Download Functional Complexity Associated with the EspB Molecule of

Functional
Complexity
Associated
with
the
EspB
Molecule
of
Enterohemorrhagic Escherichia coli
Hao-Jie Chiu and Wan-Jr Syu*
Institute of Microbiology and Immunology
National Yang-Ming University
*To whom correspondence should be addressed. Tel.: 886-2-28267112; Fax:
886-2-28212880;
Email: [email protected]
Abstract
In enterohemorrhagic Escherichia coli (EHEC), the type III secretion system plays
an important role in the bacteria/host cell interactions during the infection. One of the
type III secretion proteins, EspB, is translocated into the host cells and engaged in the
adherence, pore formation, and effector-translocation. We have previously mapped the
secretion domain of EspB to a minimum length of 190 residues. To define the other
functional domains of EspB, we have created several plasmids encoding different
fragments of EspB and analyzed the lost functions inherited with the full-length
molecule. One finding is that EspB requires residues 118 to 190 of EspB for both
efficient translocation of EspB and interaction of EspB with EspA. On the other hand,
the segment consisting of residues 217 to 312 is necessary for the bacterial adherence.
Furthermore, a predicted trans-membrane domain (residues 99-118) was founded
critical for EHEC to cause red blood cell haemolysis, presumably by forming pores on
the cell membrane. The same segment (residues 99-118) was also important to the
actin accumulation induced beneath the bacterial attachment site. Finally, various
EspB fragments, except for that of residues 1-190, expressed in the lysates of K-12
strain were found capable of association with HeLa cells. Taking together, the EspB
with a total of 312 residues have various functions associated with different regions.
These regions may form complex structures in which domains interplay with each
other or interact with other components of the type III system to orchestrate the
complicated actions of bacteria during infection.
Introduction
Escherichia coli O157:H7 is the major pathogen that causes a serious illness known
as enterohemorrhagic diarrhea and haemolytic uremic syndrome (Nataro and Kaper,
1998). Several virulent factors have been reported to attribute to the pathogenesis of
this microbe. One of these factors is a type III secretion system (TTSS) that induces
attaching and effacement lesion (A/E lesion) of enterocytes. The genes encoding the
proteins for TTSS and effectors reside on a locus for enterocyte effacement (LEE)
island that comprises a total of 41 genes. The LEE island is commonly found in other
pathogens including enteropathogenic E. coli (EPEC) and Citrobacter rodentium
(McDaniel and Kaper, 1997;Schauer and Falkow, 1993).
Most of the LEE genes are located in five major operons: LEE1, LEE2, LEE3,
LEE4, and LEE5. EspA (Kenny et al., 1996), EspB (Donnenberg et al., 1993), and
EspD (Donnenberg, Yu, and Kaper, 1993;Lai et al., 1997) are three of the proteins
encoded by LEE4. They are secreted by TTSS, and gene deletions abolish the
translocation of the effector proteins such as Tir (Chiu et al., 2003;Kenny et al., 1997),
EspF (Crane et al., 2001) and MAP (Kenny and Jepson, 2000). Tir serves as a
receptor for bacterial intimin binding and along with EspF and MAP acts as an
effector protein to subvert multiple cellular processes. EspA is believed to form a
hollow filamentous structure on the bacterial surface to deliver the effector proteins
(Knutton et al., 1998), and it may also play a role in adherence of EHEC to the host
cell (Cleary, 2004). EspD has been found to target to host cell membrane (Wachter et
al., 1999) whereas EspB is translocated to both membrane and cytoplasm (Wolff et al.,
1998). Both EspB and EspD have been proposed to be involved in the pore formation
on the infected cells (Ide et al., 2001) and have been classified as translocators (Roe et
al., 2003). The N-terminal region of EspB has been found to bind to the host cell
-catenin directly that results in the recruitment of -catenin under the bacteria
adherence site (Kodama, 2002). Without the presence of host cells, these translocators
and effectors are seen abundantly in the media when appropriate culturing conditions
such as M9 or media for the host cell cultivation are provided at the body temperature.
To orchestrate the synthesis, secretion, adhesion, and delivery of effectors into the
host cells, individual molecules from the LEE must interact with many bacterial or
host cellular proteins to achieve their final functions. Using secretion and
translocation as examples, certain domains of the type III secreted proteins may have
to be bound by the corresponding chaperones while others to be recognized by TTSS.
In the case of EPEC Tir, domains or segments required for secretion and/or
translocation (Abe et al., 1999;Crawford and Kaper, 2002;Gauthier et al., 2000),
bindings of CesT (Abe et al., 1999) and intimin (de Grado et al., 1999), and
interaction with NcK have been reported (Gruenheid et al., 2001). In our previous
study with the secretion of EHEC EspB, one essential region (residues 1-118) and two
auxiliary segments (residues 118-190 and residues 191-282) have been defined (Chiu,
Lin, and Syu, Jr., 2003). In this study, we further dissected the molecule and
determined the regions required for its own translocation and interaction with EspA.
As EspB is translocated to the host cell membrane, we also addressed whether its
deletion affects the adherence of bacteria to the host cells and whether there is any
domain responsible for membrane insertion. As a translocator, whether there is a
domain in EspB affects the translocation of Tir was also explored.
Materials and Methods
Bacterial strains and Cell culture
EHEC strain 43888 was obtained from American Type Culture Collection (ATCC).
The espB deleted strain of EHEC (B) has been described previously (Chiu, Lin, and
Syu, Jr., 2003). The tir deleted strain (Tir) was similarly constructed with the same
strategy and will be described somewhere else. Regularly bacteria were grown in LB
broth (Difco), and the media were supplemented with appropriate antibiotics
whenever necessary. HeLa cells were maintained in Dubelcco's Modified Eagle
Medium (DMEM) supplemented with 10% fetal calf serum and cultured at 37 C with
5% CO2.
