sun,
H., Henkelman, R. M., Backx, P. H., Redington, A. N., Maclennan, D. H., Bruneau, B. G., 2008.
Tbx5-dependent pathway regulating diastolic function in congenital heart disease. Proc Natl Acad
Sci U S A. 105, 5519-24.
Zorn, A. M., Wells, J. M., 2009. Vertebrate endoderm development and organ formation. Annu Rev Cell
Dev Biol. 25, 221-51.
181
5. SUMMARY
Outflow tract (OFT) morphogenesis is initiated by the addition of precursors from
the SHF to the primitive heart tube. The SHF progenitors are harbored within the
mesoderm of the rostral pharyngeal arches and the splanchnic region lying dorsal to the
heart. These progenitors undergo rapid proliferation and are gradually differentiated and
deployed to both the arterial and venous poles in a tightly regulated temporal fashion to
give rise to the myocardium, smooth muscle and endothelial cells (Kelly, 2012
). Therefore, the processes of proliferation, differentiation and deployment of these
progenitors have to be finely coordinated and any perturbations in these processes results
in significant cardiac dysmorphogenesis. Proliferation and differentiation of SHF cells
are regulated through inputs from multiple transcriptional and signaling networks such as
Wnt, TGF-β, BMP, Shh and Retinoic Acid pathways (Ai et al., 2007; Cai et al., 2003;
Cohen et al., 2007; Dyer and Kirby, 2009b; Dyer et al.; Dyer et al., 2010; Garriock et al.,
2005; Goddeeris et al., 2007; Hutson et al.; Hutson et al., 2010; Kwon et al., 2007; Kwon
et al., 2009; Li et al., 2010; Lin et al., 2007; Logan and Nusse, 2004; McCulley et al.,
2008; Park et al., 2008; Vincent and Buckingham; Zhou et al., 2007). However, the
crucial aspect of how these progenitors are deployed to the heart has been mostly
unexplored and remains unknown. The body of work in this dissertation has concentrated
upon understanding this hitherto unexamined process of recruitment of the SHF
progenitors to the heart. Through extensive genetic analysis, we have identified a novel
mechanism that involves the PCP pathway to explain how SHF progenitors may be
182
cohesively and uni-directionally recruited towards the arterial pole of the heart. Further,
mutating different components of the PCP pathway such as Dvl, Vangl2 and Wnt5a
results in severe OFT defects. Loss of Wnt5a specifically disrupts the recruitment of SHF
progenitors to the OFT and we propose that this might be one of the key pathogenic
mechanisms mediating the OFT malformations observed in DiGeorge syndrome. Finally,
extensive fate mapping studies for another presumptive PCP ligand, Wnt11, revealed a
potential role of Wnt11 in germ layer specification during mouse gastrulation and its
spatio-temporal lineage contribution during cardiogenesis. Each of these findings have
allowed us to prepare the three manuscripts assembled in this dissertation as Chapters 2,
3 and 4. The key findings from each manuscript are summarized below and have been
extensively discussed in their respective chapters. Finally, I shall outline the significance
of this work and discuss relevant future directions.
Chapter 2:
In this study, we set out to determine whether PCP signaling was required in the
SHF for development of the OFT. Dvl is a key cytoplasmic component of both the
canonical Wnt and the PCP pathway. Deleting two out of the three Dvl homologues,
Dvl1-/-; Dvl2-/- in mice resulted in the OFT malformation, DORV. To identify which
branch of the Wnt pathway was mediated by Dvl during OFT morphogenesis, we
performed genetic dissection analysis by mutating pathway specific domains of Dvl2EGFP BAC transgene and assessing its ability to rescue the OFT malformations in Dvl1-/; Dvl2-/- mutant mice. These studies revealed that Dvl2 functioned mainly through the
PCP pathway to regulate OFT morphogenesis. Since the OFT develops from two sources
of cells, the SHF and the CNC, we next examined the lineage specific requirement of
183
Dvl2 by conditionally ablating Dvl function in either the SHF or the CNC cells. Our
results demonstrated that Dvl2 mediated signaling was specifically required in the SHF
lineage and loss of Dvl2 function in the CNC cells did not interfere with OFT
morphogenesis. Interestingly, OFT defects were apparent in Dvl1/2 mutants by E9.5 and
these defects were phenocopied by loss of function mutations in other components of the
PCP pathway, namely in looptail (loss of function mutation in PCP gene, Vangl2) and
Wnt5a null mice. All three mutants displayed a significant reduction in the length of the
OFT as well as its misalignment with the ventricles. Furthermore, Wnt5a genetically
interacted with Vangl2 in this process, indicating that Wnt5a may act as a ligand to
regulate PCP signaling during OFT elongation. Strikingly, Dvl2 and Wnt5a were
observed to be highly co-expressed in the caudal SpM rather that in the OFT itself,
suggesting that Wnt5a/Dvl function may be required in the caudal SHF, outside of the
heart. The co-expression of Wnt5a and Dvl2 prompted us to analyze the SHF cells in the
SpM is greater detail. A prominent feature of the wild-type mouse SpM observed during
histological analysis is that the ventral SpM layer, lying dorsal to the heart, appeared to
exhibit uniform epithelial morphology. Additionally, the SpM is present as a contiguous
single epithelial layer rostrally whereas there are some loosely packed elongated cells
present behind this layer caudally. The caudal SpM harbors the myocardial progenitors of
the OFT and upon detailed examination, we observed that the loosely packed SHF
progenitors exhibited abnormal cellular packing, filopodia formation and actin
polymerization specifically in the caudal SpM of Dvl1/2 and Wnt5a mutants. Together,
these results allowed us to put forth a novel model to explain how SHF progenitors from
the SpM are deployed to the OFT to ensure its elongation. We proposed that Wnt5a
activated PCP signaling through Dvl2 specifically in the caudal SpM to promote
184
filopodia formation and directional intercalation of the loosely packed SHF cells into an
epithelial sheet, which in turn would provide the driving force to deploy the rostral SpM
into the OFT. This study identified an early role for PCP signaling during OFT
morphogenesis and provided the basis to understand how the deployment of SHF
progenitors promotes OFT lengthening and looping morphogenesis.
