Download Receptor Gene in a Patient with GH Insensitivity Syndrome

0021-972X/97/$03.00/0
Journal of Clinical Endocrinology and Metabolism
Copyright © 1997 by The Endocrine Society
Vol. 82, No. 11
Printed in U.S.A.
Novel Compound Heterozygous Mutations of Growth
Hormone (GH) Receptor Gene in a Patient with GH
Insensitivity Syndrome*
HIDESUKE KAJI, OSAMU NOSE, HITOSHI TAJIRI, YUTAKA TAKAHASHI,
KEIJI IIDA, TETSUYA TAKAHASHI, YASUHIKO OKIMURA, HIROMI ABE, AND
KAZUO CHIHARA
Third Division, Department of Medicine, Kobe University School of Medicine (H.K., Y.T., K.I., T.T.,
Y.O., H.A., K.C.), Kobe, Japan; Nose Clinic (O.N.), Kobe, Japan; and Department of Pediatrics, Osaka
University School of Medicine (H.T.), Osaka, Japan
ABSTRACT
A girl with severe growth retardation had the clinical features of
Laron syndrome. Her serum insulin-like growth factor-I level was
completely unresponsive to exogenous GH administration. The serum
GH-binding protein (GHBP) level was below the detectable limit in
the patient, but it was normal in her parents and brother. Her parents
and brother were normal in their height. Amplification with PCR and
direct sequencing of her GH receptor gene revealed compound heterozygous mutations. The allele from her mother contained a transversion of G to T in exon 7 that could introduce a stop codon in place
of a glutamic acid at amino acid 224. Another mutation was found in
the allele in her father and also identified in her brother. It was a C
deletion at position 981 in exon 10 that could introduce a frame shift,
thereby causing the production of 20 novel amino acids (310 –329)
instead of the wild-type sequence, the premature termination at
codon 330, and the subsequent deletion of the C terminal portion of
the intracellular domain. RT-PCR of her father’s lymphocytes and
sequencing of its complementary DNA revealed that only the wildtype GH receptor messenger RNA was expressed in his lymphocytes,
though the mechanism remains unclear. These results suggest that
neither of the mutant alleles could generate a functional GH receptor,
which would be consistent with the patient’s severe growth retardation and undetectable serum GHBP. (J Clin Endoclinol Metab 82:
3705–3709, 1997)
P
being translated out of the reading frame with a stop codon at
the fifth amino acid downstream.
We report here novel compound heterozygous mutations
of the GHR gene exons 7 and 10, which encode part of the
extracellular and cytoplasmic domains, respectively, as the
cause of severe growth retardation in a patient.
ARTIAL deletion (1) and 28 different mutations (2– 4) in
the GH receptor (GHR) gene have been reported so far
in classical GH-insensitivity syndrome (GHIS), which is an
autosomal recessive disorder with a phenotype similar to
that of severe GH deficiency, except that GH levels are normal or elevated. Recently, four different mutations of GHR
gene have also been reported in idiopathic short stature with
a partial GH insensitivity (5). Most of the reported mutations
were located in the region coding for the extracellular domain of the GHR and caused a functional disruption.
Kou et al. (6) and we (7) previously reported a heterozygous
missense mutation, Pro561Thr, located in the cytoplasmic domain of the GHR gene in patients with short stature. However,
the functional significance of this heterozygous mutation is
questionable, because we found this heterozygous mutation in
approximately 15% of the normal population, and there was no
correlation with height (8). Recently, Woods et al. (3) reported
on a Laron syndrome patient with a high GH-binding protein
(GHBP) level caused by a homozygous splice site mutation of
the GHR gene that resulted in skipping of exon 8, which codes
for a transmembrane domain, and that also resulted in exon 9
Received May 5, 1997. Revision received July 9, 1997. Accepted July
15, 1997.
Address all correspondence and requests for reprints to: Hidesuke
Kaji, Third Division, Department of Medicine, Kobe University School
of Medicine, Kobe, Japan.
* This work was supported in part by grants-in-aid for scientific
research from the Japanese Ministry of Education, Science and Culture,
from the Japanese Ministry of Health and Welfare, and from Growth
Science Foundation.
