Download Examination in Gene Technology, TFKE38 2011-10-18

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Biochemistry wikipedia , lookup

Expanded genetic code wikipedia , lookup

Cell-penetrating peptide wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Molecular cloning wikipedia , lookup

Protein wikipedia , lookup

QPNC-PAGE wikipedia , lookup

Gene regulatory network wikipedia , lookup

Magnesium transporter wikipedia , lookup

Genetic code wikipedia , lookup

Ancestral sequence reconstruction wikipedia , lookup

Protein (nutrient) wikipedia , lookup

Gene expression wikipedia , lookup

Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup

Molecular evolution wikipedia , lookup

Western blot wikipedia , lookup

Homology modeling wikipedia , lookup

List of types of proteins wikipedia , lookup

Community fingerprinting wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Genomic library wikipedia , lookup

Protein structure prediction wikipedia , lookup

Protein moonlighting wikipedia , lookup

Protein adsorption wikipedia , lookup

Expression vector wikipedia , lookup

Protein–protein interaction wikipedia , lookup

Proteolysis wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
Examination in Gene Technology, TFKE38 2011-10-18
1) Explain briefly the following concepts in molecular biology
a) Competent Cells
b) Transfection
c) Fagmid
d) operons
d) Cos-sites
(10 p)
2) Plasmid pBR322 (Figure 1) was digested with restriction enzyme Pvu1. The digested
plasmid was ligated with the Pvu1 digested gene coding for protein X and the mixture
was transformed into E. coli cells.
a) What antibiotics should be added to the medium (agarplate) to select cells that have
incorporated the gene for proteinX?
(2 p)
b) After transformation colonies were obtained that were resistant to both Ampicillin and
Tetracycline. Can you give a reasonable explanation for this?
(2 p)
c) To ligate the gene for protein X into pBR322, only one restriction site was used. What
might this have for disadvantages?
(2 p)
d) To facilitate the ligation the plasmid was treated with the enzyme alkaline
phosphatase. How does this enzyme work and how can it improve the ligation frequency.
(4 p)
Figure1 Schematic drawing of plasmid pBR322
3) You have obtained a human cDNA library and will try to clone the protein FABP, a
protein that has a very conserved protein sequence among eukaryotes.
a) What distinguishes a cDNA library from a genomic library?
(2p)
b) How do you proceed to create a cDNA library. Sketch a possible way to construct a
cDNA library, indicating the necessary enzymes.
(5p)
c) Outline how you go about identifying the clone containing the gene for the protein
FABP.
(3 p)
4) You want to study the ribosomal proteins and has therefore chosen to clone protein
L21. The figure below (figure 2) shows the DNA sequence and protein sequence of L21.
NOTE: This question provides a total of 20 points
a) Construct primers to find the gene in a cDNA library
(2p)
b) In order to quickly clone your desired fragments without the use of restriction digest
instead you use the socalled TA cloning technique.. How does the TA cloning work?
What are the requirements for the DNA polymerase used in this technique, how is the
vector treated?
(6p)
c) For the transformation, you use two different controls, transformation and ligation
control. What are the purposes of these controls and what are the expected results of
those checks
(2p)
d) To study the protein spectroscopically you want by site-directed mutagenesis to
replace Tyr7 to a tryptophan (Tyr7 (Y7 in one-letter code)) selected in the protein
sequence in bold and underlined). Design primers for using the QuikChange method to
do this amino acid replacement. Give a justification for how you design these primers.
(Utilities Genetic code in Appendix)
(4p)
e) Describe how the QuikChange method works and what happens in the various stages.
(6p)
A
5´atgactaactccaagggttacagacgtggcacgagggacttgttctctcgcaaattccgtaaacatggaac
cattcccttatccacgtacgtgaaaacgtacaaagtgggcgatattgttgatattaagggaaatggtgctg
tacaaaagggtatgccgtataaagtttatcacggtaaaactggtcgcgtattcaacgtaactgcgcacgcc
ctgggagtcatcgtgaacaagagagtacgtggacgtatcattgccaagaggatcaatgttcgcatcgagca
tctgagccattcaaagtgtagggatgatttcctcaaacgcgtcaaagagaacgagagactcaggaaggagg
caaaggagaaaaatgttcgcgttcagcttaaacgacaaccggccgaaccatctaaagcacatatcgtgtca
ggacgtgaagcgccaatcttactcgcaccagttccctatgaatttattgcttaa-3´
B
MTNSKGYRRG TRDLFSRKFR KHGTIPLSTY VKTYKVGDIV DIKGNGAVQK GMPYKVYHGK
TGRVFNVTAH ALGVIVNKRV RGRIIAKRIN VRIEHLSHSK CRDDFLKRVK ENERLRKEAK
EKNVRVQLKR QPAEPSKAHI VSGREAPILL APVPYEFIA
Figure 2 DNA sequence (A) and amino acid sequence (B) of L21 protein
Appendix
Genetic code