Download View PDF

Investigation of molecular diagnosis in Chinese patients with
myotonic dystrophy type 1
LI Mao, WANG Zhan-jun, CUI Fang, YANG Fei, CHEN Zhao-hui, LING Li, PU Chuan-qiang and
HUANG Xu-sheng *
Department of Neurology, Chinese People’s Liberation Army General Hospital, Beijing 100853, China
*Correspondence to: Pro. HUANG Xu-sheng, Department of Neurology, Chinese People’s Liberation
Army General Hospital, Beijing 100853, China (Tel: +8610-88626887, Fax: +8610-66939721, E-mail:
[email protected])
This work was supported by grants from National Natural Science Foundation of China (81171185).
Conflict of interest: none.
Keywords: myotonic dystrophy; polymerase chain reaction; blotting, Southern; molecular diagnosis;
trinucleotide repeat expansion
ABSTRACT
Background Myotonic dystrophy type 1 (DM1) is an autosomal dominant multisystem disease caused by
abnormal expansion of cytosine-thymine-guanine (CTG) repeats in the myotonic dystrophy protein
kinase gene. The clinical manifestations of myotonic dystrophy type 1 are multisystemic and highly
variable, and the unstable nature of CTG expansion causes wide genotypic and phenotypic presentations,
which make molecular methods essential for the diagnosis. So far, very few studies about molecular
diagnosis in Chinese patients with myotonic dystrophy type 1 have been reported. Therefore, we carried
out the study using two different methods in molecular diagnosis to verify the validity in detecting CTG
expansion in Chinese patients showing DM signs.
Methods 97 Chinese individuals were referred for molecular diagnosis of myotonic dystrophy type 1
using conventional polymerase chain reaction (PCR) accompanied by Southern blot and triplet primed
PCR. We evaluated the sensitivity and limitation of each method using percentage.
Results 65 samples showed only one fragment corresponding to the normal allele by conventional PCR
and 62 out of them were correctly diagnosed as DM1 by triplet primed PCR, three homologous non-DM1
samples were ruled out; Southern blot analysis successfully made 13 out of 16 correct diagnosis with a
more sensitivity using α-32P labeled probes than dig-labeled probes.
Conclusions Molecular analysis is necessary for the diagnosis of myotonic dystrophy type 1 and triplet
primed PCR is a reliable, sensitive, and easily performed method in molecular diagnosis which is worthy
to be popularized.
Myotonic dystrophy type 1 (DM1) is the most common form of adult muscular dystrophy characterized
by myotonia, progressive muscle weakness and atrophy, as well as a wide range of symptoms including
cataracts, cardiac arrhythmias, intellectual impairment, respiratory insufficiency, endocrine disturbances,
and other developmental and degenerative manifestations1. The clinical features of DM1 are highly
variable and different course of the disease often means different manifestations ranging from subclinical
cataract to lethal cardiorespiratory disorder. Therefore molecular analysis is very helpful especially for
those who are asymptomatic or exhibit equivocal symptoms and has an immense value as a screening
procedure to identify mutations in DM1 families and to reduce the birth rate of DM1 infants.
DM1 results from the expansion of an unstable CTG repeat in the 3' untranslated region of the myotonic
dystrophy protein kinase (DMPK) gene in chromosome 19q13.32-4. Normal individuals have 5 to 37 CTG
repeats, while alleles containing more than 38 CTG are considered abnormal. DMPK alleles between 38
and 49 CTG are premutated alleles, and individuals with these alleles are asymptomatic but at risk of
having children with larger pathologically expanded repeats. When the repeat length exceeds 50 CTG, the
alleles lead to onset of DM1 and larger repeat size correlates with increased severity of symptoms and
decreased age of onset5-7. So far, no single method could detect the entire range of alleles. Among
different methods, Southern blot analysis is the most widely accepted technique used to evaluate the
expansion mutation6, However, given its time consuming and the need of radioactive materials, other
methods like triplet primed PCR (TP-PCR), which is easier and faster was proposed8.
