Download Display of Artificial Scaffolding Proteins on Yeast Surface

Table of Contents
Display of Artificial Scaffolding Proteins on Yeast Surface
KATUNORI KOHDA, KENRO TOKUHIRO, KATSUHIRO OHNO, TAKAO
KITAGAWA, KAZUO SAKKA* and TAKAO IMAEDA
Biotechnology lab., Toyota Central R&D Labs., Inc., Nagakute, Aichi 480-1192, Japan
*Applied Microbiology Laboratory, Graduate School of Bioresources, Mie University,
1577 Kurima-Machiyacho, Tsu 514-8507, Japan
We examined the ability of Saccharomyces cerevisiae to display
artificial scaffolding proteins consisting of different numbers of cohesins on
its cell surface. By analysis of recombinant strains having mini CipA gene
from Clostridium thermocellum, we found that S. cerevisiae could express
the scaffolding proteins including seven cohesins at the maximum. From the
result of CMC-hydrolyzing activity of the complexes from scaffolding
proteins with different numbers of cohesins anchored onto the yeast cell
surface and C. thermocellum endoglucanase CelA, we concluded that four
cohesins was suitable for its display on S. cerevisiae cell surface. The ability
of the yeast displaying the most suitable scaffolding protein to hydrolyze
phosphoric acid-swollen cellulose (PASC) as insoluble cellulose was also
examined. In this experiment, the complex on the cell surface of S.
cerevisiae exhibited about 16% degradation of PASC (0.5% in suspension).
Keywords: scaffolding protein, yeast, cellulosome, cohesin, dockerin.
Introduction
Saccharomyces cerevisiae is a very useful microorganism for ethanol production.
However, the ability of this yeast for protein secretion was much lower than that of
aerobic fungi such as Trichoderma reesei. For development of S. cerevisiae capable of
hydrolyzing and utilizing insoluble cellulose, it is necessary to introduce effective
cellulose degradation system. Cellulosome is known as a large multienzyme complex
for effective degradation of crystalline cellulose or plant cell wall polysaccharides1,2).
This complex is formed by interaction between multiple cohesin modules in a pivotal
noncatalytic “scaffolding protein” and a dockerin module of various enzyme subunits. It
is believed that the formation of enzyme complex contributes to effective cellulose
degradation. Actually, the effective cellulose degradation of artificial cellulosome has
been already reported 3-5). In the present study, we examined the ability of S. cerevisiae
to produce and display artificial scaffolding proteins consisting of different numbers of
cohesins on its cell surface, for mimicking the cellulosome.
Reproduced from Biotechnology of Lignocellulose Degradation, Biomass Utilization
and Biorefinery, eds.: Ito Print Publishing Div., Tsu, 264-268 (2009).
420
Materials and Methods
A strain and media
S. cerevisae EBY100 was obtained from Invitrogen. Yeast cells were grown in
minimal SD-CAA medium (20 g/L glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino
acid) and expression of scaffolding proteins were induced in SG-CAA medium (20 g/L
galactose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acid).
Vector construction and surface display
The genomic DNA was extracted from C. thermocellum ATCC27405. DNA
fragments encoding a CBD plus one, two, or seven chesin(s) were amplified using
combinations
of
the
following
primers
(forward:
5’acgtaggtaccagcaaatacaccggtatcaggcaatttgaaggttgaattct-3’; reverse: one cohesin, 5’acgtactcgagatctccaacatttactccaccgtcaaagaactgtgt-3’;
two
cohesins,
5’-acgtactcgagatctccaacatttactccaccgtcaaagaactgtgtct-3’;
seven
cohesins,
5’acgtactcgagctgtgcgtcgtaatcacttgatgtagctcc-3’). The gene of four cohesins with the CBD
was constructed by gene synthesis (TOYOBO). The amplified fragments were inserted
into the KpnI-XhoI site of pYD1 vector. S. cerevisiae EBY100 tranformed with these
recombinant plasmids were grown in minimal SD-CAA at 30ºC to an OD600 between 2
to 5, transferred to minimal SG-CAA medium for induction of protein expression and
incubated for 48 h at 30ºC.
Fluorescence microscopy and FCM analysis
Yeast cells (1 ml) at OD600=1 was washed by PBS and suspended in 125 μl of
PBS. The yeast cells were treated with 0.5 μg of anti-His6 antibody and 1 mg/ml BSA
for 30 min, followed by labeling with 0.5 μg of anti-mouse antibody conjugated with
Cy5 and 1 mg/ml BSA for 30min. Fluorescence of Cy5 was measured under a
fluorescence microscope. For FACS analysis, the yeast cells were reacted with anti-V5
antibody for 30 min, followed by labeling with anti-mouse antibody conjugated with
Alexa Fluor 488 for 30 min. Fluorescence intensities of yeast cells expressing
scaffolding proteins were analyzed using flow cytometer (Beckman Coulter) with an
excitation wavelength of 488 nm.
Synthesis of endoglucanase CelA by a cell free system
The endoglucanse gene celA from C. themrocellum was amplified by PCR and
cloned. The cloned celA gene fragment was transferred into a pET-23b vector
(Novagen). The region from T7 promoter to the terminator, containing celA, was
amplified by PCR and used as the template in a cell free synthesis. The cell-free
synthesis of CelA was carried out by reaction in a cell free solution at 25ºC for 5 h using
the WAKO PURE system (WAKO).