Subjects and Methods
Subjects
The clinical profile of this girl patient has been reported previously
(9). She was born at full term to nonconsanguineous parents. She was
47 cm in height and 3130 g in weight at birth. In her family, height was
165 cm (20.96 sd) in her father, 153 cm (20.92 sd) in her mother, and
138 cm (20.03 sd) in her elder brother at the age of 10 yr and 5 months.
She had severe but proportional growth retardation with 71 cm (27.6 sd)
in height, 8.4 kg (23.6 sd) in weight, 2 yr of bone age, and with a
prominent forehead and small nose with retracted bridge at the age of
4 yr and 2 months. Her baseline plasma GH level was as high as 21.6 –59.4
ng/mL, with enhanced peak plasma GH (ng/mL) levels of 89.5 in
response to arginine, 79.5 in response to glucagon, .90 in response to
l-dopa, and 377 in response to GHRH at 4 yr and 10 months. When
plasma insulin-like growth factor-I (IGF-I) level (mg/L) was measured
by direct RIA, it was refractory to daily subcutaneous administration of
recombinant human GH (0.32 U/kg per day) for 10 days according to
the protocol by Rudman et al. (10): 87.5 at day 0, 87.9 at day 1, 95.9 at
day 3, 96.8 at day 5, and 82.6 at day 10 of GH administration at the age
of 5 yr. Height velocity was 0.7 and 0 cm/2 months before and after GH
administration, respectively. At the age of 6 yr and 2 months, the plasma
IGF-I levels were ,4 mg/L by RIA after extraction with acid and ethanol,
which was more reliable than direct RIA. At the age of 9 yr and 1 month
she was 85.4 cm in height (28.0 sd), 11.8 kg in weight (23.3 sd), and 3
yr of bone age. The plasma IGF-I levels were still ,4 mg/L by RIA after
extraction. The basal plasma IGF-binding protein-3 (IGFBP-3) levels
3705
3706
KAJI ET AL.
(milligrams per liter) measured with a RIA (11) were 0.30 – 0.34 in this
patient (the normal value is 3.10 6 0.46). Then treatment with IGF-I was
started at a dose of 0.15 mg/kg once a day. Plasma IGFBP-3 level was
2.15 in this patient at the age of 13 yr (the normal value is 3.88 6 0.59).
It was 2.2 in her father, 5.67 in her mother (the normal value is 3.25 6
0.49), and 3.5 in her brother at the age of 15 yr and 5 months (the normal
value is 3.53 6 0.49). Plasma GHBP levels (picomoles per liter), measured
with a ligand-mediated immunofunctional assay, were ,15.6 in the
patient, 136 in her father, 98.6 in her mother, and 202 in her brother (the
normal value is 222 6 115 in men and 180 6 92 in women).
DNA isolation, PCR, and direct sequencing of the GHR
gene
Genomic DNA was extracted from the blood of the subject by the
following method as described previously (7, 8, 12). Whole blood (100
mL) was mixed with 400 mL of a 10 mm Tris-HCl buffer (pH 7.5) containing 5 mm MgCl2, 0.32 m sucrose, and 1% Triton X-100. The mixture
was supplemented with proteinase K (10 mg/mL) and 10% SDS and
then incubated at 37 C for 30 min. The genomic DNA was extracted with
phenol and chloroform and precipitated with ethanol. The GHR gene
fragment from exon 2 to exon 10 was amplified with 0.5 U Taq polymerase (Perkin Elmer Cetus, Norwalk, CT) in a final volume of 20 mL
JCE & M • 1997
Vol 82 • No 11
of a 20 mm Tris-HCl buffer (pH 8.3) containing 25 mm KCl, 0.25 mm
deoxynucleotide triphosphates (dNTPs), 2.5 mm MgCl2, and 250 mm
exon-specific primers including the sequence of M13 primers at the 59
end of the forward or reverse primers as shown in Fig. 1a. The reaction
mixture was overlaid with mineral oil and incubated using a thermocycler (Astec Co., Tokyo, Japan) programmed to repeat the following
cycle 35 times: 1 min at 94 C, 2 min at 52 C, and 2 min at 72 C. The
amplified GHR gene was electrophoresed on a 1% SeaPlaque agarose gel
and purified by Wizard PCR (Promega Co., Madison, WI). The amplified
and purified GHR DNA was directly cycle-sequenced using a M13 prism
kit (Applied Biosystems, Tokyo, Japan) with the dideoxy chain-termination method and applied on an autosequencer (ABI prism 377 DNA
sequencer, Applied Biosystems). The results were analyzed using
DNAsis (Hitachi Software Engineering Co., Tokyo, Japan). To confirm
these mutations in the patient and her family, the PCR-amplified DNA
fragments of exon 7 were digested with MaeI, and those in exon 10 with
BsmI, which could digest only the mutant alleles.