The overall worldwide prevalence of DM1 is estimated to be approximately 8-12/100,0009. In China, a
low prevalence has been indicated10, but based on a population of 1.3 billion, a large number of patients
have been suffering from this disease. For a very long time, the diagnosis of DM1 has mainly depended
on clinical symptoms, electrophysiology and muscle biopsy, and correct molecular diagnosis has not been
used until 2011. There was a study using TP-PCR to detect trinucleotide repeats in Chinese patients with
DM1, considering TP-PCR as a reliable method22. However, we thought a larger samples and supplement
of conventional PCR accompanied by Southern blot analysis could make the work better. The purpose of
this study was to investigate suitable methods and verify the validity in detecting CTG expansion in
Chinese patients showing DM signs (myotonia, muscle weakness, electromyography changes).
METHODS
Subjects
From March 2009 to March 2013, two groups of 97 Chinese individuals were recruited in this study at the
neurology clinic of Chinese People’s Liberation Army General Hospital. The experimental group
consisted of 64 clinically suspected DM1 patients. The control group included five family members
showing no DM signs and 28 healthy unrelated subjects. After molecular diagnosis, each patient was
reviewed for clinical features and laboratory tests (table 1). This study was authorized by the Institutional
Scientific and Ethics Committee of the Chinese PLA General Hospital and was conducted according to
the Declaration of Helsinki. Signed informed consents were obtained from all subjects or their guardians.
DNA extraction
Genomic DNA was extracted from peripheral leukocytes using Wizard® Genomic DNA Purification Kit
(Promega, USA) and stored in -20 ℃ condition.
Polymerase Chain Reaction (PCR)
We used PCR to exclude DM1 and detect lower range (alleles containing between 5 and 100 to 125
CTG-repeat units) of CTG expansions. To those who were ruled out of DM1, we also used PCR to
amplify CCTG repeats in the first intron of CCHC-type zinc finger, nucleic acid binding protein (CNBP)
gene on chromosome 3q21 as a primary screening of myotonic dystrophy type 2 (DM2)11. The PCR was
performed using GeneAmp PCR System 9700 (Applied Biosystems, USA) in a 50 μl mixture. The
primers were shown in table 2. The conditions were as follows: initial denaturation at 94 ℃ for 2 min,
then 35 cycles of 94 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min and a final extension of 10 min at
72 ℃. These PCR products were then separated using 2 % agarose gel electrophoresis (Biowest, Spain)
and sequenced by PRISM 3730XL (Applied Biosystems, USA). When two normal alleles were identified,
DM1 diagnosis could be excluded. Considering that about 25 % of unaffected individuals could be
homozygous, the presence of a single PCR band did not confirm a diagnosis of DM112.
Southern blot analysis
To determine the larger CTG expansions, Southern blotting of genomic DNA was performed using
nonradioactive or radioactive labeled probes respectively. First, the probes were amplified from normal
human DNA (Fig. 1) using primers Pro1 and Pro2 (Table 2). Second, forty/ten micrograms of genomic
DNA were digested with Bgl I (Fermentas, Canada), separated on a 1 % agarose gel (Biowest, Spain) and
transferred to a nylon/nitrocellulose filter membrane. Then, hybridizations were carried out with
dig-/α-32P- labeled probes at 65 ℃ in hyb-100/hybridization buffer. Blots were washed twice with 2×
saline-sodium citrate buffer (SSC)/0.1 % sodium-dodecyl sulfate (SDS) for 5 min at 25 ℃, and twice
with 0.1× SSC/0.1 % SDS for 15 min at 50 ℃. Then, chemical color reaction/autoradiography (after 7
days exposure at -70 ℃) was done respectively.