Chapter 3:
Here, we set forth to directly demonstrate that the deployment of SHF progenitors
from the SpM to the inferior OFT was dependent upon a specific component of the PCP
pathway, Wnt5a. We used multiple genetic tools in the mouse embryo that allowed us to
directly monitor SHF progenitor deployment and the contribution of these progenitors to
the OFT myocardium in control and Wnt5a-/- embryos at different stages of development.
Our results revealed that, in Wnt5a-/- embryos, SHF progenitors remain trapped in the
SpM at E10.5 and fail to be deployed efficiently to the inferior OFT, resulting in a
reduced contribution to the inferior OFT and the sub-pulmonary myocardium. We also
observed that the superior OFT myocardium is aberrantly present in the inferior region in
Wnt5a-/- embryos and the residual OFT myocardium at E12.5 displayed mostly a subaortic nature. These results suggested that a reduction in the sub-pulmonary myocardium
in Wnt5a-/- mutants resulted in a stenotic or an atretic pulmonary trunk and that the
ventricular outlet in these mutants was of an aortic identity, indicating that the OFT
malformation in Wnt5a-/- may differ from the previously described PTA phenotype.
Further, our studies in the chick embryo also helped us demonstrate that the SHF
progenitors from the caudal SpM are deployed to the OFT in a Wnt5a dependent manner.
Additionally, interfering with Wnt5a signaling activity in the chick embryo also resulted
185
in a loss of medio-lateral cell elongation and oriented cell arrangement, similar to what
was observed in the caudal SpM of mouse Wnt5a-/- mutants. Collectively, the results from
this study highlight a critical and specific role for Wnt5a in regulating the deployment of
SHF progenitors to the inferior OFT. Moreover, due to the vast similarities in the SHF
deployment and OFT malformation defects between Wnt5a and Tbx1 null mutants and
because Tbx1 can directly activate Wnt5a expression specifically in the caudal SpM
(Chen et al.; Xu et al., 2004; Zhang et al., 2006), we propose that perturbation of Wnt5a
signaling dependent morphogenetic processes may represent a key pathogenic
mechanism underlying the OFT malformations in Tbx1 mutants. Therefore, it would be
very interesting to examine if genetic variations at the WNT5A locus may modify the
penetrance of the OFT defects in the TBX1 haplo-insufficiency syndrome, the DiGeorge
syndrome in humans (Jerome and Papaioannou, 2001; Merscher et al., 2001).
Chapter 4:
PCP signaling has been shown to be an evolutionarily conserved mechanism that
regulates cellular polarity and tissue morphogenetic processes across multiple species. It
has been extensively studied during the regulation of cellular behavior and movements in
Xenopus and zebrafish gastrulation, where different non-canonical Wnts such as Wnt11
have been shown to be required for PCP signaling activation. To further explore a role for
and gain a deeper understanding of how PCP signaling might be involved during early
mammalian development, we established a high resolution expression and fate map of the
Wnt11 lineage by generating and characterizing a novel, inducible Wnt11-CreER BAC
transgene. Our short term and long term lineage analysis demonstrated that the Wnt11CreER transgene faithfully recapitulated endogenous Wnt11 expression. Further, we
186
showed for the first time that the earliest cells expressing Wnt11 transiently at
gastrulation are fated to become the entire embryonic endoderm. Subsequently, at midgastrulation, Wnt11-CreER expressing cells contribute extensively to the embryonic and
the extra-embryonic endothelium as well as to the endocardial layer in all chambers of
the heart. In contrast, Wnt11-CreER expression in the myocardium occurs in three
sequential waves: in the first wave, the precursors of the left ventricular myocardium are
labeled between E7.0 and E8.0 followed by expression in the precursors of the right
ventricular myocardium between E8.0 and E9.0; and finally in the superior OFT
myocardium between E9.0 and E10.5. These studies, in turn, provide evidence that the
endocardial and myocardial progenitors diverge as early as mid-gastrulation in the mouse
embryo and that the Wnt11-CreER lineage contribution to the myocardial compartments
occurs in a tightly regulated spatio-temporal manner that is coincident with the
development of each of the three cardiac compartments; the left ventricle from the first
heart field progenitors followed by the right ventricle and the OFT from the second heart
field progenitors. This study has provided novel insights into the dynamic contribution of
the Wnt11 lineage during early mammalian development and has opened up various
avenues to explore the role of PCP signaling during endoderm development,
vasculogenesis and heart development.
187
SIGNIFICANCE
Congenital heart malformations are the most common birth defects affecting
around 1% of all newborns in humans. Of these, OFT malformations comprise ~30% of
all CHDs (Bruneau, 2008; Olson, 2006). Elucidating the developmental mechanisms
involved in OFT formation is critical towards understanding the etiologies behind these
devastating CHDs and is the first step towards devising novel diagnostic and therapeutic
approaches in humans.
The OFT arises mainly from the contribution of two extra-cardiac lineages – the
SHF lineage which gives rise to the myocardium, the endocardium and the smooth
muscle and the CNC lineage which forms the aorticopulmonary septum and subsequently
contributes to the smooth muscle in the ascending arteries and in the mammalian outflow
valve
leaflets
(Vincent
and
Buckingham).
To
thoroughly
understand
OFT
morphogenesis, it is essential to identify how the progenitors in these two lineages are
maintained, differentiated and subsequently recruited to the OFT. These processes have
been extensively examined for the CNC lineage during OFT development across mouse
and avian model systems. Additionally, the maintenance and differentiation of the SHF
progenitor has also been well studied. However, how the SHF progenitors are deployed
to their target destination, in this case the OFT, is a paradigm that has largely escaped our
attention. Even if SHF proliferation and differentiation occur normally, it is essential for
these progenitors to be correctly recruited to the OFT. The body of work in this
dissertation addressing the crucial aspect of SHF progenitor deployment during OFT
188
morphogenesis will help to answer this hitherto unknown question in SHF progenitor
biology. Our work will significantly drive the field forward in two ways; firstly, by
providing a model to explain how cells from a region outside the heart can be efficiently
recruited to allow for OFT development and secondly, by identifying a novel role for the
PCP pathway in this process.
