* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Table SI. Primers used for creation of the PHAC1co and
Mycoplasma laboratorium wikipedia , lookup
Social sequence analysis wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Long non-coding RNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Gene expression profiling wikipedia , lookup
Designer baby wikipedia , lookup
Restriction enzyme wikipedia , lookup
Metagenomics wikipedia , lookup
Bioinformatics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
SNP genotyping wikipedia , lookup
Gene expression wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene prediction wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Supplementary Online Material 1 Creation of the transformants: detailed information 1.1 Synthetic constructs The PhaC1 protein sequence from Pseudomonas resinovorans (ENA accession number AAD26365.2) was back translated using the averaged codon usage of the genes of the sophorolipid pathway (Genbank Accession numbers HM440974.1 (UGTB1), HQ670751 (AT), HM440973 (UGTA1), EU552419 (CYP52M1) and unpublished results) which was determined using an online tool (Stothard, 2000). An SKL (TCTAAGCTG) peroxisomal target sequence (PTS) found in at least one peroxisomal protein of Candida bombicola (Van Bogaert et al., 2009a) was added to the 3’ terminus of the codon-optimized PHAC1co sequence. Additionally the up- and downstream regulatory regions of the CYP52M1 gene were added to the 5’ (488 bp) and 3’ (190 bp) side of the PHAC1co sequence respectively. The 5’ UTR region, was extended beyond the promotor sequences to 1098 bp to obtain 1000 bp of homology needed for homologous recombination at the CYP52M1 locus. Codon usage of the U. maydis glucosyltransferase gene UGT1 was optimized for C. bombicola in a comparable way and XbaI restriction sites were added at both termini of the gene. The two constructs were ordered at GenScript (Piscataway, USA) and obtained cloned into a pUC vector. 1.2 Creation of the PHAC1co expression cassette The PHAC1co construct was amplified from the obtained vector using primers P55_FOR_upCYP_extNheI and P58_REV_PHAC1tCYP_extEcoRI (Table SI) yielding a fragment of 2986 bp. The primers respectively contained NheI and EcoRI extensions allowing subsequent digestion with said restriction enzymes for further subcloning. Creation of the cassette occurred in three steps. All primers used for generation of the cassette can be found in Table SI. First the URA3gene with its5’ and 3’ regulatory sequences (1970bp) was amplified from genomic DNA of C. bombicola ATCC 22214, using primers P1_FOR_URA3v and P2_REV_URA3v. This amplicon was subsequently cloned into the pGEM-T® vector (Promega) yielding ‘pGEM-T_URA3’. Secondly the region for homologous recombination at the 3’ end of the CYP52M1 locus (downcyp) was amplified from genomic DNA of C. bombicola using primers P53_FOR_downCYP_extSpeI and P54_REV_downCYP_extNotI. The resulting amplicon was digested with the unique cutters SpeI and NotI as was the pGEMT_URA3 vector and the restriction fragments were ligated after purification, yielding pGEMT_URA3_downcyp. A third and last step consisted of introduction of the synthetic construct into the expression cassette. pGEM-T_URA3_downcyp was digested using the unique cutters NheI and EcoRI. This double restriction digest yielded two fragments (5644 bp and 358 bp) of which the largest one was gel purified and subsequently ligated with the digested and purified synthetic construct. The PHAC1coexpression cassette was amplified from the resulting vector (pGEM-T_cassette_PHAC1co) using primers P63_FOR_cassPHAC1co and P64_REV_cassPHAC1co. The resulting linear PCR fragment was purified and used for transformation of the C. bombicola PT36 strain (Figure S1). Transformants were selected on SD plates. Correct integration of the PHAC1co expression cassette into the genome was controlled by performing PCR on genomic DNA with primers further up- and downstream than the primers used for amplification of the expression cassette, UDPGTA1Rev and A21TotRev respectively. The resulting PCR product was purified and sent to LGC genomics (Germany) for sequence analysis. 