General recombinant DNA techniques
Unless otherwise stated, restriction endonucleases, DNA modified enzymes, and
polymerases were purchased from New England BioLabs. DNA manipulation
procedures were followed either as described in Molecular Cloning (Sambrook J and
Russell DW, 2001) or as recommended by the manufacturers. DNA was purified from
a mini-column (Qiagen) and sequenced automatically by a contract service (Mission
Biotech).
Plasmids
To create pBp312D, plasmid pB312D (Chiu, Lin, and Syu, Jr., 2003) was amplified
with primers PQE60-2R (TGACTGCAGGGTTAATTTCTCCTC) and PEspB-9
(TAACTGCAGATGAATACTATTGATAAT). After amplification, the PCR product
was digested with PstI and self ligated by using T4-DNA Ligase (New England
Biolabs). To create plasmids pB312, pB282, pB250, pB220, and pB190, pBp312D was
used as the template and PCR amplified with primer pairs PB939RS
(CGCGGATCCTTACCCAGCTAAGCGACCCG)/PEspB-9, PB846RS
(CGCGGATCCTTAATCATCCTGCGTTCTGCG)/PEspB-9, PB750RS
(GCGGGATCCTTAAGTCGATTTGACGGACTC)/PEspB-9, PB660RS
(GCGGGATCCTTACAGTTTATCTACGGAATTCAA)/PEspB-9 and PB570RS
(CGCGGATCCTTAAACATCATCTGCAACGCC)/PEspB-9, respectively. After
amplification, the PCR products were digested with PstI/BamHI and ligated with
vector derived from pBp312D digested with the same enzymes. Plasmids pBd191-253,
pBd187-216, pBd118-190 and pBd99-118 were created by an inverted PCR method
(Vandeyar et al., 1988); (Weiner et al., 1993) using pB312 as template. The primers
pairs used were PB570R (TTAAACATCATCTGCAACGCC)/PB760
(AATGAACAACGTGCGAAG), PB558R (AACGCCAGATGCACGGCT) /PB649
(GTAGATAAACTGACCAATACC), PEspB-14R
(TGCTGCAAAAGAACCTAA)/PEspB-19 (GCGAAAGCCACTGAC) and PB294R
(AGCGGTTGCCGCGGCTTT)/PB355 (AACAACGCGGCTAAAGGG),
correspondingly. The PCR products were phosphorylated by T4 DNA kinase (New
England Biolabs) and then self ligated to produce the designated constructs.
To create pEspA-His, the entire espA gene was PCR amplified from the
chromosomal DNA of EHEC strain 43888; the used primers PEspA-1 and PEspA-3R
had the nucleotide sequences of CTAACCATGGATACATCAAATGCA and
CGCAGATCTTTTACCAAGGGATATTGC, respectively, in which restriction
enzyme sites were underlined. After PCR amplification, the obtained DNA fragment
was digested with NcoI/BamHI and cloned into NcoI/BamHI sites of pQE60 (Qiagen),
to create pEspA-His for expression of EspA-Hisx6.
Fractionation of Cells after Bacterial Infection
The method of fractionation was slightly modified from protocol previously described
(Gauthier, de Grado, and Finlay, 2000) and analysis of antigens was performed as
previously described (Hsu et al., 2000). HeLa cells cultured in 100-mm plates to
eighty percent confluence were washed with PBS. Overnight grown bacteria were
1:100 diluted and added to the HeLa cells for 6 hours. After infection, the cells were
washed with PBS two times and scratched off the plates in cold buffer (3 mM
imidazole pH 7.4, 250 mM sucrose, o.5 mM EDTA, 1 mM sodium orthovanadate, 1
mM sodium fluoride and 1 M pepstatin). The mixture was passed through 22-gauge
needles 8 times. And the unbroken cells with the bacteria were pelleted down by
centrifugation twice at 3,500 g for 15 minutes. To collect the disrupted membrane
fraction of the cells, the recovered supernatant was further centrifuged at 20,000 g for
45 minutes. Cytosolic proteins in the supernatant were precipitated by adding
one-ninth volume of trichloroacetic acid and further incubated at 4 C for 1 h.
Proteins in the precipitates were then collected by centrifugation. Proteins from each
sample were dissolved in SDS sample buffer and separated by 12% SDS-PAGE
followed by Western blotting.
Immunoblotting
Western blotting analysis of antigens was performed as previously described
(Hsu et al., 2000). Anti-EspB antibody (Chuang et al., 2001) was prepared by
immunizing rabbits with EspB purified from the secreted proteins of strain 43888 by
gel elution. Anti-EspA antibody was produced similarly by immunizing rabbit with
gel-purified EspA. The mouse anit-actin antibody (MAB1501) was purchased from
Chemicon. To capture the primary antibodies bound onto the antigens on the
nitrocellulose membrane, horseradish peroxidase-conjugated goat secondary
antibodies (Sigma) were used. The membranes were finally developed by exposure on
X-ray films using Renaissance Western Blot Chemiluminescence Reagent Plus
(NEN).
Affinity Binding to Ni++ Column
Ni-NTA agarose beads (Qiagen) were packed into columns and charged with Ni++ by
passing through with five bed volumes of 100 mM NiSO4, and finally equilibrated in
Tris-buffered saline (TBS). E. coli lysates derived transformants harboring pEspA-His,
pQE60, pB312, pBd118-190, pBd187-216 and pB190 respectively, were prepared in
TBS. The lysate containing EspB was mixed in an equal volume with that containing
EspA-Hisx6 or the pQE60 control lysate. The mixture were gently inverted at 4C for
1 h and passed through the TBS-equilibrated Ni++ columns. After washings with TBS
containing 50~150 mM imidazole, proteins retained in the columns were eluted with
500 mM imidazole in TBS and analyzed by Western blotting.