Triplet primed PCR
We also carried out TP-PCR in two reactions with four primers (Table 2), where fluorescently-labeled p1
and p2 lie outside the repeat, one within the repeat, which is added in limiting amounts (0.1 pmol/L) that
also has a sequence-tail complementary to the fourth universal primer (1 pmol/L). Reaction one included
p1 and p2 and reaction two included p1, p3R and p4CTG. Each reaction was performed in a 25 μl mixture.
The following conditions were: initial denaturation at 94 ℃ for 4 min, then 35 cycles of 95 ℃ for 1
min, 60 ℃ for 1 min, 72 ℃ for 2 min, a extension of 10 min at 72 ℃ and 4 ℃ for 10 min. Products
were analyzed using capillary electrophoresis on an PRISM 3100 (Applied Biosystems, USA) and the
data were analyzed using GeneMapper 3.7 software (Life Technologies, USA) 13.
Statistical analysis
Analyses were performed using SPSS 18.0 (SPSS Inc., Chicago, USA). Quantitative data were described
using Mean ± SD, qualitative data were described using percentage.
RESULTS
Conventional PCR was performed in 97 individuals. Two out of 64 clinically diagnosed DM1 patients,
four out of five relatives and 26 out of 28 healthy controls showed two fragments corresponding to
normal alleles; the remaining 65 samples showed only one fragment corresponding to the normal allele
(Figure 2A). Among normal alleles, the largest allele was 31 CTG repeats (Figure 2B). All samples who
were finally ruled out of DM1 also showed two fragments corresponding to normal alleles when we
amplified CCTG repeats in the first intron of CNBP.
Southern blot analysis with dig-labeled probes in eight samples successfully confirmed four out of seven
DM1 patients but failed to detect larger alleles in three patients who were diagnosed as DM1 by later
TP-PCR analysis (Figure 2C). Southern blot with α-32P-labeled probes in another eight samples
successfully confirmed all the four DM1 patients and ruled out four non-DM1 individuals (Figure 2D).
The results of reaction one of TP-PCR are in accordance with those of conventional PCR. Among the 65
samples (62 clinically diagnosed DM1 patients, one relative and two healthy controls) showing only one
normal allele, 61 clinically diagnosed DM1 patients and one relative were confirmed as DM1 by reaction
two (Figure 2E); the remaining three samples are homologous non-DM1 individuals (Figure 2F).
DISCUSSION
Myotonic dystrophy is caused by abnormal expansions of short tandem repeats (STR), which lead to
formation of transcript aggregates in the nucleus, interfering with proteins that play a role in RNA
metabolism. The RNA toxic mechanism is characterized by mis-splicing of several genes, which are
thought to account, at least in part, for multisystem involvement 14.
Diagnostic testing of molecular pathologies due to dynamic mutations has been always troublesome.
Abnormal amplified simple tandem repeats with huge length contain high GC level. Longer repeats are
not reliably detected by PCR because of preponderant amplification and therefore the method is not
suitable to make a direct diagnosis in many cases. In China, a long expand TM template PCR system was
once proposed in 2000 for DM1 diagnosis15, which could detect alleles with 3100 ~ 3350 CTG repeats
alone. According to that article, we ever used the same system but we could not detect these alleles just by
PCR. Therefore, long expand TM template PCR may be not a reliable method.
Southern blot analysis is the most common technique used to evaluate the expansion mutation, which has
the advantage of estimating repeat size. Genomic DNA digested with an appropriate restriction enzyme
(EcoRI, BamHI, NcoI or BglI) has been the gold standard for the detection of DMPK alleles containing
100 CTG-repeat units and over since the DMPK gene was identified. Several different probes have been
reported for hybridization including PGB2.6, pMDY1, cDNA25 and p5B1.43, 4, 16, 17. Nevertheless,
because these probes are hard to get domestically, we used PCR to produce a sequence flanking CTG
repeat in DMPK gene according to restriction map as our probes. After a lot of explorations, Southern
blot was successfully performed in sixteen samples and confirmed eight positive patients correctly, but
three patients with DM1 failed to be detected with dig-labeled probes. The results above indicate that the
probes prepared through our method are effective, especially for α-32P labeled probes, but their specificity,
sensitivity, and stability need further exploration by extensive application. Although Southern blot is
useful but this method is time-consuming and requires radioactive material and sometimes amplification
of large expansions could fail. In addition, the CTG repeat length is mitotically unstable in individuals
with DM1. This instability leads to somatic mosaicism for the size of the CTG expansion which often
results in a smear confusing estimation of exact CTG repeats.
