* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Nuevas estrategias para la identificación de aditivos y alimentos
Promoter (genetics) wikipedia , lookup
Gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA barcoding wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
SNP genotyping wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nuevas estrategias para la identificación de aditivos y alimentos Curso de Aditivos y su Aplicación en la Industria Alimentaria A.F.C.A.-Cámara de Comercio Palma de Mallorca, 6-8 Marzo, 2001 Universitat de les Illes Balears and IMEDEA (CSIC-UIB) Area de Microbiología Departamento de Biología y Departamento de Recursos Naturales Vicente J. Benedí 1 Applications of analytical molecular biology methods. 1 • Agriculture: pathogen detection, plant breeding programs, GMO detection, cultivar identification • Animal husbandry: detection and treatment of infections, genetic selection, sex identification • Human health: genetic diseases, infectious diseases, cancer diseases, etc. • Environment & Ecology: Species identification, symbiotic interactions, assessment of biodiversity • Forensic science: individual and familial identification, scene of crime 2 Applications of analytical molecular biology methods. 2 • Food: pathogen detection, product/species identification, adulteration detection, origin tracing, GMO detection • Law enforcement: trading standards, better definitions, etc. – Verify compliance with legislative requirements and maximum permitted levels – Confirm the authenticity of raw materials – Improve understanding of the basic mechanisms of, e.g., gel formation, formulations, etc. 3 DNA: the universal (biological) analyte • • • • • Almost universal (RNA viruses) Extremely stable Polymorphic and informative Trace amounts can be amplified Easy to work with: isolation, amplification, detection, analysis 4 DNA and its building blocks DNA is certainly a molecule composed only by four blocks (or nucleotides) called A, C, G, and T. Combinations of these four blocks give different messages which code for all proteins necessary for all living functions. 5 Examples of languages (messages) English Musical Score Morse code Chinese DNA The DNA message is then a specific language. Understanding these languages is crucial to understanding the messages. In the DNA case, there are some messages (sequences) that we know they code for some proteins or functions. 6 DNA vs. amino acid information The DNA language is certainly more informative than other biological messages. For example, each amino acid is coded by three nucleotides, so we have at least three times more information when we read the DNA sequences than when we read the protein sequence. Furthermore, since the DNA code is “degenerate” (one amino acid can be coded by more than one nucleotide triplet), there is usually more than three times information at the nucleotides than that at the amino acid level. An example of the consequences of these DNA properties can be observed in the slide. 7 DNA information is conserved Another feature of the DNA messages that is important for our purposes is that they read basically the same (are conserved) among the phylogenetic tree. In this real example, DNA sequences implicated in sex determination in humans and whales are compared. Most of the sequences from the two species are the same, as can be expected since they code for the same message (function). However, both species can clearly be differentiated by specific sequence variations. 8 DNA sequences in public databanks (March 08, 2001) 9 The Polymerase Chain Reaction A method based on DNA has a further advantage over those based on other biological molecules. By using the polymerase chain reaction (PCR), a few DNA molecules can be copied many times (amplified) following the scheme shown in the slide. For this, it is necessary and key to design two short DNA pieces (called primers) specific for the two extremes of the DNA sequence to be copied. 10 Amplification step of the PCR Once these primers have annealed to their complementary sequences on the target DNA, the selected sequence between the two primers can be copied many times. Thus, from a few molecules, one can obtain thousand of copies of the original sequence, provided that the primers are really specific, I.e, they anneal to the desired two ends of the sequence to be amplified. 