It has been previously shown that mutating various PCP pathway components
such as Wnt5a, Wnt11 and Vangl2 results in severe OFT defects in the form of PTA,TGA
or DORV respectively. However, the requirement for these signaling molecules has been
shown to be within the OFT itself and during later stages of cardiac development, namely
between E10.and E12.5. For example, Wnt5a and Vangl2 have been proposed to act in
the CNC and the cardiomyocytes, respectively and Wnt11 regulates endocardial and
CNC cell development through modulation of the TGF-β pathway (Henderson et al.,
2001; Phillips et al., 2005; Schleiffarth et al., 2007; Zhou et al., 2007). These are events
that occur within the OFT after the SHF progenitors have been recruited. In contrast, the
work in this dissertation has identified an earlier role for PCP signaling in SHF
progenitors, present in the SpM outside the heart and not in the OFT itself, prior to CNC
invasion.
Further, our results also demonstrate that the non-canonical Wnt, Wnt5a plays a
critical role in the deployment of these SHF progenitors from the SpM to the OFT to
mediate OFT elongation and looping morphogenesis. Initial OFT elongation occurs
through the recruitment of SHF progenitors and is essential for subsequent OFT looping
and alignment such that the CNC can appropriately septate the OFT into the aorta and the
189
pulmonary artery. Any compromise in the early process of SHF recruitment will
significantly impair the downstream events and result in abnormal OFT morphogenesis.
Therefore, the identification of a deployment mechanism underlying SHF progenitor
recruitment to the OFT has helped us understand how the disruption of this process may
be one of the primary pathogenic mechanisms underlying several different OFT
malformations. Indeed, the discovery of Wnt5a as a key regulator of SHF deployment
across two different species and the fact that it is directly activated by Tbx1 in the SHF
have allowed us to provide an explanation for the pathogenesis of the OFT malformations
observed in Tbx1 mutants as well as in the Tbx1 associated DiGeorge syndrome.
Our detailed examination of Wnt11 lineage contribution during early mammalian
development and cardiogenesis has opened up several avenues for other investigators to
explore the various roles of Wnt11 in the development of the endoderm, vasculature and
heart. The establishment and characterization of the Wnt11-CreER transgene has
identified it as an extremely useful tool to conditionally manipulate gene expression with
a tight spatio-temporal control over its expression in different lineages. Further, a very
interesting insight gained from this study is the presence of the Wnt11-CreER lineage in
the mesodermal region of the 2nd pharyngeal arch rostrally, which harbors OFT
precursors. This pattern is complimentary to the expression of the other PCP ligand,
Wnt5a, which is expressed in a reciprocal fashion by the SHF progenitors in the caudal
SpM. The Wnt11-CreER lineage was also found to specifically occupy the superior OFT
myocardium and subsequently, these cells were located in the sub-aortic myocardium.
This pattern is complimentary to that observed for the inferior OFT myocardium, which
is derived from the SHF progenitors in the caudal SpM and whose deployment is
190
controlled by Wnt5a. Since both Wnt5a and Wnt11 mouse mutants display OFT defects
in the form of PTA and TGA respectively (Schleiffarth et al., 2007; Zhou et al., 2007), it
would be interesting to identify whether Wnt11 is involved in deployment of the rostral
SHF progenitors to the superior OFT myocardial region. Moreover, Wnt5a-/-;Wnt11-/compound mutants display profound cardiovascular defects and do not survive past E10.5
(Cohen et al., 2012) suggesting that a complete loss of PCP signaling might be intolerable
for normal heart development.
An additional observation that we made during the course of this work by
morphological and Mef2c-Cre lineage analyses was that Wnt5a-/- mutants display a
considerably malformed OFT as early as E8.5 (data not shown), which is when the
process of OFT looping is just commencing. Since these defects persist throughout
development and may underlie the later OFT defects in these mutants, we propose that
PCP signaling plays a much earlier role in governing the deployment of the OFT
myocardial precursors, right from when the SHF cells are first being recruited to the
primitive heart tube. This would imply an earlier requirement for PCP signaling in SHF
progenitor deployment than what has been previously described. Further, we also
observed that at E9.5, the SHF progenitors in the caudal SpM of Wnt5a-/- mutants, which
exhibited filopodia formation and actin polymerization defects, also displayed an increase
in the localization of the adherens junction protein N-cadherin at cell-cell contacts
(Fig.1). PCP signaling has also been shown to regulate the turnover of adherens junction
components in various situations (Ulrich et al., 2005; Warrington et al.; Warrington et al.,
2013; Wirtz-Peitz and Zallen, 2009) and studies from our lab have discovered that
191
Figure 1: Wnt5a-/- mutants exhibit an up-regulation of N-cadherin in the caudal
SpM. E9.5 wild-type embryos display punctate N-cadherin (green) localization at cellcell junctions in the caudal SpM (A-A”). In contrast, there was an increase in N-cadherin
expression in the SHF progenitors in the caudal SpM of Wnt5a-/- embryos (B-B”).
Nucleus was stained with DAPI (blue). Inflow tract (IFT).
192
ectopic Wnt5a expression in the rostral SpM results in an increased turnover of Ncadherin in the SHF cells, independent of its transcription (unpublished data, DL&JW).
Therefore, it would be very interesting to determine how PCP signaling regulates cell
cohesion in the caudal SHF progenitors and whether this upregulation of cell cohesion in
Wnt5a-/- mutants may be primary or secondary to the other cellular defects exhibited by
the SHF progenitors.
All these factors together underscore the importance of studying the role of the
PCP pathway during early cardiac development. The work performed in this thesis will
conceptually advance the field of cardiovascular development by providing insights into
the molecular and cellular mechanisms involved in SHF progenitor deployment to the
OFT. The development of the SHF and its involvement in arterial pole morphogenesis
requires various levels of complexity and the examination of the role of PCP signaling in
the SHF will contribute to our knowledge of the multiple signaling pathways involved.
Finally, this work has laid a foundation for future studies involved in uncovering a link
between SHF progenitor differentiation and deployment which is critical towards
identifying the etiology underlying multiple CHDs
193
FUTURE DIRECTIONS
Our studies have demonstrated a direct role for PCP signaling in the SHF lineage
during OFT morphogenesis and have provided novel insights into how a Wnt5a mediated
signaling mechanism is involved in the deployment of SHF progenitors to the OFT. This
work has opened up several avenues for further explorations of this pathway during
cardiac development. Some of the future directions that I envision for the applications of
this project are:
1)
To specifically delineate the spatio-temporal requirements for Wnt5a signaling
during OFT morphogenesis by crossing conditional Wnt5a inactivating or overexpressing mice with inducible, lineage specific-Cre mice. Even though our results
strongly indicate that Wnt5a function is required very early in the SHF during OFT
development, these results do not completely eliminate the possibility that Wnt5a
mediated PCP signaling may be required during later stages of development and in
different cardiac lineages and compartments. Experiments to identify this spatiotemporal specificity for Wnt5a requirement in cardiac development are already
underway in our lab by employing a conditional Wnt5a gain-of-function allele and
assessing its ability to rescue the different phenotypes observed in Wnt5a-/- embryos.