Adherence Assay
The method used to analyze the adherence of EHEC to cells was slightly modified
from that described previously (Gansheroff et al., 1999). In brief, 2 x 105 HeLa cells
were plated in 12-well plates. After incubation overnight, the cells were washed with
PBS and maintained in DMEM without any additives. Overnight grown bacteria were
1:100 diluted and added into the cells, and infection was kept for 6 hours. Thereafter,
the cells were harvested and lysed in PBS containing 10% Saponin solution (5 mM
Tris-HCl pH7.4, 0.4 mM NaVO4, 0.1 mM phenyl methyl sulfonyl fluoride) at 4 C for
10 minutes. The cell lysates were serially diluted with LB and plated on LB agar
plates supplemented with ampicillin. After 16-h incubation at 37 C, colony-forming
units were scored and the relative adherence efficiencies were calculated.
Red Blood Cell Haemolysis Assay
Human red blood cells (Type B) were washed with PBS three times and suspended in
PBS to a final concentration of 3% (v/v). RBC was then plated on wells of 12-well
plates (700 l/well) coated with 1% poly-lysine for 20 min at 37 C followed by two
PBS washes and incubated in DMEM medium without phenol red. Overnight grown
bacteria were added to the RBC culture and incubated at 37C in the presence of 5%
CO2. After 6 hours infection, the culture medium was harvested and centrifuged.
Experiments were carried out in triplicates and the resulted supernatant was measured
at 543 nm for the released hemoglobin by an ELISA reader (TECAN RainBow). The
RBC haemolysis were calculated with the equation [(S-B)/(T-B)]; S is value from the
sample measurement, B stands for the absorbance of the supernatant derived from
uninfected RBC monolayers incubated under the same condition, and T represents the
total haemolysis value obtained RBC monolayers incubated in diluted PBS, 1:30
diluted in distilled water.
Immunofluorescence Staining
Immunofluorescence staining was carried out as the methods described by Lin et al.,
(1999)(Lin et al., 1999). 2 x 105 HeLa cells were plated on glass cover slips in
6-welled plate and cultured in DMEM with 10% fetal calf serum. Over-night grown
bacteria were 1:100 diluted into the culture and infected for 6 hours. After infection,
the cells were gently washed with cold PBS two times and fixed with 4%
paraformadehye for 20 minutes at 37 C. Then the cells were permeablized with 0.5
% Triton X-100 in PBS and blocked with 3% BSA in PBS. To stain the EHEC, rabbit
anti-O157 antibody (Difco) was used to detect the O-antigen of EHEC and traced by
fluorescein isothiocyanate (FITC)-labeled anti-rabbit immunoglobulin (Jackson Lab).
To stain the actin filaments, cells on the cover slips were treated with TRICT-labeled
phalloidin (Jackson Lab) (5g/ml) in dilution buffer (PBS containing 1% bovine
serum albumin). The stained cells on cover slips were examined using a fluorescence
microscope (Olympus BX51) and pictured with a cool CCD camera (Photometrics
CoolSNAP fx).
Cell Pull-Down
To examine the interaction of EspB with cells, cultured HeLa cells were treated with
trypsin and suspended in PBS. After washing with PBS two times, the cells were
suspended in DMEM and 9:1 diluted with lysate of plasmid-transformed E. coli
(JM109). After gently inverting at 4 C for 15 minutes, the cells were vigorously
washed with PBS five times and proteins of the cells were separated with 12%
SDS-PAGE. To detect the associated EspB, separated proteins were
electro-transferred to nitrocellulose paper and immunoblotted with rabbit anti-EspB
antibody.
Results
Segment of EspB critical for translocation
EspB is a type III secreted protein that translocates into the membrane and
cytoplasm of the bacteria-infected cells. Our previous study has demonstrated the
C-terminal region (residues 282-312) of EspB is dispensable for the type III secretion
(Chiu, Lin, and Syu, Jr., 2003), and constructs shorter than that are secreted less
efficiently or completely retained within the bacteria. To study whether the secretion
ability of EspB is in parallel to that with its own translocation, we examined the
membrane and the cytosolic fractions of the host cells for the presence of various
constructs. To ensure that the host cells are properly infected, the expression plasmids
in Fig. 1A were transformed into the wild-type EHEC. Detection of the authentic
EspB in the host cell content thus warranted a proper infection.
The infected cells with the attached bacteria were prepared as a total lysate in the
SDS gel sample buffer. Alternatively, bacteria were removed together with unbroken
cells by low speed centrifugation after cells were disrupted by freeze and thaw. The
remaining was then fractionated into cell membrane and cytosolic fractions. These
preparations were then analyzed by Western blotting using anti-EspB antibodies (Fig
1B), The authentic EspB encoded by the chromosomal espB was detected in all
samples, and the truncated EspB molecules, as seen with sizes smaller than that of the
authentic, were also detected. The latter observation indicated that all the constructs
were properly expressed.
When the membrane fraction of the infected cells was examined, all but pB190 and
pBd118-190 gave products detected by anti-EspB (Fig. 1C, lanes 2-9). Since the
bacterial outer membrane protein A (OmpA) was not detected in these samples, the
possibility of intact bacteria contaminated in this fraction was excluded (data not
shown). Thus, a positive detection represented a proper translocation. The same set of
truncated EspB constructs seen in the membrane fraction was also detected in the
cytosolic fraction (Fig. 1D), a result consistent with the property of translocation.