11 Technical variables and detection 12 Locust bean or guar? Molecular methods for detecting additions of guar gum to locust bean gum Universitat de les Illes Balears and IMEDEA (CSIC-UIB) Area de Microbiología Departamento de Biología y Departamento de Recursos Naturales Vicente J. Benedí This work was presented at the annual meeting of the Institut Européen des Industries de la Gomme de Caroube (INEC) hold in Granada, Spain in May 200. It describes the preexisting methods for discriminating between the locust bean gum (LBG)and guar gum, two gellifier agents extracted from the carob tree (Ceratonia siliqua) and the guar plant (Cyamopsis tetragonolobus or C. tetragonoloba). Also, new methods based on DNA identification are described. The interest in this discrimination comes from the different prices of the two additives, the LBG being more expensive than the guar gum. 13 • Spain is the major producer of LBG • The Balearic Islands are the 2nd in Spain • LBG (E 410) vs. guar (E 412) has: • Better properties as gelling agent • No health related problems • Higher price Garrofín Guar In this slide, we summarize the properties of both locust bean gum (LBG) and guar gum. Clearly, there is a major difference in price between the two additives, thus opening the possibilty of frauds. 14 E 410 vs. E 412: what the EC says (I. Definitions) Off. J. of the E.C. L334, 09.12.98 E 410 Locust bean gum is the ground endosperm of the seeds of the natural strains of carob tree, Cerationia siliqua (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans E 412 Guar gum is the ground endosperm of the seeds of the natural strains of guar plant, Cyamopsis tetragonlobus (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans LBG and guar gum are food additives subjected to regulations and coded as E410 and E412 respectively. This slide shows the official definition published in the Official Journal of the European Communities, i.e., the official definition for most European countries. We have copied that definition, even with its mistake in the scientific name of carob tree, and have highlighted in red the differences between the two additives. Please note that for the Official Journal, the only differences are the plant species from which the additives are extracted. 15 E 410 vs. E 412: what the EC says (II. Identification) Off. J. of the E.C. L334, 09.12.98 E 410 A. Positive tests for galactose mannose B. Microscopic examination (see next slide) C. Solubility: soluble in hot water, insoluble in ethanol E 412 A. Positive tests for galactose mannose B. Solubility: soluble in cold water Both additives are theoretically identified by the official tests shown in this slide. It can be seen that bot are galactomannans, i.e., polymers of galactose and mannose, with guar gum being more soluble in cold water than LBG. Microscopic examination requires further explanation, since it can be used for differentiation. This is shown in more detail in the next slides. 16 E 410 vs. E 412: what the EC says (II. Identification) B. Microscopical identification (Place some…containing 0.5% iodine and…and examine under the microscope.) Locust bean gum contains long stretched tubiform cells, separated or highly interspaced. Their brown contents are much less regularly formed in guar gum. Guar gum shows close groups of round to pear shaped cells. Their contents are yellow to brown. E 410 E 412 Following the official methods, LBG and guar gum preparations can be stained and observed under the microscope. As shown in this slide, these two gums show clearly different structures which can help to identify them. 17 E 410 vs. E 412: what the EC says (II. Identification) A Control LBG B Control Guar gum Following these microscopical methods, we studied a commercial mixture of both gums (top panel), and, after magnification, we identified two different structures (middle panels). These two structures resemble those observed for the control pure gums (bottom panels). However, these methods are subjective and may require intensive observation when facing a fraud mixture of low percentage guar in LBG. 18 Other methods from literature • Methods based on the polysaccharide composition • Galactose to mannose ratios • Methods based on the polysaccharide composition and structure • Lectin assays Two other types of methods have been described in the literature for the identification of LBG and guar gum. Both types are base on the polysaccharide nature of the gums, and it is worthwhile to explain them in more detail in the next few slides. 