2) Wnt5a and Wnt11 are expressed in a reciprocal fashion in specific regions of the
SHF and have been shown to be involved during OFT morphogenesis. Both, Wnt5a
and Wnt11, are presumptive PCP ligands and have been shown to function
194
redundantly during convergent extension in the anterior zebrafish mesendoderm but
not in the posterior mesendoderm (Kilian et al., 2003). It would be very interesting to
examine if Wnt11 also regulated the deployment of the rostral SHF progenitors to the
OFT. Further, whether the expression of Wnt11 in the Wnt5a domain could rescue
SHF deployment defects in Wnt5a-/- embryos would be an exciting question to
address the redundancy between Wnt5a and Wnt11 function during SHF
development.
3)
Wnt5a was recently shown to be directly regulated by Tbx1 in SHF (Chen et al.,
2012) and our studies have proposed that the perturbation of the Wnt5a mediated
SHF deployment process may be responsible, in a large part, for the OFT
malformations in Tbx1-/- mouse mutants as well as in the human DiGeorge syndrome.
In light of these observations, the identification of genetic variations at not only the
WNT5A locus but also at other PCP associated gene loci may allow us to predict the
penetrance and the phenotypic outcome of the OFT malformation spectrum observed
in DiGeorge syndrome patients. Additionally, a recent study in the zebrafish showed
that Tbx1 regulated OFT looping and differentiation morphogenesis through Wnt11r,
which is an orthologue of the mammalian Wnt11(Choudhry and Trede, 2013).
Whether Tbx1 also regulates mammalian Wnt11 expression in the mouse rostral SHF
to control global OFT morphogenesis is an appealing possibility for future
consideration.
4)
We have provided insights into a mechanism underlying Wnt5a mediated SHF
deployment to the OFT. However, the downstream effectors required for the
195
transduction of Wnt5a activated PCP signals to result in efficient SHF deployment
still remain to be identified. An alluring effector in this case would be the formin
homology protein, Daam1 which has been shown to regulate convergent extension
tissue morphogenesis in Xenopus through its interaction with Disheveled (Habas et
al., 2001; Liu et al., 2008). Further, Daam1 hypomorphic mouse mutants display
ventricular compaction abnormalities and OFT malformations with variable
penetrance (Li et al., 2011). Whether Daam1 or its homologue Daam2 functions in
the SHF to regulate the Wnt5a-mediated deployment of the SHF progenitors remains
to be seen.
5)
Finally, the heart is the first organ to form in both mice and humans and OFT
looping defects associated with compromised SHF deployment can be grossly
identified as early as E9.0 (~day 30 of human gestation, as per the Carnegie staging
system). Therefore, this opens up several avenues for the development of small
molecules that could spatio-temporally modulate PCP signaling and thereby provide
an opportunity for the timely rescue of OFT malformations associated with various
congenital birth syndromes.
196
8. GENERAL LIST OF REFERENCES
Aanhaanen, W. T., Brons, J. F., Dominguez, J. N., Rana, M. S., Norden, J., Airik, R.,
Wakker, V., de Gier-de Vries, C., Brown, N. A., Kispert, A., Moorman, A. F.,
Christoffels, V. M., 2009. The Tbx2+ primary myocardium of the atrioventricular canal
forms the atrioventricular node and the base of the left ventricle. Circ Res. 104, 1267-74.
Abu-Issa, R., Kirby, M. L., 2008. Patterning of the heart field in the chick. Dev Biol. 319,
223-33.
Ai, D., Fu, X., Wang, J., Lu, M. F., Chen, L., Baldini, A., Klein, W. H., Martin, J. F.,
2007. Canonical Wnt signaling functions in second heart field to promote right
ventricular growth. Proc Natl Acad Sci U S A. 104, 9319-24.
Axelrod, J. D., Miller, J. R., Shulman, J. M., Moon, R. T., Perrimon, N., 1998.
Differential recruitment of Dishevelled provides signaling specificity in the planar cell
polarity and Wingless signaling pathways. Genes Dev. 12, 2610-22.
Bajolle, F., Zaffran, S., Kelly, R. G., Hadchouel, J., Bonnet, D., Brown, N. A.,
Buckingham, M. E., 2006. Rotation of the myocardial wall of the outflow tract is
implicated in the normal positioning of the great arteries. Circ Res. 98, 421-8.
Bertrand, N., Roux, M., Ryckebusch, L., Niederreither, K., Dolle, P., Moon, A.,
Capecchi, M., Zaffran, S., Hox genes define distinct progenitor sub-domains within the
second heart field. Dev Biol. 353, 266-74.
197
Boutros, M., Paricio, N., Strutt, D. I., Mlodzik, M., 1998. Dishevelled activates JNK and
discriminates between JNK pathways in planar polarity and wingless signaling. Cell. 94,
109-18.
Bruneau, B. G., 2008. The developmental genetics of congenital heart disease. Nature.
451, 943-8.
Buckingham, M., Meilhac, S., Zaffran, S., 2005. Building the mammalian heart from two
sources of myocardial cells. Nat Rev Genet. 6, 826-35.
Cai, C. L., Liang, X., Shi, Y., Chu, P. H., Pfaff, S. L., Chen, J., Evans, S., 2003. Isl1
identifies a cardiac progenitor population that proliferates prior to differentiation and
contributes a majority of cells to the heart. Dev Cell. 5, 877-89.
Chen, L., Fulcoli, F. G., Ferrentino, R., Martucciello, S., Illingworth, E. A., Baldini, A.,
Transcriptional control in cardiac progenitors: Tbx1 interacts with the BAF chromatin
remodeling complex and regulates Wnt5a. PLoS Genet. 8, e1002571.