RNA isolation, RT-PCR, and sequencing of GHR messenger
RNA (mRNA)
RT-PCR was performed as described previously (7, 12). Briefly, lymphocytes were separated by density-gradient centrifugation with the
FIG. 1. Identification of GH receptor gene mutations. a, Schematic representation of primer design to amplify each of exons of GH receptor gene
encoding extracellular domain (p), transmembrane domain (f), and cytoplasmic domain (u). M13 primer sequence was added at 59 end of each
forward or reverse primer as shown by (d). b, Sequence analysis of GH receptor gene exon 7 from control and patient. A heterozygous G to T
transversion at nucleotide 724 was found. c, Sequence analysis of GH receptor gene exon 10 from control and patient. A heterozygous single
cytosine deletion at nucleotide 981 was found.
HETEROZYGOUS MUTATIONS OF GHR GENE
monopoly resolving medium Ficoll-Hypaque (Flow Labs., Costa Mesa,
CA). The RNA was extracted from the lymphocytes with the acid guanidinium isothiocyanate/phenol chloroform method (12). The RNA (0.5
mg) was reverse-transcribed with avian myeloblastosis virus reverse
transcriptase (GIBCO BRL, Gaithersburg, MD) in a 20-mL reaction buffer
containing dNTPs, random hexamers, RNase inhibitor, and MgCl2 at 37
C for 30 min, followed by heating at 95 C for 5 min. Then, 1–2 mL of the
complementary DNA (cDNA) mixture was amplified with Taq polymerase (Perkin Elmer Cetus) in a buffer containing dNTPs, MgCl2, and
primers designed to amplify from the nucleotide 681 in exon 7 to nucleotide 1015 in exon 10 (forward primer: GTGCGTGTGAGATCCAAACAACGA, and reverse primer: CACTGTGGAATTCGGGTTTATA).
The PCR products were electrophoresed on 1% SeaPlaque agarose gels
and visualized by staining with ethidium bromide. The amplified cDNA
was purified by Wizard PCR and directly cycle-sequenced with the
dideoxy chain-termination method using a dye terminator kit (Applied
Biosystems) and an autosequencer.
Results
As shown in Fig. 1b, the direct sequencing of exon 7 of the
GHR gene in the patient revealed peaks of both G and T at
position 724 in contrast to only a single peak of G in the
control. The G to T transversion changed codon 224 from
GAG (Glu) to TAG (stop) (Fig. 2b). The direct sequencing of
exon 10 of the GHR gene in this patient showed another
abnormality, i.e. a point deletion of C at the position 981 in
one allele and the normal nucleotide in the other, resulting
in the formation of overlapping peaks in the sequences
downstream from position 981 (Fig. 1c). In the control subject, there was only a single peak indicating the wild-type
sequence in both alleles. The deletion of a single cytosine was
found in codon 309 of exon 10 resulting in a frame shift of
translation that would, if translated, produce 20 novel amino
acids from codons 310 to 329 and terminate translation at
codon 330 because of the appearance of a stop codon (TAG)
(Fig. 2c). No other sequences of the GHR gene exons 2–10
FIG. 2. Wild-type and mutant GH receptors if translated. a, Wildtype GH receptor. b, G to T transversion at nucleotide 724 caused
change from a glutamic acid (GAG) to a termination (TAG) codon at
codon 224 (extracellular domain of GH receptor). c, A single cytosine
deletion at nucleotide 981 resulted in a frame shift, thereby causing
production of 20 novel amino acids (310 –329), as shown in bold
letters, instead of wild-type sequence and termination by a premature stop codon at codon 330.