19 Mannose to galactose ratios (I) • EC says nothing in E 410 and E 412 descriptions • But when describes E 417 says that mannose:galactose ratios are – 3:1 for E 417 (m-m-m-m-m-m-m-m-m-m-m-m)n I I I I g g g g – 4:1 for E 410 (m-m-m-m-m-m-m-m-m-m-m-m)n I I I g g g – 2:1 for E 412 (m-m-m-m-m-m-m-m-m-m-m-m)n I I I I I I g g g g g g The European Communities Journal does not specify in the definitions for LBG (E410) and guar gum (E412) the composition of these galactomannans. However, when it defines the tara gum (E417), a gum that was commercially introduced later than the other two gums, the Journal gives three different mannose:galactose ratios for the three polysaccharides. 20 Mannose to galactose ratios (II) • 4:1 for E 410; 2:1 for E 412 • But, different ratios have been described: – 3.0:1 and 1.5:1 (Preuss and Their, Z Lebensm Unters Forsch, 175:93, 1982) – 2.7:1 and 1.4:1 (Angelini et al, Riv Soc Ital Alim, 13:479, 1984) – 3.7:1 and 2.3:1 (Cheetham et al, Carbohyd Pol 6:257, 1986) – 3.7 to 7.7:1 depending on the solubilization temperature of E 410 (Lopes da Silva and Gonzales, Foof Hydrocol. 4:277, 1990) However, these differences cannot be exploited for the differentiation of LBG and guar gum, since the literature describes variations in the galactose to mannose ratios. It would still be possible, for isolated gums, to ensure if the analyzed sample is LBG or guar because for LBG these ratios are always higher than for guar gum. However, in a fraud situation, when a theoretically pure LBG sample may contain 5% guar, these variations in the galactose to mannose ratio make impossible to ensure the presence of guar. 21 Mannose to galactose ratios (III) • Variations difficult demonstration of E 412 presence in E 410/E 412 mixtures • Furthermore, man:gal ratios will be affected if other food additives (e.g., man from E 415) • Also, man and gal can be present in processed foods, thus affecting the man:gal ratios Techniques are cumbersome and require complex extractions Methods based on the galactose to mannose ratio are further limited by other considerations. First, the food industry often use combinations of additives. So for example, the presence of additive E415 will affect the ratio due to the mannose of this additive. Also, mannose and galactose are present in many processed foods, thus affecting the galactose to mannose ratio of the food additives. Finally, the methods required to study galactose to mannose ratios are cumbersome and require complex extractions and derivatizations. 22 Lectin assays • Lectins are plant proteins which bind polysaccharides • Different lectins bind different polysaccharides • Patel et al. (Leatherhead Food RA) LBG lectin enzyme guar GUAR support immobilized lectin LBG lectin binds guar but not LBG bound guar is detected with the same lectin labeled with an enzyme color readings A second type of method described by Patel and colleagues use lectins. This plant-derived proteins bind some polysaccharides through specific interactions between a given lectin and a polysaccharide sequence. It has been described that one of such lectins can be used in an ELISA-type method to detect guar gums, since it will bind guar and not LBG. The principles of the method is shown on this slide. 23 Enzyme-Linked Lectin Assay (ELLA) 1.2 Optical density 1.0 0.8 0.6 0.4 0.2 0 LBG Guar Tara E 410 commercial samples buffer However, when we used the quantitative lectin-based methods (called ELLA by the original authors) we found the results shown in this slide. Certainly, the ELLA method, when applied to pure control preparations of LBG (yellow bars) and guar gum (red bars) is able to differentiate the by their different reactivity with the enzyme-labeled lectin, with LBG being more reactive. The tara gum (blue bars) gave values between those of the two other gums. However, when this method was applied to commercial preparations labeled