Download Fig. 7 Cancer cell signaling pathways and the cellular processes

The History of Cancer and Its Treatments
Osher Lecture 5
May 8, 2013
Recent History
(after a reminder of how DNA encodes proteins)
Russell Doolittle, PhD
DNA: A Double-Helix
Sugars
phosphate
links
(desoxyribose)
One base pair
A:T
G:C
Complementary nitrogen bases
(A:T, G:C) directed inward
Proteins are composed of long chains of amino acids.
During the 1950’s techniques were developed that allowed
the sequence of amino acids in a protein to be determined.
The sequence of amino acids in a protein is simply the order
in which the amino acids occur, starting at the amino-terminus.
During the 1960’s and 70’s, numerous proteins were “sequenced”
and the relationship of proteins and organisms at the molecular
level was firmly established.
In 1978, new cutting and pasting techniques set the stage for
DNA sequencing and eventually to the Human Genome project.
It is much easier to find the sequence of a protein by translating
the DNA sequence of its gene than by the old chemical methods.
Current methodology allows DNA sequencing to be
conducted on a massive scale.
What all cancers have in common is DNA damage that
leads to run-away cell division.
It is a kind of cellular evolution where natural selection
favors those that divide most rapidly.
The DNA damage results in altered proteins, the
interactions of which often promote more DNA damage.
It is much easier to disrupt a protein’s structure and
function than it is to make it more active, but both kinds
of alteration occur.
DNA
RNA
Protein
DNA is composed of 4 kinds of unit: A, G, C, T.
RNA is composed of 4 kinds of unit: A, G, C, U.
proteins are composed of 20 kinds of unit: amino acids
A triplet code (three units of DNA or RNA) is necessary to
distinguish 20 amino acids.
For example, AAA (DNA) is transcribed as UUU, which is
translated as the amino acid phenylalanine.
If one of the units in the DNA is mutated, e.g., AAA -> ATA,
this will be transcribed as UAU, which is translated as the
amino acid tyrosine.
Coding
ATGAGATACTCCTTTAAAGGG…etc
DNA: TACTCTATGAGGAAATTTCCC…etc
RNA: AUGAGAUACUCCUUUAAAGGG…etc
RNA: AUG AGA UAC UCC UUU AAA GGG…etc
(taken three at a time)
Protein: Met-Arg-His-Ser-Phe-Lys-Gly…etc
Protein: MRHSFKG…etc (in single-letter code)
Synonymous mutations
base substitution gives rise to same
amino acid
Non-synonymous mutations
base substitution gives rise to
different amino acid
The ratio of non- synonymous mutations to
synonymous ones is an index of non-random survival.
Today the determination of DNA sequences is a highly automated
process.
Most protein sequences are gotten by translating (decoding) DNA
sequences.
It is possible to sequence the DNA of cancer cells taken
directly from tumors to see what changes have occurred
during their lifetime compared with nearby healthy tissue.
A reminder about signaling pathways.
The cell is crowded.
Bumping into old pals in the subway crowd.
Things can go awry during all these cell divisions.
Gene Expression
Although all your cells (well, almost all) have all the DNA encoding all your
genes, different cells express different genes.
They are able to do this because the expression of genes is highly regulated
by factors that prevent or encourage copying to RNA (by the enzyme RNA
polymerase) .
Regulation occurs at the gene product stage also, by activating or inactivating
enzymes and other proteins.
Various forms of somatic damage to DNA
Simple base replacements (e.g., A for G, C for T, etc.)
Deletions or insertions of pieces of DNA.
Chromosomal translocations (exchanges of pieces).
Amplification (increase in “copy number”).
Speaking very generally, there are two kinds of altered
proteins in cancer cells.
In one kind, the mutated protein acquires new
power: “gain-of-function.” Many of these are
hyperactive kinases (often “gatekeepers”).
In the other kind, the mutated protein is inactivated.
Many of these are “tumor suppressors” (“caretakers”).
Generally speaking, it is easier to make a drug that
can inactivate a “gain-of-function” sort than it is to
find one that can restore function to a “caretaker.”
An example of a suppressor gene: p53 and cell death
More than half of all cancers involve a gene product called p53.
In 1993, Science magazine named p53 “Molecule of the Year”
and had its structure on the cover.
In an accompanying editorial the hope was expressed that “a cure
of a terrible killer (would occur) in the not too distant future.”
The “hope” was that damaged molecules of p53 could be fixed.
p53 is a tumor suppressor; here is how it works.
When p53 is not working properly, cells with damaged DNA keep
dividing.
Moreover, the progeny of those cells with damaged DNA spawn
even more cells with even more damaged DNA.
Those progeny cells with stuck accelerators quickly outrace the others.
Carriers of a mutated p53 gene (in their genome) have
a 95% lifetime risk of developing cancer.
Now for the recent stuff.
A few terms:
WGS = Whole Genome Sequencing.
exome = the 1-2% of the genome that is expressed as protein.
sbs = single base substitution = snv = single nucleotide variant.
CNV = copy number variation (more than one gene
for the same protein as a result of gene duplication)
cancer susceptibility genes (caretakers and gatekeepers).
driver gene mutations, directly or indirectly, confer a selective
growth advantage for the cell in which they occur.
passenger gene mutations have no direct or indirect effect on the
growth of the cell in which they occur.
The March 29, 2013 issue of Science carried a special section on
Cancer Genomics
Many of the following slides are from those very recent articles.
The main theme has to do with the sequencing of cancer genomes.
colorectal
Numbers of non-synonymous
mutations per cell line
lung
melanoma
colorectal
breast
AML
CLL ALL
Fig. 2 Genetic alterations and the progression of colorectal cancer.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 3 Total alterations affecting protein-coding genes in selected tumors.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
p53 complex
PIK3CA
mutant PIK3CA
Fig. 4 Distribution of mutations in two oncogenes (PIK3CA and IDH1) and two tumor
suppressor genes (RB1 and VHL).
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
B. Vogelstein et al, Science 2013;339:1546-1558
Fig. 5 Number and distribution of driver gene mutations in five tumor types.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 6 Four types of genetic heterogeneity in tumors, illustrated by a primary tumor in the
pancreas and its metastatic lesions in the liver.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 7 Cancer cell signaling pathways and the cellular processes they regulate.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Fig. 8 Signal transduction pathways affected by mutations in human cancer.
B Vogelstein et al. Science 2013;339:1546-1558
Published by AAAS
Like snowflakes and fingerprints, no
two cancers are exactly alike.
However, there are a limited number of very
susceptible locations in the genome, and the same
signaling pathways are disrupted in many different
settings.
On other fronts, there have been some spectacular successes
recently in treating adult leukemias (AML and CML) by
modifying the patient’s own white cells that makes them
attack cancer cells.
However,
The future: cancer prevention by DNA screening
It will soon be routine to have some aspect of WGS
performed at birth (think PKU screening at present)
or during pregnancy.
It will also be possible to screen for certain cancers
before they become malignant, perhaps including
lung (sequence DNA from cells in sputum), colon
(DNA from stool samples), and prostate (urine)
Treatment will take various guises, including the
usual routes (surgery), as well as very targeted
chemotherapy directed at the altered signaling pathways.
But who will pay?
Beware the military-industrial-complex (Eisenhauer, 1961)
Today we would say:
Beware the pharmaceutical-congressional-complex.