Choudhry, P., Trede, N. S., DiGeorge syndrome gene tbx1 functions through wnt11r to
regulate heart looping and differentiation. PLoS One. 8, e58145.
Cohen, E. D., Miller, M. F., Wang, Z., Moon, R. T., Morrisey, E. E., 2012. Wnt5a and
Wnt11 are essential for second heart field progenitor development. Development. 139,
1931-40.
Cohen, E. D., Wang, Z., Lepore, J. J., Lu, M. M., Taketo, M. M., Epstein, D. J.,
Morrisey, E. E., 2007. Wnt/beta-catenin signaling promotes expansion of Isl-1-positive
cardiac progenitor cells through regulation of FGF signaling. J Clin Invest. 117, 1794804.
David, R., Brenner, C., Stieber, J., Schwarz, F., Brunner, S., Vollmer, M., Mentele, E.,
Muller-Hocker, J., Kitajima, S., Lickert, H., Rupp, R., Franz, W. M., 2008. MesP1 drives
198
vertebrate cardiovascular differentiation through Dkk-1-mediated blockade of Wntsignalling. Nat Cell Biol. 10, 338-45.
de la Cruz, M. V., Sanchez Gomez, C., Arteaga, M. M., Arguello, C., 1977. Experimental
study of the development of the truncus and the conus in the chick embryo. J Anat. 123,
661-86.
Diman, N. Y., Remacle, S., Bertrand, N., Picard, J. J., Zaffran, S., Rezsohazy, R., A
retinoic acid responsive Hoxa3 transgene expressed in embryonic pharyngeal endoderm,
cardiac neural crest and a subdomain of the second heart field. PLoS One. 6, e27624.
Dominguez, J. N., Meilhac, S. M., Bland, Y. S., Buckingham, M. E., Brown, N. A.,
Asymmetric fate of the posterior part of the second heart field results in unexpected
left/right contributions to both poles of the heart. Circ Res. 111, 1323-35.
Dyer, L. A., Kirby, M. L., 2009. Sonic hedgehog maintains proliferation in secondary
heart field progenitors and is required for normal arterial pole formation. Dev Biol. 330,
305-17.
Dyer, L. A., Makadia, F. A., Scott, A., Pegram, K., Hutson, M. R., Kirby, M. L., BMP
signaling modulates hedgehog-induced secondary heart field proliferation. Dev Biol. 348,
167-76.
Etheridge, S. L., Ray, S., Li, S., Hamblet, N. S., Lijam, N., Tsang, M., Greer, J., Kardos,
N., Wang, J., Sussman, D. J., Chen, P., Wynshaw-Boris, A., 2008. Murine dishevelled 3
functions in redundant pathways with dishevelled 1 and 2 in normal cardiac outflow tract,
cochlea, and neural tube development. PLoS Genet. 4, e1000259.
Galli, D., Dominguez, J. N., Zaffran, S., Munk, A., Brown, N. A., Buckingham, M. E.,
2008. Atrial myocardium derives from the posterior region of the second heart field,
which acquires left-right identity as Pitx2c is expressed. Development. 135, 1157-67.
199
Garriock, R. J., D'Agostino, S. L., Pilcher, K. C., Krieg, P. A., 2005. Wnt11-R, a protein
closely related to mammalian Wnt11, is required for heart morphogenesis in Xenopus.
Dev Biol. 279, 179-92.
Goddeeris, M. M., Schwartz, R., Klingensmith, J., Meyers, E. N., 2007. Independent
requirements for Hedgehog signaling by both the anterior heart field and neural crest
cells for outflow tract development. Development. 134, 1593-604.
Guo, C., Sun, Y., Zhou, B., Adam, R. M., Li, X., Pu, W. T., Morrow, B. E., Moon, A., A
Tbx1-Six1/Eya1-Fgf8 genetic pathway controls mammalian cardiovascular and
craniofacial morphogenesis. J Clin Invest. 121, 1585-95.
Habas, R., Dawid, I. B., He, X., 2003. Coactivation of Rac and Rho by Wnt/Frizzled
signaling is required for vertebrate gastrulation. Genes Dev. 17, 295-309.
Habas, R., Kato, Y., He, X., 2001. Wnt/Frizzled activation of Rho regulates vertebrate
gastrulation and requires a novel Formin homology protein Daam1. Cell. 107, 843-54.
Hamblet, N. S., Lijam, N., Ruiz-Lozano, P., Wang, J., Yang, Y., Luo, Z., Mei, L., Chien,
K. R., Sussman, D. J., Wynshaw-Boris, A., 2002. Dishevelled 2 is essential for cardiac
outflow tract development, somite segmentation and neural tube closure. Development.
129, 5827-38.
Heisenberg, C. P., Tada, M., Rauch, G. J., Saude, L., Concha, M. L., Geisler, R.,
Stemple, D. L., Smith, J. C., Wilson, S. W., 2000. Silberblick/Wnt11 mediates
convergent extension movements during zebrafish gastrulation. Nature. 405, 76-81.
Henderson, D. J., Conway, S. J., Greene, N. D., Gerrelli, D., Murdoch, J. N., Anderson,
R. H., Copp, A. J., 2001. Cardiovascular defects associated with abnormalities in midline
development in the Loop-tail mouse mutant. Circ Res. 89, 6-12.
200
Ho, H. Y., Susman, M. W., Bikoff, J. B., Ryu, Y. K., Jonas, A. M., Hu, L., Kuruvilla, R.,
Greenberg, M. E., Wnt5a-Ror-Dishevelled signaling constitutes a core developmental
pathway that controls tissue morphogenesis. Proc Natl Acad Sci U S A. 109, 4044-51.
Hutson, M. R., Kirby, M. L., 2003. Neural crest and cardiovascular development: a 20year perspective. Birth Defects Res C Embryo Today. 69, 2-13.
Hutson, M. R., Kirby, M. L., 2007. Model systems for the study of heart development
and disease. Cardiac neural crest and conotruncal malformations. Semin Cell Dev Biol.
18, 101-10.
Hutson, M. R., Zeng, X. L., Kim, A. J., Antoon, E., Harward, S., Kirby, M. L., Arterial
pole progenitors interpret opposing FGF/BMP signals to proliferate or differentiate.
Development. 137, 3001-11.
Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y. P., Jiao, K., Schwartz, R. J., Klingensmith,
J., Meyers, E. N., 2006. Fgf8 is required for anterior heart field development.
Development. 133, 2435-45.
Inagaki, T., Garcia-Martinez, V., Schoenwolf, G. C., 1993. Regulative ability of the
prospective cardiogenic and vasculogenic areas of the primitive streak during avian
gastrulation. Dev Dyn. 197, 57-68.
Jerome, L. A., Papaioannou, V. E., 2001. DiGeorge syndrome phenotype in mice mutant
for the T-box gene, Tbx1. Nat Genet. 27, 286-91.
Jessen, J. R., Topczewski, J., Bingham, S., Sepich, D. S., Marlow, F., Chandrasekhar, A.,
Solnica-Krezel, L., 2002. Zebrafish trilobite identifies new roles for Strabismus in
gastrulation and neuronal movements. Nat Cell Biol. 4, 610-5.
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P., Sucov, H. M., 2000. Fate of the
mammalian cardiac neural crest. Development. 127, 1607-16.
201
Kelly, R. G., 2012
The second heart field. Curr Top Dev Biol. 100, 33-65.
Kelly, R. G., Brown, N. A., Buckingham, M. E., 2001. The arterial pole of the mouse
heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev Cell. 1, 435-40.
Kelly, R. G., Buckingham, M. E., 2002. The anterior heart-forming field: voyage to the
arterial pole of the heart. Trends Genet. 18, 210-6.
Kilian, B., Mansukoski, H., Barbosa, F. C., Ulrich, F., Tada, M., Heisenberg, C. P., 2003.
The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish
gastrulation. Mech Dev. 120, 467-76.
Kioussi, C., Briata, P., Baek, S. H., Rose, D. W., Hamblet, N. S., Herman, T., Ohgi, K.
A., Lin, C., Gleiberman, A., Wang, J., Brault, V., Ruiz-Lozano, P., Nguyen, H. D.,
Kemler, R., Glass, C. K., Wynshaw-Boris, A., Rosenfeld, M. G., 2002. Identification of a
Wnt/Dvl/beta-Catenin --> Pitx2 pathway mediating cell-type-specific proliferation during
development. Cell. 111, 673-85.
Klingensmith, J., Yang, Y., Axelrod, J. D., Beier, D. R., Perrimon, N., Sussman, D. J.,
1996. Conservation of dishevelled structure and function between flies and mice:
isolation and characterization of Dvl2. Mech Dev. 58, 15-26.
Kwon, C., Arnold, J., Hsiao, E. C., Taketo, M. M., Conklin, B. R., Srivastava, D., 2007.
Canonical Wnt signaling is a positive regulator of mammalian cardiac progenitors. Proc
Natl Acad Sci U S A. 104, 10894-9.
Kwon, C., Qian, L., Cheng, P., Nigam, V., Arnold, J., Srivastava, D., 2009. A regulatory
pathway involving Notch1/beta-catenin/Isl1 determines cardiac progenitor cell fate. Nat
Cell Biol. 11, 951-7.
202
Laugwitz, K. L., Moretti, A., Lam, J., Gruber, P., Chen, Y., Woodard, S., Lin, L. Z., Cai,
C. L., Lu, M. M., Reth, M., Platoshyn, O., Yuan, J. X., Evans, S., Chien, K. R., 2005.
Postnatal isl1+ cardioblasts enter fully differentiated cardiomyocyte lineages. Nature.
433, 647-53.
Li, D., Hallett, M. A., Zhu, W., Rubart, M., Liu, Y., Yang, Z., Chen, H., Haneline, L. S.,
Chan, R. J., Schwartz, R. J., Field, L. J., Atkinson, S. J., Shou, W., Dishevelledassociated activator of morphogenesis 1 (Daam1) is required for heart morphogenesis.
Development. 138, 303-15.
Li, P., Pashmforoush, M., Sucov, H. M., 2010. Retinoic acid regulates differentiation of
the secondary heart field and TGFbeta-mediated outflow tract septation. Dev Cell. 18,
480-5.
Lin, L., Cui, L., Zhou, W., Dufort, D., Zhang, X., Cai, C. L., Bu, L., Yang, L., Martin, J.,
Kemler, R., Rosenfeld, M. G., Chen, J., Evans, S. M., 2007. Beta-catenin directly
regulates Islet1 expression in cardiovascular progenitors and is required for multiple
aspects of cardiogenesis. Proc Natl Acad Sci U S A. 104, 9313-8.
Liu, W., Sato, A., Khadka, D., Bharti, R., Diaz, H., Runnels, L. W., Habas, R., 2008.
Mechanism of activation of the Formin protein Daam1. Proc Natl Acad Sci U S A. 105,
210-5.
Logan, C. Y., Nusse, R., 2004. The Wnt signaling pathway in development and disease.
Annu Rev Cell Dev Biol. 20, 781-810.
Manisastry, S. M., Han, M., Linask, K. K., 2006. Early temporal-specific responses and
differential sensitivity to lithium and Wnt-3A exposure during heart development. Dev
Dyn. 235, 2160-74.
203
McCulley, D. J., Kang, J. O., Martin, J. F., Black, B. L., 2008. BMP4 is required in the
anterior heart field and its derivatives for endocardial cushion remodeling, outflow tract
septation, and semilunar valve development. Dev Dyn. 237, 3200-9.
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J.,
Demay, M. B., Russell, R. G., Factor, S., Tokooya, K., Jore, B. S., Lopez, M., Pandita, R.
K., Lia, M., Carrion, D., Xu, H., Schorle, H., Kobler, J. B., Scambler, P., WynshawBoris, A., Skoultchi, A. I., Morrow, B. E., Kucherlapati, R., 2001. TBX1 is responsible
for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell. 104, 619-29.
Mikels, A. J., Nusse, R., 2006. Purified Wnt5a protein activates or inhibits beta-cateninTCF signaling depending on receptor context. PLoS Biol. 4, e115.
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J.,
Eisenberg, C. A., Turner, D., Markwald, R. R., 2001. The outflow tract of the heart is
recruited from a novel heart-forming field. Dev Biol. 238, 97-109.
Moon, A., 2008. Mouse models of congenital cardiovascular disease. Curr Top Dev Biol.
84, 171-248.