TP-PCR8, 18, 19 which uses triplet primers to produce a mixture of PCR fragments of different sizes is
much easier and faster. Although expansions in all size ranges can be detected by TP-PCR, no reliable
information about the length of the expanded repeat could be obtained because of extinction of the signal
in the higher size region. In DM1 expansion analysis, TP-PCR had proven to be an accurate technique.
Nevertheless, the presence of rare interruptions of the otherwise pure CTG repeat13, 20 may result in
aberrant patterns or failure to detect expansions with TP-PCR21. Therefore, to exclude false-negative
results, an additional test (such as a TP-PCR at the other repeat end or Southern blotting) is strongly
recommended. In our experiment, of three suspected patients who were negative by TP-PCR analysis,
two heterozygous patients were also ruled out by conventional PCR and one homologous by Southern
blot with α-32P labeled probes. We did not find any false-negative results. Therefore, the three patients
who were clinically diagnosed as DM1 were ruled out after molecular tests and they all also harbored two
normal alleles when we used PCR to amplify CCTG repeats in the first intron of CNBP gene on
chromosome 3q21. The false-positive of clinical diagnosis emphasizes again the importance of molecular
diagnosis and the need of carefully clinical differentiation. In addition, The relative who was diagnosed as
DM1 harboring two alleles of 10 and 50 CTG repeats has a son and two grandchildren suffering from
DM1 with a increased severity of symptoms and decreased age of onset through generations. If we did
not use genetic analysis, we may overlook a subclinical patient. Therefore, proper molecular analysis
could be very helpful in finding asymptomatic or atypical patients , ruling out non-DM1 patients showing
similar symptoms and reducing the birth rate of DM1 infants.
In summary, we have described different methods in molecular analysis of Chinese patients with DM1,
finding that molecular analysis is necessary for the diagnosis and TP-PCR is a reliable, sensitive, and
easily performed molecular diagnosis which is worthy to be popularized.
ACKNOWLEDGEMENTS
This work was supported by grants from National Natural Science Foundation of China (81171185).
REFERENCES
1.
2.
Harper PS. Myotonic dystrophy. 3rd edn. London: Saunders, 2001.
Brook JD, McCurrach ME, Harley HG, Buckler AJ, Church D, Aburatani H, et al. Molecular basis of myotonic dystrophy:
expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 1992;
68: 799-808.
3.
PMID:1310900
Mahadevan M, Tsilfidis C, Sabourin L, Shutler G, Amemiya C, Jansen G, et al. Myotonic dystrophy mutation: an unstable
CTG repeat in the 3' untranslated region of the gene. Science 1992; 255: 1253-1255. PMID:1546325
4.
Fu YH, Pizzuti A, Fenwick RG, Jr., King J, Rajnarayan S, Dunne PW, et al. An unstable triplet repeat in a gene related to
myotonic muscular dystrophy. Science 1992; 255: 1256-1258. PMID:1546326
5.
Salehi LB, Bonifazi E, Stasio ED, Gennarelli M, Botta A, Vallo L, et al. Risk prediction for clinical phenotype in
myotonic dystrophy type 1: data from 2,650 patients. Genet Test 2007; 11: 84-90. PMID:17394397
6.