3707
showed any meaningful mutation in this patient (data not
shown).
A heterozygous mutation of the GHR gene with a C deletion at position 981 was identified in her father and brother,
neither of whom showed the G to T transversion at position
724 (data not shown). In contrast, the heterozygous mutation
G3 T at position 724 was identified in her mother, who did
not show the deletion of cytosine at position 981 (data not
shown). These results were confirmed by PCR-restriction
fragment length polymorphism (Fig. 3). In this patient and
her mother, but not her father and brother, one half of the
PCR products of exon 7 of the GHR gene (280 bp) were
digested by MaeI, which could digest only the G3 T mutant
at nucleotide 724, resulting in two fragments of 173 and 107
bp. In this patient and her father and brother, but not her
mother, one half of the PCR products of exon 10 of the GHR
gene (576 bp) were digested by BsmI, which could digest only
the mutant GHR gene with a C deletion at nucleotide 981,
resulting in two fragments of 513 and 63 bp, although the
smaller fragment could not be clearly identified. Neither the
G3 T transversion at 724 nor the C deletion at 981 was
identified in 20 control subjects (data not shown).
A partial sequence of the GHR cDNA was reverse transcribed and amplified by PCR from her father’s lymphocytes.
A PCR product of the expected size could be amplified, but
the direct sequencing of this fragment showed only the wildtype GHR cDNA without the coexistence of the mutant GHR
cDNA with the C deletion at nucleotide 981 (data not shown).
Discussion
We identified novel compound heterozygous mutations in
a girl with typical GHIS. This report is of interest, because
only one compound heterozygote with classical GHIS has
previously been described in a patient from Spain (2). Our
paper has convincing genetic studies that add to its interest,
because the single allelic defects have no effect on the carrier
parents or brother. One of the mutations was a G to T transversion in exon 7 that could introduce a stop codon in place
of a glutamic acid at amino acid 224 (Glu224stop), causing a
truncation of the molecule, and thereby deleting the C terminal portion of the GH-binding domain as well as the transmembrane and intracellular domains. This mutant GHR,
even if it was translated, would possess no obvious function.
The second mutation was a C deletion at nucleotide 981 in
exon 10 that resulted in a frame shift, thereby causing the
production of 20 novel amino acids (310 –329) instead of the
wild-type sequence, the premature termination at amino acid
330, and the deletion of the subsequent C terminal portion of
the intracellular domains when this mutant GHR gene was
transcribed and translated.
The patient’s father and brother possessed the mutation of
the C deletion at nucleotide 981 in exon 10 in only one allele
with the normal sequence in the other allele. The mutation
in her mother was also heterozygous: one allele exhibited the
G3 T transversion at nucleotide 724 in exon 7, and the other
showed the normal sequence. However, all of them had
normal height and serum GHBP levels, suggesting that the
wild-type GHR expressed from the normal allele could function sufficiently, or that the mutant GHR, if expressed, did
3708
JCE & M • 1997
Vol 82 • No 11
KAJI ET AL.
FIG. 3. Pedigree and genotype in family of this patient. Both alleles were mutated in this patient. Mutant allele with G3 T mutation at 724
had one MaeI site, whereas normal allele did not have this cleavage site. Exon 7 from patient and her father, mother, and brother were amplified
by PCR and digested with MaeI. Mutant allele with C deletion at 981 had one BsmI site, whereas normal allele did not have this cleavage site.
Exon 10 from this patient and her family were amplified by PCR and digested with BsmI.
not have a dominant negative effect on normal GHR
function.
Taken together, not only the G3 T transversion at nucleotide 724 but also the C deletion at nucleotide 981 were
essential for the pathogenesis of the patient’s growth failure.