Moorman, A., Webb, S., Brown, N. A., Lamers, W., Anderson, R. H., 2003.
Development of the heart: (1) formation of the cardiac chambers and arterial trunks.
Heart. 89, 806-14.
Murdoch, J. N., Doudney, K., Paternotte, C., Copp, A. J., Stanier, P., 2001. Severe neural
tube defects in the loop-tail mouse result from mutation of Lpp1, a novel gene involved
in floor plate specification. Hum Mol Genet. 10, 2593-601.
Nishita, M., Itsukushima, S., Nomachi, A., Endo, M., Wang, Z., Inaba, D., Qiao, S.,
Takada, S., Kikuchi, A., Minami, Y., Ror2/Frizzled complex mediates Wnt5a-induced
AP-1 activation by regulating Dishevelled polymerization. Mol Cell Biol. 30, 3610-9.
204
Niu, Z., Yu, W., Zhang, S. X., Barron, M., Belaguli, N. S., Schneider, M. D., Parmacek,
M., Nordheim, A., Schwartz, R. J., 2005. Conditional mutagenesis of the murine serum
response factor gene blocks cardiogenesis and the transcription of downstream gene
targets. J Biol Chem. 280, 32531-8.
Olson, E. N., 2006. Gene regulatory networks in the evolution and development of the
heart. Science. 313, 1922-7.
Pandur, P., Lasche, M., Eisenberg, L. M., Kuhl, M., 2002. Wnt-11 activation of a noncanonical Wnt signalling pathway is required for cardiogenesis. Nature. 418, 636-41.
Park, E. J., Watanabe, Y., Smyth, G., Miyagawa-Tomita, S., Meyers, E., Klingensmith,
J., Camenisch, T., Buckingham, M., Moon, A. M., 2008. An FGF autocrine loop initiated
in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart.
Development. 135, 3599-610.
Park, T. J., Gray, R. S., Sato, A., Habas, R., Wallingford, J. B., 2005. Subcellular
localization and signaling properties of dishevelled in developing vertebrate embryos.
Curr Biol. 15, 1039-44.
Patwardhan, V., Fernandez, S., Montgomery, M., Litvin, J., 2000. The rostro-caudal
position of cardiac myocytes affect their fate. Dev Dyn. 218, 123-35.
Phillips, H. M., Murdoch, J. N., Chaudhry, B., Copp, A. J., Henderson, D. J., 2005.
Vangl2 acts via RhoA signaling to regulate polarized cell movements during
development of the proximal outflow tract. Circ Res. 96, 292-9.
Phillips, H. M., Rhee, H. J., Murdoch, J. N., Hildreth, V., Peat, J. D., Anderson, R. H.,
Copp, A. J., Chaudhry, B., Henderson, D. J., 2007. Disruption of planar cell polarity
signaling results in congenital heart defects and cardiomyopathy attributable to early
cardiomyocyte disorganization. Circ Res. 101, 137-45.
205
Qian, D., Jones, C., Rzadzinska, A., Mark, S., Zhang, X., Steel, K. P., Dai, X., Chen, P.,
2007. Wnt5a functions in planar cell polarity regulation in mice. Dev Biol. 306, 121-33.
Redkar, A., Montgomery, M., Litvin, J., 2001. Fate map of early avian cardiac progenitor
cells. Development. 128, 2269-79.
Roarty, K., Baxley, S. E., Crowley, M. R., Frost, A. R., Serra, R., 2009. Loss of TGFbeta or Wnt5a results in an increase in Wnt/beta-catenin activity and redirects mammary
tumour phenotype. Breast Cancer Res. 11, R19.
Robertson, E. J., Charatsi, I., Joyner, C. J., Koonce, C. H., Morgan, M., Islam, A.,
Paterson, C., Lejsek, E., Arnold, S. J., Kallies, A., Nutt, S. L., Bikoff, E. K., 2007.
Blimp1 regulates development of the posterior forelimb, caudal pharyngeal arches, heart
and sensory vibrissae in mice. Development. 134, 4335-45.
Rochais, F., Mesbah, K., Kelly, R. G., 2009. Signaling pathways controlling second heart
field development. Circ Res. 104, 933-42.
Rosenquist, G. C., 1970. Location and movements of cardiogenic cells in the chick
embryo: the heart-forming portion of the primitive streak. Dev Biol. 22, 461-75.
Ryu, Y. K., Collins, S. E., Ho, H. Y., Zhao, H., Kuruvilla, R., An autocrine Wnt5a-Ror
signaling loop mediates sympathetic target innervation. Dev Biol. 377, 79-89.
Schleiffarth, J. R., Person, A. D., Martinsen, B. J., Sukovich, D. J., Neumann, A., Baker,
C. V., Lohr, J. L., Cornfield, D. N., Ekker, S. C., Petryk, A., 2007. Wnt5a is required for
cardiac outflow tract septation in mice. Pediatr Res. 61, 386-91.
Sinha, T., Wang, B., Evans, S., Wynshaw-Boris, A., Wang, J., 2012. Disheveled
mediated planar cell polarity signaling is required in the second heart field lineage for
outflow tract morphogenesis. Dev Biol. 370, 135-44.
206
Stalsberg, H., DeHaan, R. L., 1969. The precardiac areas and formation of the tubular
heart in the chick embryo. Dev Biol. 19, 128-59.
Sugishita, Y., Leifer, D. W., Agani, F., Watanabe, M., Fisher, S. A., 2004a. Hypoxiaresponsive signaling regulates the apoptosis-dependent remodeling of the embryonic
avian cardiac outflow tract. Dev Biol. 273, 285-96.
Sugishita, Y., Watanabe, M., Fisher, S. A., 2004b. The development of the embryonic
outflow tract provides novel insights into cardiac differentiation and remodeling. Trends
Cardiovasc Med. 14, 235-41.
Sugishita, Y., Watanabe, M., Fisher, S. A., 2004c. Role of myocardial hypoxia in the
remodeling of the embryonic avian cardiac outflow tract. Dev Biol. 267, 294-308.
Tada, M., Smith, J. C., 2000. Xwnt11 is a target of Xenopus Brachyury: regulation of
gastrulation movements via Dishevelled, but not through the canonical Wnt pathway.
Development. 127, 2227-38.