1.3 Creation of the UGT1co expression cassette All primers used for generation of the cassette are given in Table SI. The codon optimized UGT1co gene was amplified from the pUC-based construct using primers KIUGT1_UGT1For and KIUGT1_UGT1Rev which both contained extensions for fusion PCR. The UGT1co gene was fused to the C. bombicola UGTB1 5’ and 3’ regulatory sequences (Saerens et al., 2011b) by means of fusion PCR (Fang et al., 2002) with PfuUltra DNA polymerase. Amplification of the UGTB1 5’ (P) and 3’ (T) regulatory sequences occurred with primer pairs UGTB1-989Rev/KIUGT1_UGTB1PRev and KIUGT1_UGTB1TFor/UGTB1+1015Rev respectively from genomic DNA of C. bombicola wild type. The obtained 3741 bp fusion product was ligated into pGEM-T® yielding pG_PUGT1T from which the 2967 bpPUGT1T fragment was amplified using primers UGTB1 -989Rev and PUGT1TRev_MluI. Additionally the 3’ end of the UGTB1coding sequence followed by the URA3 selectable marker was amplified from plasmid pGKO_ugtB1 (Saerens et al., 2011b) with primers URA3-677For_MluI and GTII +1296Rev. The purified PUGT1T fragment and selection marker were cut overnight with the single cutter MluI and both fragments were ligated after purification. The ligation product (5777 bp) was amplified from the ligation mix using Phusion High Fidelity polymerase (Finnzymes) with primers UGTB1 -989Rev and GTII+1296Rev. After purification, the obtained expression cassette PUGT1T_URA3GT2 was cloned into the pJET® cloning vector (Clontech) and sent for sequencing. A linear expression cassette was created from the latter using primers UGT1URA3 For and GTII +1296Rev and transformed into the Candida bombicola G9 strain. Transformants were selected on SD medium. Correct integration of the UGT1co expression cassette at the UGTB1 locus was controlled by two yeast colony PCR’s. Primers KIUGT1 CtrlFor2 and KIUGT1CtrlRev were used to check 3’ cross-over while primers Ura3endFor and GTII+239Rev were used to check cross-over at the 5’ site of the UGTB1 locus. Two transformants arising from double cross-over events were randomly selected for investigation of their glycolipid production. Table SI. Primers used for creation of the PHAC1co and UGT1co expression cassettes and genotype control of the C. bombicola transformants. All primers were ordered at Sigma Genosys. Primername Sequence ‘5-3’ P55_FOR_upCYP_extNheI GTTGCTAGCTCTCGGCAGATTTCCTTG P58_REV_PHAC1tCYP_extEcoRI AGAATTCGTCGGTTAAACGCACTCCTTCA KIUGT1 UGT1For CATAAAACAATAAAGTCTCCTATATGGCGACCGAACATATTC KIUGT1 UGT1Rev CATATCTAGAAAAAGAGCCAGGTCAAAAGAGGCGGACTTCTGCC P1_FOR_URA3v AGAACAAGGCCGAGTATGTC P2_REV_URA3v TGCCAGCAGATCATCATCAC P53_FOR_downCYP_extSpeI TTACTAGTGTTTCTTAGCCTCCCATGGAAGAAACG AATTGGCCTTGCGGCCGCGGTGTCGACTCGCCAAATTC P54_REV_downCYP_extNotI CATC P63_FOR_cassPHAC1 CTCTCGGCAGATTTCCTTGTG P64_REV_cassPHAC1 GGTGTCGACTCGCCAAATTC UDPGTA1Rev CCTACCTCTCTTCCCTGATCT A21TotRev GCTCTTGTTCGGTACTCTTATTG UGTB1 -989Rev CCTCGCCACCACCTAGTTTG KIUGT1_UGTB1P Rev GAATATGTTCGGTCGCCATATAGGAGACTTTATTGTTTTATGC KIUGT1_UGTB1T For CAGAAGTCCGCCTCTTTTGACCTGGCTCTTTTTCTAGATATG UGTB1 +1015Rev ATTGGCTGCTTAGTGGACTC PUGT1TRev_MluI CATAACGCGTTTCTGCTCTCAACACCGAG URA-677For_MluI GAGAACGCGTGATAGTACAGGCTTTGC GTII+1296Rev AGAAGCTAATTCACTAATTGCCGAC UGT1URA For TCTGGCGAATAACAGCACTC KIUGT1CtrlFor2 GCGCCAGTTCCCATTGTGATTACC KIUGT1 CtrlRev ATAGGGCGTGCATGACCAAC URAend For TAAAGAAACGAAGGGCCCAGCAGTC GTII +239Rev CTGCTCTCAACACCGAGTGTAG Figure S1. Schematic representation of the created PHAC1co and UGT1co expression cassettes and their integration in the genome of a C. bombicola ∆ura3 mutant. The sites used for homologous recombination are indicated by lines. Figure S2. Mass spectra taken at the peak maxima of the new compounds in the chromatogram of C. bombicola UGT1co transformant (UGT1) and corresponding spectrum of C. bombicola ∆ugtB1. (a) compound eluting at 26.68 min (b) compound eluting at 28.17 min.