Similarly, the products derived from pB190 and pBd118-190 not found in the
membrane fractions of the infected cells were not seen in the cytosol. The failure of
detection could not be attributed to a low level of expression since that from pB250,
expressed equally as that from pB190 or poor than that from pBd119-190, was
successfully translocated. These facts indicated the loss of EspB translocation ability
with constructs from pB190 and pBd118-190, respectively.
Intriguingly, these two constructs have been previously found in the spent media,
and retained a secretion efficiency of about 40% of the full-length EspB (Chiu, Lin,
and Syu, Jr., 2003). Thus, as to EspB, secretion does not warrant a successful
translocation. Furthermore, the bacterial lysate derived from pB250 gave an additional
product with size smaller than the expected (Fig. 1B, lane 3). This product was not
found in either membrane or cytosolic fraction and may represent a degradation
product that is no more translocated.
Interaction of EspB with EspA
EspB has been reported to interact with EspA after secreted to the medium
(Hartland et al., 2000). Deletion of espA in EPEC was also found to affect the
translocation of EspB (Knutton et al., 1998), so we investigate whether EspB
defected in translocation remains interactive with EspA. Proteins from pB190 and
pBd118-190 were tested along with three other controls (Fig. 2A) in an affinity
column retention assay, in which, EspA tagged with a C-terminal Hisx6 epitope was
pre-bound to a Nickel ion column. The results (Fig. 2B) indicated that the full-length
EspB encoded by pB312 and those derived from pB282 and pBd187-216, respectively,
were specifically retained in the column. In contrast, the products resulted from
pB190 and pBd118-190 completely lost the ability, suggesting a fact that the
constructs not translocated also lost the ability to interact with EspA.
Domain between C-terminus and coil-coil domain of EspB was important for
adherence of EHEC to the host cell
In EPEC, deletion of espB afftects the adherence of bacteria to host cell
(Donnenberg, Yu, and Kaper, 1993), but not the length of EspA filaments and
translocation of EspD. (Delahay et al., 1999;Hartland et al., 2000;Knutton et al.,
1998;Wachter et al., 1999). To investigate whether the translocatable EspB fragments
can restore adherence of EHEC to the host cells, EspB-expressing plasmids were
transformed into an espB knock-out strain of EHEC (i.e.B), and recovery of the lost
bacterial adherence was examined.
Fig. 3 shows that B complemented with the full-length EspB expressed from
pB312 can restore the bacterial adherence to level similar to that of the wild-type
strain transformed with a control vector pQE60. Increasing deletions from the
C-terminus of EspB such as that from pB282, pB250, pB220 and pB190 results in no
adherence to the cells. Furthermore, the deletion with residues 191-253 of EpsB (in
pBd191-253) obviously affected the adherence of EHEC to host cell (Fig. 3). In
contrast, truncation at residues 118-190 (in pBd118-190) that abolished both
translocation and interaction with EspA apparently did not affect bacterial adherence.
Deletion of coil-coil domain (residues 187-216), and transmembrane domain (residues
99-118) also do not have any effect on adherence (Fig. 3). Therefore, the domain
between C-terminus and coil-coil domain of EspB must be important for the bacterial
adherence. Besides, it is obvious that adherence of bacteria to cells involves regions
of EspB different from that for translocation and reaction with EspA.
Tir is a type III effector protein tranlocated into the host cells to function as a
receptor for bacterial membrane protein, intimin. Tir-intimin interaction was reported
to be important for intimate attachment of bacteria and host cells (Kenny et al., 1997).
However, deletion of espB also blocks the translocation of Tir (Kenny et al., 1997), so
it is important to clarify the role of Tir played in our system. For this purpose, an
isogenic strain with tir deleted (Tir) were included in our adherence assays.
Apparently, the results in Fig. 3 showed that B lost the adherence activities but not
Tir, and EspB is the major determinant in this system.
Regions of EspB critical for causing RBC haemolysis.
EspB together with EspD was thought to form pores at the membranes of the
infected cells (Kenny et al., 1997;Warawa et al., 1999); (Ide et al., 2001). In EPEC,
this activity can be assayed with haemolysis of human red blood cell (RBC), and
deletion of either espA, espD, or espB was found to attenuate the hemolytic activity of
EPEC (Warawa, Finlay, and Kenny, 1999). To examine the role of EHEC EspB
involved in the haemolysis, RBC was incubated with the bacteria used in Fig. 3, and
hemoglobin released after 6-h incubation was measured. Fig. 4 shows that deletion of
espB also turn down the haemolytic activity of EHEC and the deletion of Tir had a
slight decreasing effect. All constructs of EspB (in pB282, pB250, pB220, pB190, and
pBd191-253) failed in the adherence assay also failed in haemolysis of RBC. Thus,
the results with the adherence and haemolysis assays seemed to be in parallel except
in one construct, i.e. pBd99-118. Deletion of residues 99-118 apparently did not affect
the adherence but did abolish the RBC haemolysis activity. Residues 99-118 have
been predicated to form a transmembrane region, and thus it is proposed that EspB
may mediate the adherence through a structure that involves the C-terminal region,
particularly the last 30 residues and residues 191-253. After the adherence, EspB may
further participate the pore formation involving residues 99-118.
In EHEC, a virulence factor, hemolysin, was also reported to confer RBC
haemolysis during the infection, and the responsible gene was located at a 60-MD
plasmid (Bauer and Welch, 1996;Schmidt et al., 1996). But by comparing the
hemolytic activity of wild-type and B, it seems that the hemolysin was not important
in this assay.