Tam, P. P., Behringer, R. R., 1997. Mouse gastrulation: the formation of a mammalian
body plan. Mech Dev. 68, 3-25.
Tirosh-Finkel, L., Elhanany, H., Rinon, A., Tzahor, E., 2006. Mesoderm progenitor cells
of common origin contribute to the head musculature and the cardiac outflow tract.
Development. 133, 1943-53.
Topol, L., Jiang, X., Choi, H., Garrett-Beal, L., Carolan, P. J., Yang, Y., 2003. Wnt-5a
inhibits the canonical Wnt pathway by promoting GSK-3-independent beta-catenin
degradation. J Cell Biol. 162, 899-908.
Ulrich, F., Krieg, M., Schotz, E. M., Link, V., Castanon, I., Schnabel, V., Taubenberger,
A., Mueller, D., Puech, P. H., Heisenberg, C. P., 2005. Wnt11 functions in gastrulation
by controlling cell cohesion through Rab5c and E-cadherin. Dev Cell. 9, 555-64.
207
van den Berg, G., Abu-Issa, R., de Boer, B. A., Hutson, M. R., de Boer, P. A., Soufan, A.
T., Ruijter, J. M., Kirby, M. L., van den Hoff, M. J., Moorman, A. F., 2009. A caudal
proliferating growth center contributes to both poles of the forming heart tube. Circ Res.
104, 179-88.
Veeman, M. T., Axelrod, J. D., Moon, R. T., 2003. A second canon. Functions and
mechanisms of beta-catenin-independent Wnt signaling. Dev Cell. 5, 367-77.
Verzi, M. P., McCulley, D. J., De Val, S., Dodou, E., Black, B. L., 2005. The right
ventricle, outflow tract, and ventricular septum comprise a restricted expression domain
within the secondary/anterior heart field. Dev Biol. 287, 134-45.
Vincent, S. D., Buckingham, M. E., How to make a heart: the origin and regulation of
cardiac progenitor cells. Curr Top Dev Biol. 90, 1-41.
Viragh, S., Challice, C. E., 1973. Origin and differentiation of cardiac muscle cells in the
mouse. J Ultrastruct Res. 42, 1-24.
Waldo, K. L., Hutson, M. R., Ward, C. C., Zdanowicz, M., Stadt, H. A., Kumiski, D.,
Abu-Issa, R., Kirby, M. L., 2005. Secondary heart field contributes myocardium and
smooth muscle to the arterial pole of the developing heart. Dev Biol. 281, 78-90.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H.,
Kirby, M. L., 2001. Conotruncal myocardium arises from a secondary heart field.
Development. 128, 3179-88.
Wallingford, J. B., Habas, R., 2005. The developmental biology of Dishevelled: an
enigmatic protein governing cell fate and cell polarity. Development. 132, 4421-36.
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbacher, U., Fraser, S. E.,
Harland, R. M., 2000. Dishevelled controls cell polarity during Xenopus gastrulation.
Nature. 405, 81-5.
208
Wallingford, J. B., Vogeli, K. M., Harland, R. M., 2001. Regulation of convergent
extension in Xenopus by Wnt5a and Frizzled-8 is independent of the canonical Wnt
pathway. Int J Dev Biol. 45, 225-7.
Wang, J., Hamblet, N. S., Mark, S., Dickinson, M. E., Brinkman, B. C., Segil, N., Fraser,
S. E., Chen, P., Wallingford, J. B., Wynshaw-Boris, A., 2006. Dishevelled genes mediate
a conserved mammalian PCP pathway to regulate convergent extension during
neurulation. Development. 133, 1767-78.
Wang, J., Mark, S., Zhang, X., Qian, D., Yoo, S. J., Radde-Gallwitz, K., Zhang, Y., Lin,
X., Collazo, A., Wynshaw-Boris, A., Chen, P., 2005. Regulation of polarized extension
and planar cell polarity in the cochlea by the vertebrate PCP pathway. Nat Genet. 37,
980-5.
Warrington, S. J., Strutt, H., Strutt, D., The Frizzled-dependent planar polarity pathway
locally promotes E-cadherin turnover via recruitment of RhoGEF2. Development. 140,
1045-54.
Winter, C. G., Wang, B., Ballew, A., Royou, A., Karess, R., Axelrod, J. D., Luo, L.,
2001. Drosophila Rho-associated kinase (Drok) links Frizzled-mediated planar cell
polarity signaling to the actin cytoskeleton. Cell. 105, 81-91.
Wirtz-Peitz, F., Zallen, J. A., 2009. Junctional trafficking and epithelial morphogenesis.
Curr Opin Genet Dev. 19, 350-6.
Wong, G. T., Gavin, B. J., McMahon, A. P., 1994. Differential transformation of
mammary epithelial cells by Wnt genes. Mol Cell Biol. 14, 6278-86.
Xu, H., Morishima, M., Wylie, J. N., Schwartz, R. J., Bruneau, B. G., Lindsay, E. A.,
Baldini, A., 2004. Tbx1 has a dual role in the morphogenesis of the cardiac outflow tract.
Development. 131, 3217-27.
209
Yelbuz, T. M., Waldo, K. L., Kumiski, D. H., Stadt, H. A., Wolfe, R. R., Leatherbury, L.,
Kirby, M. L., 2002. Shortened outflow tract leads to altered cardiac looping after neural
crest ablation. Circulation. 106, 504-10.
Zaffran, S., Kelly, R. G., Meilhac, S. M., Buckingham, M. E., Brown, N. A., 2004. Right
ventricular myocardium derives from the anterior heart field. Circ Res. 95, 261-8.
Zhang, Z., Huynh, T., Baldini, A., 2006. Mesodermal expression of Tbx1 is necessary
and sufficient for pharyngeal arch and cardiac outflow tract development. Development.
133, 3587-95.
Zhou, W., Lin, L., Majumdar, A., Li, X., Zhang, X., Liu, W., Etheridge, L., Shi, Y.,
Martin, J., Van de Ven, W., Kaartinen, V., Wynshaw-Boris, A., McMahon, A. P.,
Rosenfeld, M. G., Evans, S. M., 2007. Modulation of morphogenesis by noncanonical
Wnt signaling requires ATF/CREB family-mediated transcriptional activation of
TGFbeta2. Nat Genet. 39, 1225-34.
210
APPENDIX
211