as “LBG”, we obtained a whole range of reactivities, and for many of these samples it was no possible to rule out the possible presence of guar gum. 24 Development of new (DNA-based) methods E 410 Locust bean gum is the ground endosperm of the seeds of the natural strains of carob tree, Cerationia siliqua (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans E 412 Guar gum is the ground endosperm of the seeds of the natural strains of guar plant, Cyamopsis tetragonlobus (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans We then decided to develop a new method for the reliable detection and differentiation of guar gum and LBG. This method will be based on: • The fact that the gums are extracted from two plants of different genuses and species. • DNA sequences which could be specific from these two plants 25 Seeds as sources of DNA • Germination of seeds (carob and guar) • Extraction of DNA from fresh tissues • PCR amplification of extracted DNA • Electrophoretic analysis of amplification products G U A R L B G Marker 1 G U A R L B G Marker 2 On germinated seeds of the guar plant and carob tree, we have found two DNA regions that we called “markers” because they exist in both plants but (as seen in the next slides) with specific differences in their sequences depending on the species. 26 Unveiling the Markers sequences • Isolation of markers from gel • Sequencing L B G G U A R Marker 1 L B G G U A R Marker 2 GUAR sequence (Marker 1) ACCTTCCTCTTCAGCATTGTTCCAAAGGCATCCACTTGGACGCCTTCCTAGTAACAG CTACGGAGTGTTCGTCAGGCTGGGCACTTGAACAAAACGAATAAATCCCAACCAAAC CCCGCACAGTTTTGTGCGGCTGGAAGGAAACCAACCCTCAACAGACGGAACGCACCG AAAGAGAATCGGAAATTGTTTGGGTGGCCGCGATGTGCGCGGTTCCTTTGAATTGAN AAGACACGCGGGAACGGTCGGGCCATTGCCACGACACATCCAACNCAAATCTATGTA CTTAGTTTTACTGAGAGCCGTTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGT CGT CAROB TREE sequence (Marker 1) ACCTTCCTCTTCAGCATTGTTCCAAAAGCATCCACTTGGACACCTTCCTAGTAACAG CTACGGAGTGTTTTGCTTGCTGGACGCTTAACCAATTTGATAGCCCCCGCCCCCCGC ACGCAGGAGGGTTCGGAGGTACAGCCCTCCGCGGACACCGGGGGGCGGTGAGCACGA TGGAGCTGGTTTTTTGATTGGGACCGCAAATTGCGCGGTTCCTTGATGTTGGTCACT CGCACGAGGGCTACTGGACCATTGCCGCTAGCTAGCTACTCGCAGCACTGTAAGAAT AGGTTTTACTGAGAGCCATTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCG T These differences could be demonstrated by isolating the markers and sequencing them. The slide shows underlined one of these differences in sequence found in the markers of the two plants. 27 Marker 1 restriction analysis G L UL B A B G RG G U A R G L U B A G R ClaI HaeIII PCR amplification and digestion BcnI Additionally, the differences in sequence between the markers of the two plants can be easily characterized by their differential susceptibility to restriction endonuclesases (enzymes which cleave specific DNA sequences). As shown in the slides, the two plants markers were clearly different by this type of analysis. 28 Marker 2 restriction analysis G G L UL U B A B A G RG R G L U B A G R SmaI XhoI HaeIII This as another example of the same type of analysis but applied to the second marker. 29 Markers sequences • Isolation of markers from gel • Sequencing L B G G U A R Marker 1 L B G G U A R Marker 2 GUAR sequence (Marker 1) ACCTTCCTCTTCAGCATTGTTCCAAAGGCATCCACTTGGACGCCTTCCTAGTAACAG CTACGGAGTGTTCGTCAGGCTGGGCACTTGAACAAAACGAATAAATCCCAACCAAAC CCCGCACAGTTTTGTGCGGCTGGAAGGAAACCAACCCTCAACAGACGGAACGCACCG AAAGAGAATCGGAAATTGTTTGGGTGGCCGCGATGTGCGCGGTTCCTTTGAATTGAN AAGACACGCGGGAACGGTCGGGCCATTGCCACGACACATCCAACNCAAATCTATGTA CTTAGTTTTACTGAGAGCCGTTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGT CGT CAROB TREE sequence (Marker 1) ACCTTCCTCTTCAGCATTGTTCCAAAAGCATCCACTTGGACACCTTCCTAGTAACAG CTACGGAGTGTTTTGCTTGCTGGACGCTTAACCAATTTGATAGCCCCCGCCCCCCGC ACGCAGGAGGGTTCGGAGGTACAGCCCTCCGCGGACACCGGGGGGCGGTGAGCACGA TGGAGCTGGTTTTTTGATTGGGACCGCAAATTGCGCGGTTCCTTGATGTTGGTCACT CGCACGAGGGCTACTGGACCATTGCCGCTAGCTAGCTACTCGCAGCACTGTAAGAAT AGGTTTTACTGAGAGCCATTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCG T Furthermore, as we mentioned a few slides before, the markers from the two plants differ in their sequences, and one can exploit these differences to develop highly specific methods for the detection and differentiation of the two species. 