It should be determined whether the mutated GHR with the
C deletion at 981 is functional or not if it is expressed. The
previous study of truncated GHRs using site-directed mutagenesis (14 –19) revealed that GHR1–310 was sufficient to
bind GH (14) but not to associate with and phosphorylate
Jak2 (15), to stimulate Spi 2.1 gene promoter activity (16, 17),
to phosphorylate some signal-transducing molecules (18), or
to induce two GH-dependent cellular events (lipogenesis
and protein synthesis) (19). There are two possibilities to
explain why GHBP was not detected in the serum of this
patient. One possibility is that the mutant allele with the C
deletion at 981 produced a truncated GHR that lacks the
signal transduction motif required for the generation of
GHBP, an extracellular domain of the GHR, although the
mechanism of GHBP generation is not fully understood yet
(20 –22). However, recent reports (23, 24) have shown that a
short isoform of the human GHR truncating 97.5% of the
intracellular domain of the receptor may be involved in the
increased release of GHBP, probably because of the lack of
a motif in box 2 required for receptor internalization (25).
Alternatively, this allele with the C deletion at 981 might not
be transcribed or translated. To elucidate these possibilities,
we tried to identify the expression of the mutant GHR mRNA
in lymphocytes from the patient’s father who had the heterozygous C deletion at 981 in the GHR gene because, unfortunately, we could not obtain a large enough blood sample to extract mRNA from the patient. The GHR mRNA
could be clearly detected in his lymphocytes with the RTPCR method. However, only the wild-type GHR cDNA was
identified in his PCR products by direct sequencing. Thus, it
is likely that the mutant GHR mRNA encoding the C deletion
at 981 either could not be transcribed or, if it were transcribed, was very unstable. It remains to be clarified why the
mRNA for the mutant GHR with the C deletion at 981 was
not detected. It is possible to speculate that an as yet undefined mutation might exist in the other region like promoter
of this mutant GHR gene allele affecting gene transcription,
or the structural change of GHR gene by C deletion at 981
itself caused an instability or repressed transcription activity
of this mutant gene. Nevertheless, our results obtained up to
now indicate that neither of the mutant alleles could produce
any functional GHR, which is responsible for the patient’s
severe growth retardation and undetectable serum GHBP
level.
Acknowledgment
We thank Dr. F. Kurimoto (Mitsubishi Kagaku Bio-Clinical Labs.,
Tokyo, Japan) for measurement of GHBP and IGFBP-3.
HETEROZYGOUS MUTATIONS OF GHR GENE
References
1. Godowski J, Leung W, Meacham R, et al. 1989 Characterization of the human
growth hormone receptor gene and demonstration of a partial gene deletion in
two patients with Laron type dwarfism. Proc Natl Acad Sci USA. 86:8083– 8087.
2. Berg M, Argente J, Chernausek S, et al. 1993 Diverse growth hormone receptor gene mutations in Laron syndrome. Am J Hum Genet. 52:998 –1005.
3. Woods KA, Fraser NC, Postel-Vinay M, Savage MO, Clark AJ. 1996 A homozygous splice site mutation affecting the intracellular domain of the growth
hormone (GH) receptor resulting in Laron syndrome with elevated GH-binding protein. J Clin Endocrinol Metab. 81:1686 –1690.
4. Rosenbloom AL, Rosenfeld RG, Guevara-Aguirre J. 1997 Growth hormone
insensitivity. Pediatr Clin N Am. 44:423– 442.
5. Goddard AD, Covello R, Luoh S, et al. 1995 Mutations of the growth hormone
receptor in children with idiopathic short stature. N Engl J Med. 333:1093–1098.
6. Kou K, Lajara R, Rotwein P. 1993 Amino acid substitutions in the intracellular
part of the growth hormone receptor in a patient with the Laron syndrome.
J Clin Endocrinol Metab. 76:54 –59.
7. Kaji H, Ohashi S, Abe H, Chihara K. 1994 Regulation of the growth hormone
(GH) receptor and GH-binding protein mRNA. Proc Soc Exp Biol Med.
206:257–262.
8. Chujo S, Kaji H, Takahashi Y, Okimura Y, Abe H, Chihara K. 1996 No
correlation of growth hormone receptor gene mutation P561T with body
height. Eur J Endocrinol. 134:560 –562.