Regions of EspB critical for the actin accumulation activity of EHEC (B)
Deletion of espB affects the translocation of type III effectors (Foubister et al.,
1994) including Tir that is necessary for the actin accumulation underneath the
bacteria attachment site(Kenny et al., 1997). Therefore, a failure of actin
accumulation may reflect a defected function of EspB involved in the translocation of
Tir. To investigate how EspB is involved, cells infected with the plasmid-transformed
B were stained for the condensed actin using TRITC-labeled phalloidin (Fig. 5). B
gave no condensed actin accumulations underneath the bacteria that were clearly seen
with the wild-type bacteria (compare panels A and B). Neither B transformed with
the control vector pQE60 nor Tir (data not shown) yielded the positive result. When
B was separately transformed with pB282, pB250, pB220 and pBd191-253 that
failed to adhere to the host cells in Fig. 3, none of the transformants resulted in
formation of focused actin condensation (panel C-J). Furthermore, the one failed in
the lysis of RBC, i.e. pBd99-118, also yield a negative result. On the other hand, ΔB
transformed with pB312, pBd187-216, and pBd118-190, respectively, that retained
the RBC haemolysis activity (Fig. 4) were able to induce actin accumulation.
Therefore, to assist the translocation of Tir, as reflected by causing the actin
accumulation, the EspB constructs of bacteria must retain the property of adhering to
the host membrane and forming the pores. Apparently, the additional region
containing residues 99-118 that was needed for RBC haemolysis (Fig. 4) was also
critical for the actin accumulation (Fig. 5).
EspB can direct associated with HeLa cells.
Shown in Fig.3, B with EspB deleted seriously attenuate the bacterial
adherence to the host cells, a fact suggesting that EspB may confer the adherence
directly or indirectly. The involvement of Tir, required for intimate interaction, in this
adherence assay was not supported since no effect was observed with Tir.
To test whether EspB is able to associate directly with the host cells without the
help of the other LEE proteins, we analyzed the association of EspB with HeLa cells
directly. Various products of espB constructs in Fig. 1A were prepared in E. coli
(JM109) (Fig. 6C) were mixed and incubated with suspended HeLa cells. To
inactivate the endocytosis of cell, the reaction was take at 4°C. The EspB molecules
associated with the cells were then detected by immunoblotting using anti-EspB
antibodies (Fig. 6B). The results showed that all the truncated EpsB molecules readily
associate with HeLa cells except for that derived from pB190. Therefore, EspB
secreted into the vicinity of a host cell may associate with the host cells, perhaps in a
less efficient way but independent from molecule such as EspA.
Discussion
The LEE comprises 41 ORFs that are involved in A/E lesion. Systematic deletion
of individual genes has been recently performed with C. rodentium (Deng et al.,
2004), and the results indicated that no single gene could be deleted without damaging
the degree of bacterial virulence. The implication, then, could be the complexity of
gene regulation and interplays of the gene products. Deletion of EspB completely
abolishes the bacterial adhesion, actin rearrangement, translocation of Tir, and then
the bacterial virulence. Therefore, multiple functions must be played by EspB during
this process of host-bacteria interaction. To unfold the functional complexity that
coined in the structure of EspB molecule, we have dissected the molecule and
generated different constructs of EspB. By complementation of an EspB-deleted
mutant, the association of domain and function were obtained and summarized in Fig.
7A.
As shown previously, the N-terminal 118-residue region of EspB is critical but not
sufficient for the secretion (Chiu, Lin, and Syu, Jr., 2003). To reach a detectable
secretion, EspB must have either residues 119-190 or 190-282. To obtain a full
secretion capacity, the N-terminal EspB must extend toward the C terminus.
Previously concluded is that the C-terminal segment consisting of residues 282-312 is
the only dispensable region in this regard. Since to execute the translocator’s
functions, EspB must first be secreted from the bacteria. Any construct that lacks the
N-terminal first 118 residues are not secreted at all, and it would not possibly function
for other purposes (Fig. 7).
Translocation of EspB apparently required the same regions of EspB that were
critical to interact with EspA (Fig. 7A). The interaction of EspA and EspB has been
reported (Hartland et al., 2000), and here we have further shown that structure
formed by residues 118 to 216 of EspB are needed for this interaction. But in Fig. 6, it
shows that EspB could interact with host cell membrane without other proteins of the
type III secretion system. So we hypothesize that the EspA-filament may carry the
EspB close to the cell membrane and facilitate its translocation.
Early adherence of bacteria to HeLa cells apparently involves EspB, particularly
the C-terminal region (Fig. 7A). The EspB construct having the first 282 residues was
translocated well into the host cells but did not restored the lost adherence of EHEC
(B). Therefore, the C-terminal residues 282-312 should be important for the
bacterial adherence. However, retaining this C-terminal region but deleting residues
191-253 (in pBd191-253) of EspB did not recover the adherence phenotype either
(Fig. 7A). On the other hand, EspB constructs (in pBd118-190, pBd99-118, and
pBd187-216) without deleting residues 216-312 appeared to have recognizable
adherence. Therefore, C-terminal to residue 216 of EspB (Fig. 7B) seemed to
contribute to the adherence of bacteria to host, perhaps at the early phase after the
interaction with EspA. This adherence may occur as an effect of translocation of EspB
as well as EspD, onto the host cell membrane. If so, it would have some overlapping
results with that from RBC haemolysis experiment, in which the measured RBC
haemolysis is also based upon the formation of membrane pores on RBC by EspB
together with EspD. Indeed, the C-terminal region of residues 216-312 is important
for both the adherence characteristic and the RBC haemolysis (Fig. 7B). However, to
cause the lysis of RBC, an additional domain of EspB that has a high degree of
hydrophobicity apparently is involved, i.e. residues 99-118. Intriguingly, all the
regions important for RBC haemolysis matched with that critical for the formation of
condensed actin structure underneath the sites where bacteria attached. The actin
accumulation has been correlated with the successful translocation of Tir. Therefore,
residues 99-118 of EspB that have been implicated as the transmembrane region may
be important for facilitating a proper topological organization of EspB on the
membrane to form pores that cause the RBC rupture and Tir translocation.