30 Carob vs. guar sequences (Marker 2) GUAR CAROB different P3 identical 1 123413241244244323423 2444123 2414311221212441123424 1 1234132412442443234232444123 4414311221212441123424 50 50 GUAR CAROB 51 413 332324433 113242131112443 23442112 3233324423341 14 100 51 413 112124433 413442131112443 43442112 1233324423341 34 100 GUAR CAROB PG22 101 22332422234323312331222 3213 2323213 2112333 14431322- 149 101 42332442234321312331222 1213 4343431 2132333 334333321 150 GUAR CAROB 150 -4321313 411 122 12132 11242122 -32441 211223 11333432423 197 151 22331313 232 122 31132 42244122 234241 141223 31133212423 200 GUAR CAROB 198 2112331 34122 1122 112 444 113 2421 332122122 4224 12334324 247 201 1132331 14122 4122 333 444 424 2421 132322122 3243 12334324 250 GUAR CAROB PG21 248 11241 4122122 11242 144 1142313 242433 3413212 423 24313-3 296 251 3--23 4322122 41242 344 424-313 442433 4213212 344 2121341 297 GUAR CAROB PG21 297 41311211112 24313 111 24333 nnnn4 341 2423 413133 2-4123 13 341 298 43332224112 32313 224 24333 11342 341 3232 422123 414123 31 347 GUAR CAROB P4 342 211 432 42433 134221342 432222 1143 33231242111442341413 348 324 432 22433 314421342 232222 3143 13231242111442341413 GUAR CAROB P4 392 4414423224224 398 4414423224224 391 397 405 410 In this slide we show a schematic comparison of the sequences of the marker 2 sequences from the carob tree and guar plant. Most of these sequences coincide (yellow regions) as could be expected from the fact that they code for the same function. Other zones (in red) are clearly different between the two species, just as it happened in the whale vs. human example shown some slides before. These sequence differences were used to design primers P3 and P4 which amplify both species, as well as primers PG21 and PG22 that are specific of the guar DNA. 31 Specific amplification of guar DNA from seeds 400 300 200 100 Guar seeds Carob tree seeds By using the specific guar primers, we demonstrated that DNA extracted from guar seeds was detected after amplification, whereas no amplification was detected with the same primers and the DNA extracted from carob tree seeds. 32 Investigation of DNA extraction from locust bean and guar gums (E 410 and E 412) Gum Guar 30% Guar 10% Guar Locust bean Guar 30% Guar 10% Guar Locust bean Guar 30% Guar 10% Guar Locust bean Guar 30% Guar 10% Guar Locust bean Extraction method 1 1 1 1 2 2 2 2 3 3 3 3 4 4 4 4 DNA Sugars DNA/sugars PCR 46.87 8.6 10.8 14.22 77.3 156.1 232.5 509.7 4.84 1.72 1.94 1.72 3.21 0.3 0.64 0.86 0.639 0.523 0.541 0.572 1.056 0.361 0.494 0.721 0.013 0.019 0.030 0.029 ND ND ND ND 1 / 14,000 1 / 60,000 1 / 50,000 1 / 40,000 1 / 14,000 1 / 2,500 1 / 2,000 1 / 1,500 1 / 3,000 1 / 11,000 1 / 16,000 1 / 17,000 NA NA NA NA + + + — + — — — + — — — — — — — The purpose of the method was to differentiate the two gums, not just the two seeds. Commercial gums extracted from the seeds of guar plan t and carob tree contain DNA that can be amplified by PCR and the guar-specific primers. However, a critical step in the method was to find out an extraction procedure of the DNA from the galactomannan matrix. This slide shows some of the assayed extraction methods. It can clearly be seen that only extraction method 1 was suitable for further PCR amplification, although this extraction procedure was not the most effective, in quantitative terms, for DNA extraction. 33 Specific amplification of guar DNA from mixtures of LBG and known additions of guar gum 300 200 100 L B G G U A R 30% 20% 10% 12% 6% mixture 1 2% guar+LBG mixture 2 Using the right extraction procedure and guarspecific primers, we amplified and detected the presence of guar gum in laboratory control mixtures of LBG and guar gum. 34 Specific detection of guar DNA in commercial samples labeled as E 410 LBG 300 Guar 200 100 Commercial samples labeled as E 410 When these methods were applied to the analysis of commercial samples of locust bean gum, we in fact detected the presence of guar in some of these theoretically pure “LBG”. However, it should be emphasized that the number of samples positive for guar does not represent the real proportion of positives we have found in our survey of market samples. 