New nomenclature and DNA testing guidelines for myotonic dystrophy type 1 (DM1). The International Myotonic
Dystrophy Consortium (IDMC). Neurology 2000; 54: 1218-1221. PMID: 10746587
7.
Morales F, Couto JM, Higham CF, Hogg G, Cuenca P, Braida C, et al. Somatic instability of the expanded CTG triplet
repeat in myotonic dystrophy type 1 is a heritable quantitative trait and modifier of disease severity. Hum Mol Genet
2012; 21: 3558-3567. PMID: 22595968
8.
Warner JP, Barron LH, Goudie D, Kelly K, Dow D, Fitzpatrick DR, et al. A general method for the detection of large
CAG repeat expansions by fluorescent PCR. J Med Genet 1996; 33: 1022-1026. PMID: 9004136
9.
Romeo V. Myotonic Dystrophy Type 1 or Steinert's disease. Adv Exp Med Biol 2012; 724: 239-257. PMID: 22411247
10. Sizhong Z, Hui W, Agen P, Cuiying X, Ge Z, Yiping H, et al. Low incidence of myotonic dystrophy in Chinese Hans is
associated with a lower number of CTG trinucleotide repeats. Am J Med Genet 2000; 96: 425-428. PMID: 10898927
11. Grewal RP, Zhang S, Ma W, Rosenberg M, Krahe R. Clinical and genetic analysis of a family with PROMM. J Clin
Neurosci 2004; 11: 603-605. PMID:15261229
12. Prior TW. Technical standards and guidelines for myotonic dystrophy type 1 testing. Genet Med 2009; 11: 552-555.
PMID: 19546810
13. Musova Z, Mazanec R, Krepelova A, Ehler E, Vales J, Jaklova R, et al. Highly unstable sequence interruptions of the
CTG repeat in the myotonic dystrophy gene. Am J Med Genet A 2009; 149A: 1365-1374. PMID:19514047
14. Lin X, Miller JW, Mankodi A, Kanadia RN, Yuan Y, Moxley RT, et al. Failure of MBNL1-dependent post-natal splicing
transitions in myotonic dystrophy. Hum Mol Genet 2006; 15: 2087-2097. PMID:16717059
15. Xie H, Zheng H, Zheng S, Deng B, Xu J, Cui Y, et al. DNA analysis of a pedigree with myotonic dystrophy in Songjiang
county, Shanghai. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2000; 17: 319-322. (Chin) PMID:11024209
16. Shelbourne P, Davies J, Buxton J, Anvret M, Blennow E, Bonduelle M, et al. Direct diagnosis of myotonic dystrophy
with a disease-specific DNA marker. N Engl J Med 1993; 328: 471-475. PMID:8421476
17. Buxton J, Shelbourne P, Davies J, Jones C, Van Tongeren T, Aslanidis C, et al. Detection of an unstable fragment of DNA
specific to individuals with myotonic dystrophy. Nature 1992; 355: 547-548. PMID:1346924
18. Radvansky J, Ficek A, Kadasi L. Repeat-primed polymerase chain reaction in myotonic dystrophy type 2 testing. Genet
Test Mol Biomarkers 2011; 15: 133-136. PMID:21204698
19. Addis M, Serrenti M, Meloni C, Cau M, Melis MA. Triplet-Primed PCR Is More Sensitive Than Southern Blotting-Long
PCR for the Diagnosis of Myotonic Dystrophy Type1. Genet Test Mol Biomarkers 2012; 16 : 1428-31. PMID:23030650
20. Braida C, Stefanatos RK, Adam B, Mahajan N, Smeets HJ, Niel F, et al. Variant CCG and GGC repeats within the CTG
expansion dramatically modify mutational dynamics and likely contribute toward unusual symptoms in some myotonic
dystrophy type 1 patients. Hum Mol Genet 2010; 19: 1399-1412. PMID:20080938
21. Radvansky J, Ficek A, Minarik G, Palffy R, Kadasi L. Effect of unexpected sequence interruptions to conventional PCR
and repeat primed PCR in myotonic dystrophy type 1 testing. Diagn Mol Pathol 2011; 20: 48-51. PMID: 21326039
22. Li Y, Da YW. [Detection for trinucleotide repeats in myotonic dystrophy type 1]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi
2012; 29: 16-18. (Chin) PMID:22311484
Tables
Table 1 Clinical characteristics of 62 DM1 patients.