In Fig. 3, the tir deleted strain of EHEC did not decrease the adherence ability
measured in our system. This fact indicates that this adherence measured is different
from the intimate attachment mediated by interaction of intimin and Tir. As
hypothesized above, EspB may contribute to the adherence by forming complex with
EspD but may have to translocate first by interacting with EspA. In this study,
truncated EspB molecules still can be translocted in EHEC (B) which was seriously
attenuated in adherence to host cell, (truncation of EspA-interacting domain at
residues 118-190 or at 187-216 of EspB did not affect the adherence of EHEC).
Therefore, at least in EspB, the function of translocation appeared to be uncoupled
from the activity of adherence, and it remained to be explored whether the c-terminal
region of EspB responsible for the adherence is involved in the interaction with EpsD.
Shown in Fig 4 and 5, deletion of espB affected the haemolysis and actin
accumulation caused by EHEC. Furthermore, trans-complementation with some EspB
fragments did not rescue these two phenotypes of EHEC (B). Among these EspB
fragments, product of pBd118-190 was unable to translocate efficiently through direct
interaction with EspA as shown in Fig. 1 and Fig. 2. It seemed to be conflicted that
Bd118-190 could form pore on host cell’s membrane to result RBC haemolysis but
failed to translocate to the host cells. Looking at the capability of adherence per se,
we speculated that this truncated EspB molecule might associate with HeLa cells in
an alternative route without interacting with EspA. Perhaps, the efficiency of EspB’s
translocation through the alternative route may be too low to be detected by the
biochemical fractionation (Fig. 1). The alternative translocation of EspB may be a
direct association of EspB with the host cell’s membrane, and thus EspD. This
hypothesis is supported by the last experiment we have carried out in Fig. 6 by direct
incubation of recombinant constructs in crude bacterial lysates with HeLa cells to
address association of EspB constructs with cell membranes. Constructs that have
residues 187-312 of EspB were capable to associate with cells that with additional
residues 118-190 might have enhance the capacity.
In conclusion, our results have shown that interplays of the residues within EspB
are complicated, and to dissect the activities presented with EspB into distinct
domains is relatively uneasy. However, a general summary of structure and function
could be summarized as follows. The N-terminal region is critical for the secretion
that is a premier property for the molecule to have other functions. The middle region
of EspB is importance for interacting with EspA, and the interaction directly or
indirectly is important for its own translocation. The C-terminal region on the other
hand contributes to the adherence of bacteria to the host cells as well as to the
consequence after correct positioning EspB on the host membrane. Nevertheless,
other residues located away from the key regions may play some auxiliary roles, as a
cohort of EspB interactions with multiple molecules have to be effectively
coordinated.
Besides, translocation of these truncated EspB molecules in an espB deletion strain of
EHEC was similar to that in the wild type EHEC seen above (data not shown).
Acknowledgements
This research was supported in parts by grant 89-B-FA22-2-4 (Program for
Promoting Academic Excellence of Universities) from the Department of Education
and NSC 92-2320-B-010-048 from the National Science Council, Taiwan, ROC.
Reference List
Abe,A., de Grado,M., Pfuetzner,R.A., Sanchez-Sanmartin,C., Devinney,R.,
Puente,J.L., Strynadka,N.C., and Finlay,B.B. (1999) Enteropathogenic Escherichia
coli translocated intimin receptor, Tir, requires a specific chaperone for stable
secretion Mol.Microbiol 33: 1162-1175.
Bauer,M.E., Welch,R.A. (1996) Association of RTX toxins with erythrocytes
Infect.Immun. 64: 4665-4672.
Chiu,H.J., Lin,W.S., and Syu,W., Jr. (2003) Type III secretion of EspB in
enterohemorrhagic Escherichia coli O157:H7 Arch.Microbiol 180: 218-226.
Chuang,C.H., Hsu,S.C., Hsu,C.L., Hsu,T.C., and Syu,W.J. (2001) Construction of a
tagging system for subcellular localization of proteins encoded by open reading
frames J.Biomed.Sci. 8: 170-175.
Cleary,J. (2004) Enteropathogenic Escherichia coli (EPEC) adhesion to intestinal
epithelial cells: role of bundle-forming pili (BFP), EspA filaments and intimin.
Crane,J.K., McNamara,B.P., and Donnenberg,M.S. (2001) Role of EspF in host cell
death induced by enteropathogenic Escherichia coli Cell Microbiol 3: 197-211.
Crawford,J.A., Kaper,J.B. (2002) The N-terminus of enteropathogenic Escherichia
coli (EPEC) Tir mediates transport across bacterial and eukaryotic cell membranes
Mol.Microbiol 46: 855-868.
de Grado,M., Abe,A., Gauthier,A., Steele-Mortimer,O., DeVinney,R., and Finlay,B.B.
(1999) Identification of the intimin-binding domain of Tir of enteropathogenic
Escherichia coli Cell Microbiol 1: 7-17.
Delahay,R.M., Knutton,S., Shaw,R.K., Hartland,E.L., Pallen,M.J., and Frankel,G.
(1999) The coiled-coil domain of EspA is essential for the assembly of the type III
secretion translocon on the surface of enteropathogenic Escherichia coli J.Biol.Chem.
274: 35969-35974.