Enzyme assays of minicellulosome complex on yeast surface
Phosphoric acid-swollen cellulose PASC was prepared from Avicel PH101. Yeast
cells from 1-ml culture (OD600=5 for CMC, OD600=10 for PASC) displaying
scaffolding proteins were washed with 20 mM Tris-HCl pH 8.0 containing 10 mM
CaCl2. After centrifugation, yeast cells were suspended in a solution of 20 mM
421
Tris-HCl (pH8.0), 0.15 M NaCl, 10 mM CaCl2, and 80 μl of CelA solution from cell
free synthesis and incubated at 4ºC for 1 h. Yeast cells harboring minicellulosome
complex on the cell surface were washed three times with a solution of 20 mM Tris-HCl
(pH 8.0), 0.15 M NaCl, 10 mM CaCl2 and 0.05% Tween 20, followed by washing with
50 mM acetate buffer (pH 6.0) containing 10 mM CaCl2. Reaction solution (1% CMC
or 0.5% PASC in 50 mM acetate buffer (pH6.0) containing 10mM CaCl2) was added to
the cells and suspended. Reaction was carried out at 60ºC for CMC and 50ºC for PASC.
The cellulase activity was assayed by measuring reducing sugars, as D-glucose
equivalents, by the TZ-assay method.
Results
Display of scaffolding proteins on yeast surface
DNA fragments encoding one, two, four and seven cohesins with a CBD of C.
thermocellum CipA (Fig. 1) were inserted into the pYD1 CEN/ARS vector that
displayed the proteins of interest on the cell surface of S. cerevisiae by AGA1-AGA2
interaction system. Yeast cells transformed with these constructs expressed the
scaffolding proteins under the control of the GAL1 promoter. After expression of
scaffolding proteins, every transformant was labeled with anti-His6 antibody and
anti-mouse IgG conjugated with Cy5. By the fluorescence analysis of these recombinant
strains, we found that S. cerevisiae could express the scaffolding proteins including
seven cohesins at the maximum (Fig. 2).
422
For FCM analysis, yeast cells were also stained by anti-V5 antibody and
anti-mouse IgG conjugated with Alexa fluor. The FCM analysis indicated expression
level of the proteins decreased, as the copy number of cohesins became large (Fig. 3).
Optimum size of repeated cohesins for yeast display using CEN/ARS vector
We constructed the complexes from the scaffolding proteins with different
numbers of cohesins anchored onto the yeast cell surface and C. thermocellum
endoglucanase CelA synthesized by cell-free system and measured the cellulolytic
activity of the complexes (Fig. 4). The CMC-hydrolyzing activity of the complex
including a scaffolding protein with two or four cohesins was about 20% higher than
that of the complex including only one cohesin. When a scaffolding protein with seven
cohesins was anchored onto the cell surface, the activity was about the same level as
that of displaying one cohesin. From these results, we concluded that surface display of
the scaffolding protein with four cohesins was suitable for engineering S. cerevisiae to
hydrolyze insoluble cellulose.
423
Insoluble cellulose-hydrolyzing ability of the complex
The ability of the yeast displaying the most suitable scaffolding protein including
four cohesins to hydrolyze PASC as insoluble cellulose was examined by the method
described above. The complex on the cell surface of S. cerevisiae exhibited about 16%
degradation of PASC (0.5% in reaction mixture) by measuring reducing sugars (Fig. 5).
After the reaction, the reduction of PASC volume was observed by centrifugation (Fig.
5).
Discussion
The results described above indicate that S. cerevisiae can express the recombinant
scaffolding proteins derived from C. thermocellum CipA on its cell surface. However,
FACS analysis of yeast strains displaying the scaffolding proteins with different
numbers of cohesins indicated that the expression level of the proteins decreased, as the
copy number of cohesins increased. Especially, when a scaffolding protein including
seven cohesins was displayed on yeast surface, intensity of fluorescence was drastically
decreased, and percentage of labeled yeast cells to whole cells was under 50%. It is
likely that transformants lost the endogenous vector by strong expression of
hydrophobic scaffolding proteins by GAL1 promoter. To prevent yeast cells from losing
the vector, we are now constructing new strains in which scaffolding protein genes
controlled by a different promoter were integrated into the genomic DNA. From the
results of CMC-hydrolyzing activity of minicellulosome on yeast surface, we concluded
that four cohesins were suitable for display of the scaffolding protein on S. cerevisiae
cell surface, in the case of AGA1-AGA2 display system using CEN/ARS vector. This
result was consistent with that of the FACS analysis. To increase the amount of cohesin
domain on yeast surface, increment of expression level of scaffolding proteins on yeast
surface must be achieved. The complex composed of a scaffolding protein including
four cohesins and endoglucanase CelA displayed on yeast cell surface exhibited the
hydrolytic activity toward insoluble cellulose. In this experiment, the effect of
endoglucanase on scaffolding proteins was only evaluated. Recently, synergistic action
among different enzymes in cellulosome complex has been attracting increasing
attention. We are now investigating the optimum combinations of enzymes that indicate
strong synergistic effect on the surface of yeast cells displaying the artificial scaffolding
424
Table of Contents
proteins.
References
1)
2)
3)
4)
5)
Demain, A. L., et al.: Microbiol. Mol. Biol. Rev. 69(1): 124-154 (2005).
Bayer, E. A., et al.: Annu. Rev. Microbiol. 58: 521-5 4 (2004).
Fierobe, H. P., et al.: J. Biol. Chem. 280(16): 16325-16334 (2005).
Murashima, K., et al.: J. Bacteriol. 184(128): 5088-5095 (2002).
Mingardon, F., et al.: Appl. Environ. Microbiol. 73(12): 3822-3832 (2007).
425