Parameter
DM1 patients (N = 62)
Age (years)
36.32 ± 13.14
Sex (m/f)
35/27
Onset age (years)
27.12 ± 13.94
Course (years)
7.92 ± 7.47
Positive family history (%)
37 (59.68%)
Myotonia (%)
58 (93.55%)
Strength (score on 15 muscles, MRC scale)
123.70 ± 13.83
Muscular atrophy (%)
43 (69.35%)
Serum creatine kinase levels (IU/L)
291.33 ± 150.74
Cataract (%)
44 (70.97%)
IGT or Diabetes mellitus (%)
10 (16.13%)
Abnormal level of gonadal hormone (%)
34 (54.84%)
First degree AVB (%)
13 (20.97%)
MRC scale = Medical Research Council scale (0–5 grade); IGT = impaired glucose tolerance; AVB = atrioventricular block
Table 2
Primer sequences
Location
Purpose
Name
Sequence（5’ → 3’）
Forward
PCR (DMPK)
P1
CCAGCTCCAGTCCTGTGATC
Reverse
PCR (DMPK)
P2
TGCACAAGAAAGCTTTGCAC
Forward
PCR (CNBP)
P3
GCCTAGGGGACAAAGTGAGA
Reverse
PCR (CNBP)
P4
GGCCTTATAACCATGCAAATG
Forward
Probe amplification
Pro1
TCACCCTACGTCTTTGCGAC
Reverse
Probe amplification
Pro2
ATCACAGGACTGGAGCTGG
Forward
TP-PCR
p1-FAM
AGAAAGAAATGGTCTGTGATCCC
Reverse
TP-PCR
p2
GAACGGGGCTCGAAGGGTCCTTGTAGCCG
Universal
TP-PCR
p3R
TACGCATCCCAGTTTGAGACG
Within
TP-PCR
p4CTG
TACGCATCCGAGTTTGAGACGTGCTGCTGCTGCTGCT
Legends for illustrations
Figure 1. Restriction map of the DMPK gene with relative location of CTG repeats. Sites displaying
digestion are shown in bold line across the gene. The Bgl I digestion results in ～3.4kb band. Area from
10312 to 11201 represents target sequence flanking (CTG)20 used as probe amplification.
Figure 2. Representative results of molecular diagnosis. A: Electrophoretogram of CTG repeat
amplification in DMPK gene. M represented 100bp DNA ladder. N represented a normal control.
Numbers at the top represented individual samples. Numbers at the bottom represented the CTG repeat
size. B: Sequencing diagram of a larger normal allele in sample 16 showed 31 CTG repeats (marked by
arrow). C: Southern blot analysis with dig-labeled probes found a ~3.4kb band in all samples, a ~4.0kb
band in sample 15 and a smear larger than 3.4kb (marked by asterisk) in samples 1, 2 and 8. It failed to
detect larger alleles in sample 4, 10 and 13 who were diagnosed as DM1 by later TP-PCR analysis. D:
Southern blot with α-32P-labeled probe found a normal size band with ~3.4kb and abnormal amplified
band larger than 3.4kb (marked by asterisk) in samples 23 ,24, 25 and 26. Only one normal size band was
found in sample 20, 21 and 22. E: TP-PCR analysis of sample 25. Reaction one (upper panel) showed one
normal allele and reaction two (lower panel) showed an expanded allele. F: TP-PCR analysis of sample
20. Reaction one showed one normal allele and reaction two showed no expanded allele.