Deng,W., Puente,J.L., Gruenheid,S., Li,Y., Vallance,B.A., Vazquez,A., Barba,J.,
Ibarra,J.A., O'Donnell,P., Metalnikov,P., Ashman,K., Lee,S., Goode,D., Pawson,T.,
and Finlay,B.B. (2004) Dissecting virulence: systematic and functional analyses of a
pathogenicity island Proc.Natl.Acad.Sci.U.S.A 101: 3597-3602.
Donnenberg,M.S., Yu,J., and Kaper,J.B. (1993) A second chromosomal gene
necessary for intimate attachment of enteropathogenic Escherichia coli to epithelial
cells J.Bacteriol. 175: 4670-4680.
Foubister,V., Rosenshine,I., Donnenberg,M.S., and Finlay,B.B. (1994) The eaeB gene
of enteropathogenic Escherichia coli is necessary for signal transduction in epithelial
cells Infect.Immun. 62: 3038-3040.
Gansheroff,L.J., Wachtel,M.R., and O'Brien,A.D. (1999) Decreased adherence of
enterohemorrhagic Escherichia coli to HEp-2 cells in the presence of antibodies that
recognize the C-terminal region of intimin Infect.Immun. 67: 6409-6417.
Gauthier,A., de Grado,M., and Finlay,B.B. (2000) Mechanical fractionation reveals
structural requirements for enteropathogenic Escherichia coli Tir insertion into host
membranes Infect.Immun. 68: 4344-4348.
Gruenheid,S., DeVinney,R., Bladt,F., Goosney,D., Gelkop,S., Gish,G.D., Pawson,T.,
and Finlay,B.B. (2001) Enteropathogenic E. coli Tir binds Nck to initiate actin
pedestal formation in host cells Nat.Cell Biol. 3: 856-859.
Hartland,E.L., Daniell,S.J., Delahay,R.M., Neves,B.C., Wallis,T., Shaw,R.K., Hale,C.,
Knutton,S., and Frankel,G. (2000) The type III protein translocation system of
enteropathogenic Escherichia coli involves EspA-EspB protein interactions
Mol.Microbiol 35: 1483-1492.
Hsu,S.C., Lin,H.P., Wu,J.C., Ko,K.L., Sheen,I.J., Yan,B.S., Chou,C.K., and Syu,W.J.
(2000) Characterization of a strain-specific monoclonal antibody to hepatitis delta
virus antigen J.Virol.Methods 87: 53-62.
Ide,T., Laarmann,S., Greune,L., Schillers,H., Oberleithner,H., and Schmidt,M.A.
(2001) Characterization of translocation pores inserted into plasma membranes by
type III-secreted Esp proteins of enteropathogenic Escherichia coli Cell Microbiol 3:
669-679.
Kenny,B., DeVinney,R., Stein,M., Reinscheid,D.J., Frey,E.A., and Finlay,B.B. (1997)
Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into
mammalian cells Cell 91: 511-520.
Kenny,B., Jepson,M. (2000) Targeting of an enteropathogenic Escherichia coli (EPEC)
effector protein to host mitochondria Cell Microbiol 2: 579-590.
Kenny,B., Lai,L.C., Finlay,B.B., and Donnenberg,M.S. (1996) EspA, a protein
secreted by enteropathogenic Escherichia coli, is required to induce signals in
epithelial cells Mol.Microbiol 20: 313-323.
Knutton,S., Rosenshine,I., Pallen,M.J., Nisan,I., Neves,B.C., Bain,C., Wolff,C.,
Dougan,G., and Frankel,G. (1998) A novel EspA-associated surface organelle of
enteropathogenic Escherichia coli involved in protein translocation into epithelial
cells EMBO J. 17: 2166-2176.
Kodama,T. (2002) [Mechanism of A/E lesion formation produced by
enterohemorrhagic Escherichia coli: O157--role of EspB, Tir and cortactin] Nippon
Rinsho 60: 1101-1107.
Lai,L.C., Wainwright,L.A., Stone,K.D., and Donnenberg,M.S. (1997) A third secreted
protein that is encoded by the enteropathogenic Escherichia coli pathogenicity island
is required for transduction of signals and for attaching and effacing activities in host
cells Infect.Immun. 65: 2211-2217.
Lin,H.P., Hsu,S.C., Wu,J.C., Sheen,I.J., Yan,B.S., and Syu,W.J. (1999) Localization of
isoprenylated antigen of hepatitis delta virus by anti-farnesyl antibodies J.Gen.Virol.
80 ( Pt 1): 91-96.
McDaniel,T.K., Kaper,J.B. (1997) A cloned pathogenicity island from
enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E.
coli K-12 Mol.Microbiol 23: 399-407.
Nataro,J.P., Kaper,J.B. (1998) Diarrheagenic Escherichia coli Clin.Microbiol Rev. 11:
142-201.
Roe,A.J., Hoey,D.E., and Gally,D.L. (2003) Regulation, secretion and activity of type
III-secreted proteins of enterohaemorrhagic Escherichia coli O157 Biochem.Soc.Trans.
31: 98-103.
Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn
Cold Spring Harbor Laboratory.
Schauer,D.B., Falkow,S. (1993) Attaching and effacing locus of a Citrobacter freundii
biotype that causes transmissible murine colonic hyperplasia Infect.Immun. 61:
2486-2492.
Schmidt,H., Maier,E., Karch,H., and Benz,R. (1996) Pore-forming properties of the
plasmid-encoded hemolysin of enterohemorrhagic Escherichia coli O157:H7
Eur.J.Biochem. 241: 594-601.
Vandeyar,M.A., Weiner,M.P., Hutton,C.J., and Batt,C.A. (1988) A simple and rapid
method for the selection of oligodeoxynucleotide-directed mutants Gene 65: 129-133.