35 Specificity of the amplified products Amplification products were • cutted with a restrictase specific of the guar sequence • analyzed by gel electrophoresis uncut Taq I XhoI restrictions Further proof of the specificity of the detected guar was obtained by restriction analysis of the amplicon. This slides shows that the amplified product gave the restriction fragments expected for guar DNA. 36 100% Guar 100% LBG 90% LBG-10%Guar Fluorescence detection of guar amplicons in guar guma and LBG-guar gum mixtures. Both the molecular size and the abundance of guar amplicons can be detected in a few minutes 37 Molecular methods for detecting additions of guar gum to locust bean gum Work developed by: • S. Albertí, A. Doménech-Sánchez, V.J. Benedí • M.L. Hernández, J.A. Rosselló With the collaboration of: • A. Juan, J. Sansegundo (Carob S.A., lab) • D. Álvarez, M. Urdiaín (IMEDEA, CSIC-UIB) Funded by: In summary, using DNA sequences specific from carob tree and guar plant, we have developed a method for the PCR amplification of specific guar sequences. The presence of these sequences in LBG-guar gum mixtures can be detected by PC R using specific guar primers. The method is patent pending, and the people and Institutions cited in the slide have contributed to its development. 38 Las nuevas nuevas tecnologías Qué es lo que está llegando? 39 Real-time PCR (quantitative) In a conventional PCR, the number of amplicons increases as the number of cycles increases, but it is not until that a sufficient number of cycles have ben run that the amplicons can be detected (see top of the figure). A conventional PCR is usually performed for 35-45 cycles and is basically an “end-point” analysis: two samples with two different amounts of target DNA to be amplified are PCR amplified for the same number of cycles and the compared by agarose gel electrophoresis. It could be possible to estimate the amount of amplicons in two samples by removing samples at different cycles, running them in an agarose gel, and then comparing the intensity of the bands from the gel. This is not done because it is cumbersome and increases the chances of contamination of the PCR mixtures. The real-time PCR machine provides real-time monitoring of the amount of new amplicons formed troughout every cycle. The reasons are: (1) a fluorecent dye is incorporated in the PCR mixture, and (2) the fluoresce in the mixture is read by buil-in fluorescence detectors. 40 The real-time PCR machine The real-time PCR machine, like the LightCycler (Roche) shown in the slide is a PCR machine which works with capilars instead that with tubes. This allows faster temperature exchange between the PCR mixture and the cooling device, thus making the PCR cycles to become faster (shorter). An important feature of these real-time PCR machines is that fluorescence in the capilars is constatntly monitored, thus informing of the amount of amplicons being formed in every cycle of the PCR. 41 SYBR Green fluorescent dye does not fluoresce until binding to double strand DNA At the beginning of amplification, the reaction mixture contains the denatured DNA, the primers, and the dye. The unbound dye molecules (SYBR Green, Molecular Probes) weakly fluoresce, producing a minimal background fluorescence signal which is subtracted during computer analysis. 42 Upon binding primers, the dye starts to fluoresce After annealing of the primers, a few dye molecules can bind to the double strand. DNA binding results in a dramatic increase of the SYBR Green I molecules to emit light upon excitation. 43 As more and more double strand DNA molecules (amplicons) are formed, more SYBR green molecules bind and fluorescence increases During elongation, more and more dye molecules bind to the newly synthesized DNA. If the reaction is monitored continuously, an increase in fluorescence is viewed in real-time. Upon denaturation of the DNA for the next heating cycle, the dye molecules are released and the fluorescence signal falls. 44 Different PCR curves are obtained for different amounts of initial DNA. End-points (plateaus) are obtained at different cycles: those samples with higheramounts of initial target DNA reach the plateau more rapidly 45 102 103 104 105 Real-time quantitative PCR analysis a) Analysis of the amplification plots for the standard concentrations (in duplicate) of the target DNA b) Standard curve; plot of the crossing point (cycle number) against the input target quantity 46