Download Chapter 13: Genetic Engineering

Chapter 13:
Genetic
Engineering
DNA Technology
DNA Technology – science involved in the
ability to manipulate genes/DNA
 Purpose:

◦ Cure disease (Cystic Fibrosis)
◦ Treat genetic disorders (Hemophilia, diabetes)
◦ Improve food crops (better tasting, longer
shelf life, fungus resistance…)
◦ Improve human life in general
◦ Helps us ID genes for traits
How could you get a desired trait without
directly manipulating the organisms’ DNA?
Selective Breeding
- choosing organisms with desired
traits to produce the next generation
 Breeding the winners of a horse race
(Smarty Jones)
 Taking the seeds from the
Great Pumpkin

Hybridization

Crossing organisms of different traits
to produce a hardier product
Ex. A mule is a cross of a horse and a
donkey – Sturdy and surefooted
Hybrid corn – tastes good and is more
resistant to disease.
Inbreeding
Maintaining the present genes by
breeding only within the population
 Ex. Pedigree animals
 Risk with dipping into the same gene
pool and recessive traits showing
up that may be lethal or harmful.

Inducing mutations
By using known mutagens, attempt to
force mutations to occur
 Radiation & Chemicals
 Not a sure bet nor do you know what
you are going to get
 Polyploidy (3N or 4N) plants have
resulted from this – larger & hardier
DNA Technology:
ex: Gene Therapy
Treatment of a genetic disorder (like
cystic fibrous) by correcting a
defective gene that causes a
deficiency of an enzyme.
 Nasal spray that carries normal
enzyme gene. Body makes enzyme
and patient breathes normally.
Regular treatments necessary
 Has not been proven to be successful
in the long term

The Tools:





DNA Extraction – Chemical procedure
(we’ll do this)
Restriction enzymes – molecular
scissors that cut DNA at specific
nucleotide sequences
Gel Electrophoresis – method to
analyze fragments of DNA cut by
restriction enzymes through a gel
made of agarose (molecular sieve)
DNA Ligase – molecular glue that puts
pieces of DNA together
Polymerase Chain Reaction (PCR)molecular copy machine. Makes
millions of copies of DNA/hr
Let’s suppose that you are a diabetic
and can not make your own insulin.
What are you to do?
Inject insulin of course but from what
source?
 Old method was to use sheep insulin.
Costly and labor intensive
 New method: Let bacteria with a
human insulin producing gene make
it for you

The Method:
 Transformation of a
bacterium to produce human
insulin
1. Extract the insulin
producing gene from a
healthy human
2. Using a restriction
enzyme, cut the insulin
producing gene out of a the
DNA
What are restriction enzymes?
Bacterial enzymes – used to cut
bacteriophage DNA (viruses that
invade bacteria).
 Different bacterial strains express
different restriction enzymes
 Restriction enzymes recognize a
specific short nucleotide sequence
 For example, Eco RI recognizes the
sequence:

 5’ - G A A T T C - 3’
 3’ - C T T A A G - 5’
 Pandindrones same base pairing forward and
backwards
Let’s try some cutting:

Using this piece of DNA, cut it with Eco RI
 G/AATTC




GACCGAATTCAGTTAATTCGAATTC
CTGGCTTAAGTCAATTAAGCTTAAG
GACCG/AATTCAGTTAATTCG/AATTC
CTGGCTTAA/GTCAATTAAGCTTAA/G
What results is:
GACCG AATTCAGTTAATTCG AATTC
 CTGGCTTAA
GTCAATTAAGCTTAA G

Sticky end
Sticky end - tails
of DNA – easily
bind to other
DNA strands
Blunt & Sticky ends

Sticky ends – Creates an overhang. EcoRI

Blunts- Enzymes that cut at precisely
opposite sites without overhangs. SmaI is
an example of an enzyme that generates
blunt ends
3. Cut cloning vector:

Use bacterial plasmids
◦ Plasmids will be cut with the
same restriction enzyme used
to cut the desired gene



4. Ligation - Donor gene (desired gene)
is then spliced or annealed into the
plasmid
using DNA ligase as the glue.
Recombinant DNA - DNA with new
piece
of genetic information on it
5. Plasmid is then returned to
bacterium and reproduces with donor
gene in it.
Transgenic organism – organism with
foreign DNA incorporated in its
genome (genes)
6. Bacterium reproduces and starts
producing human insulin gene which we
harvest from them.
Recombinant DNA
Donor Gene