9. Nishi Y, Okada S, Tajiri H, et al. 1993 Effect of IGF-I on isolated GH deficiency
type 1A and Laron-type dwarfism. Pediatr Adolesc Endocrinol. 24:244 –253.
10. Rudman D, Kutner MH, Fleming GA, et al. 1978 Effect of 10-day courses of
human growth hormone on height of short children. J Clin Endocrinol Metab.
46:28 –35.
11. Hasegawa Y, Hasegawa T, Aso T, et al. 1992 Usefulness and limitation of
measurement of insulin-like growth factor binding protein-3 (IGFBP-3) for
diagnosis of growth hormone deficiency. Endocrine J. 39:585–591.
12. Takahashi Y, Kaji H, Okimura Y, Goji K, Abe H, Chihara K. 1996 Short
stature caused by a mutant growth hormone. N Engl J Med. 334:432– 436.
13. Chomoczynski P, Sacchi N. 1987 Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem.
162:156 –159.
14. Colosi P, Wong K, Leong SR, Wood WI. 1993 Mutational analysis of the
intracellular domain of the human growth hormone receptor. J Biol Chem.
268:12617–12622.
3709
15. Smit LS, Meyer DJ, Billestrup N, Norstedt G, Schwartz J, Carter-Su C. 1996
The role of the growth hormone (GH) receptor and JAK1 and JAK2 kinases in
the activation of stats 1, 3, and 5 by GH. Mol Endocrinol. 10:519 –533.
16. Billstrup N, Bouchelouche P, Allevato G, Ilondo M, Nielsen J. 1995 Growth
hormone receptor C-terminal domains required for growth hormone-induced
intracellular free Ca21 oscillations and gene transcription. Proc Natl Acad Sci
USA. 92:2725–2729.
17. Hansen LH, Wang X, Kopchick JJ, et al. 1996 Identification of tyrosine
residues in the intracellular domain of the growth hormone receptor required for transcriptional signaling and stat 5 activation. J Biol Chem.
271:12669 –12673.
18. Wang X, Souza SC, Kelder B, Cioffi JA, Kopchick JJ. 1995 A 40-amino acid
segment of the growth hormone receptor cytoplasmic domain is essential for
GH-induced tyrosine-phosphorylated cytosolic proteins. J Biol Chem.
270:6261– 6266.
19. Lobie PE, Allevato G, Nielsen JH, Norstedt G, Billestrup N. 1995 Requirement of tyrosine residues 333 and 338 of the growth hormone (GH) receptor
for selected GH-stimulated function. J Biol Chem. 270:21745–21750.
20. Trivedi B, Daughaday WH. 1988 Release of growth hormone binding protein
from IM-9 lymphocytes by endopeptidase is dependent on sulfydryl group
inactivation. Endocrinology. 123:2201–2206.
21. Sotiropoulos A, Goujon L, Simonin G, Kelly PA, Postel-Vinay MC, Finidori
J. 1992 Evidence for generation of the growth hormone-binding protein
through proteolysis of the growth hormone membrane receptor. Endocrinology. 132:1863–1865.
22. Harrison SM, Barnard R, Ho KY, Rajkovic I, Waters MJ. 1995 Control of
growth hormone (GH) binding protein release from human hepatoma cells
expressing full-length GH receptor. Endocrinology. 136:651– 659.
23. Dastot F, Sobrier M-L, Duquesnoy P, Duriez B, Gossens M, Amselem S. 1996
Alternatively spliced forms in the cytoplasmic domain of the human growth
hormone (GH) receptor regulate its ability to generate a soluble GH-binding
protein. Proc Soc Natl Acad Sci USA. 93:10723–10728.
24. Ross RJM, Esposito N, Shen XY, et al. 1997 A short isoform of the human
growth hormone receptor functions as a dominant negative inhibitor of the
full-length receptor and generates large amounts of binding protein. Mol
Endocrinol. 11:265–273.
25. Argetsinger LS, Carter-Su C. 1996 Mechanism of signaling by growth hormone receptor. Physiol Rev. 76:1089 –1107.