Wachter,C., Beinke,C., Mattes,M., and Schmidt,M.A. (1999) Insertion of EspD into
epithelial target cell membranes by infecting enteropathogenic Escherichia coli
Mol.Microbiol 31: 1695-1707.
Warawa,J., Finlay,B.B., and Kenny,B. (1999) Type III secretion-dependent hemolytic
activity of enteropathogenic Escherichia coli Infect.Immun. 67: 5538-5540.
Weiner,M.P., Felts,K.A., Simcox,T.G., and Braman,J.C. (1993) A method for the
site-directed mono- and multi-mutagenesis of double-stranded DNA Gene 126: 35-41.
Wolff,C., Nisan,I., Hanski,E., Frankel,G., and Rosenshine,I. (1998) Protein
translocation into host epithelial cells by infecting enteropathogenic Escherichia coli
Mol.Microbiol 28: 143-155.
Figure Legends
Fig. 1. Translocation of truncated EspB in EHEC. (A) Schematic illustration of EspB
constructs with different truncations. Hactched bar represents the construct that was
not detected in the membrane and cytoplasmic fractions of the host cells (see below).
(B) Immunoblotting analysis of the truncated EspB proteins present in different
fractions of the infected cells. Plasmids were separately transformed into the wild type
(WT) EHEC (ATCC 43888), and the corresponding bacteria were used to infect HeLa
cells for 6 h. The infected HeLa cells were washed and then lysed in buffer containing
protease and phosphatase inhibitors, and the total proteins in the lysates were
fractionated into the host cell membrane and cytoplasm fractions. The proteins in
fractions were analyzed for the presence of EspB by Western blotting using rabbit
anti-EspB antibody. Arrow indicates the protein of the plasmid-expressed EspB while
open circle labels the authentic EspB of EHEC. Note: the EspB construct derived
from pBd99-118 was barely separated from the authentic EspB in lane 9.
Fig. 2. Interaction of truncated EspB with EspA.
(A) Analysis of different EspB constructs contained in the bacterial lysates.
Plasmid-transformed E.coli (JM109) lysates were prepared and equal amount of the
lysates were analyzed for the presence of the corresponding EspB construct by
Western blotting using anti-EspB. (B) Analysis of the eluant from Ni+2 NTA column
for the retained EspB constructs. An equal volume of bacterial lysate in (A) was
added to Ni+2 NTA column that was prebound with EspA-Hisx6 from a bacterial
lystae. After washing with TBS containing low concentrations of imidazole, the
proteins retained in the column were eluted with 500mM imidazole and analyzed by
Western blotting using anti-EspB antibody. Eluants used for a control were from Ni+2
NTA column equally treated with lysates derived from bacteria containing pQE60,
from which the expression vector pEspA-Hisx6 was created. Insert shows the same
eluants were Western blotted with anti-EspA. Arrow indicates the protein of
plasmid-expressed EspB.
Fig. 3. Relative competency of various EspB constructs to complement an espB
deleted strain of EHEC (B) to restore the adherence activity. Bacteria were added to
infect HeLa cells for 6 hours. Then the cells were washed, harvested in PBS, and
lysed with saponin. The cell lysates were serial diluted and plated on LB plates
supplemented with ampicillin. After overnight incubation, colony forming numbers
were scored and presented as a percentage of that from the wild-type EHEC (WT).
Note, an isogenic Tir-deleted mutant (tir) was included as a control to show that this
adherence assay was EspB dependent but Tir independent.
Fig. 4. Haemolytic activity of bacteria complemented with various EspB constructs.
Human red blood cells (type B) were coated on 12-well plate and cultured in DMEM
medium without phenol red. Overnight grown bacteria were added to the RBC culture
and incubated for 6 hours. The whole culture was harvested and centrifuged, and the
supernatant was measured at 543 nm by an ELISA reader. The results were shown in
percentage of readings with the wild-type EHEC.
Fig. 5. Focused actin accumulation of bacteria complemented with various EspB
constructs. HeLa cells were plated on slide glass covers and cultured in DMEM
medium with 10% fetal calf serum. Overnight grown bacteria were added to cells and
cultured for 6 hours. The cells were then washed and fixed with 4% paraformadehyde.
The fixed cells were then permeablized with 0.5% triton X-100 and treated with rabbit
anti-O157 antibodies, which were in turn detected by FITC conjugated goat
anti-rabbit antibodies. For acin-staining, the cells were treated with TRITC-labeled
phalloidin. Samples were observed with a fluorescence microscope and pictured by a
cool CCD camera. Each picture is labeled by the plasmid used in the
complementation followed by the bacteria in parenthesis harboring the plasmid.
Fig. 6. Association of the EspB constructs with HeLa cells.
Bacterial lysates were directly mixed with the suspended HeLa cells and gently
inverted at 4˚C for 15 minutes. The cells were then vigorously washed five times with
cold PBS. Cells and the associated proteins were then dissolved in SDS sample buffer
and subsequently analyzed with Western blotting using (A) anti-EspB and (B)
anti-actin antibodies. (C) Western blotting using anti-EspB to show approximately
comparable amounts of the EspB constructs in the bacterial lysates were mixed with
HeLa cells. Arrow labels the EspB products in each sample.
Fig. 7. Summary of the structure-function relationship of EspB. (A) Schematic maps
of individual EspB constructs and the summarized results observed from figures 1 to
6. Abbreviations used for the phenotype/property described in text are: Sec, secretion;
As, association; Tran: translocation; EspA, interaction with EspA; Ad, adherence; Hm,
RBC haemolysis; Ac, actin acumulation. (B) Key region(s) associated with the
phenotype/property of EspB. Thick bar, the major essential region; thin bar, the minor
auxiliary region. It should be noted that a successful secretion is the premier for other
functions to be achieved.