Download Spectrum of Mutations in MMAB Identified by

Spectrum of Mutations in MMAB Identified by
High Resolution Melting Analysis
Margaret Lamb Illson
Department of Human Genetics
McGill University
Montréal, Québec, Canada
August 2012
A thesis submitted to McGill University in partial fulfillment of the
requirements of the degree of Masters of Science
Copyright 2012 Margaret L. Illson
DEDICATION
To all of my family and friends,
but especially John,
for their encouragement, support and understanding.
ACKNOWLEDGMENTS
I would like to express my appreciation to my mentor, David Rosenblatt, for
providing me the opportunity, not only once but twice, to be actively engaged in
a field of personal interest. Being a member of the Rosenblatt team provides the
friendship, support and unquestioning assistance of a very special group of
colleagues headed by Dr.David Watkins. He points us in the right direction, gives
valuable information and offers only the kindest critiques when asked.
Memorable days have been passed in the company of Alison Brebner, Jaesung
Kim and Laura Dempsey Nunez, and former lab mates who occasionally make
welcome appearances. They have always been available for science discussions
and troubleshooting, IT assistance and quirky bits of fun.
The successful completion of this project was due to the training, mentoring and
support of a large cast of people. My co-supervisor, Dr. Brian Gilfix, and
committee members, Dr. Ron Agatep and Dr. George Chong helped us wade
through all challenges with very practical advice. Many members of Dr. Carl
Wittwer’s Lab (Department of Pathology , University of Utah, Salt Lake City,
UT) put aside time to first train us, and then offer continued support. Thank you
Carl, Dr. Bob Palais, Quiying Huang, Jana Kent, Luming Zhou and Zach Dwight.
I would also like to thank Gail Dunbar, Maria Galvez, Junhui Liu, Leah Ladorez
and Jocelyne Lavallé, Kandance Springer, Thomas Leslie, Ross MacKay and
Laura Benner for help in their areas of expertise, and smiling faces even when
they saw me coming. I also appreciate the willingness of Francis Petrella, Kush
Prithipaul, Dylan Tanzer and Tracy Wang to do countless, but not thankless
tasks. However, the biggest contributer in helping me achieve my personal goal
was Laura Dempsey Nunez who never tired of joining forces and brains to work
our way through this project together.
Thank you all!
iii
TABLE OF CONTENTS
DEDICATION ................................................................................................................................. ii
ACKNOWLEDGMENTS............................................................................................................... iii
TABLE OF CONTENTS ................................................................................................................ iv
LIST OF TABLES .......................................................................................................................... vi
LIST OF FIGURES........................................................................................................................ vii
LIST OF ABBREVIATIONS ....................................................................................................... viii
ORIGINAL CONTRIBUTIONS TO SCIENCE............................................................................. ix
ABSTRACT ......................................................................................................................................x
ABRÉGÉ........................................................................................................................................ xii
Introduction and Objectives of Study..............................................................................................14
CHAPTER 1: Cobalamin .............................................................................................................15
1.1 Significance ..........................................................................................................................15
1.2 Identification of cobalamin..................................................................................................15
1.3 The cobalamin molecule.......................................................................................................16
1.4 Clinical Impact ....................................................................................................................17
1.5 Cobalamin Metabolism ........................................................................................................17
1.5.1 Extracellular Metabolism..............................................................................................18
1.5.2 Intracellular Metabolism ...............................................................................................19
1.6 Inherited Cobalamin Disorders (Complementation groups)................................................21
1.6.1 Combined methylmalonic aciduria and homocystinuria...............................................23
1.6.2 Isolated homocystinuria ...............................................................................................26
1.6.3 Isolated Methylmalonic Aciduria (MMA) ...................................................................28
CHAPTER 2: Isolated Methylmalonic Aciduria ........................................................................30
2.1 Organic Aciduria (acidemia): an overview...........................................................................31
2.2 Etiology of Methylmalonic Aciduria...................................................................................31
2.3 Clinical spectrum – Isolated MMA .....................................................................................33
2.4 Vitamin B12 Responsiveness ...............................................................................................35
CHAPTER 3: The MMAB gene ...................................................................................................36
3.1 Historical Overview..............................................................................................................36
3.2 Identification of gene responsible for cblB disorders ..........................................................36
3.3 Location and Structure ........................................................................................................37
3.4 Function of ATR..................................................................................................................38
3.5 Spectrum of Variants...........................................................................................................39
3.6 Genotype / Phenotype correlation ......................................................................................40
CHAPTER 4: Mutation detection for cblB type disorders ........................................................42
4.1 Overview of screening methods .........................................................................................42
4.2 Screening by functional assays............................................................................................42
4.3 New advances in sequencing technology ............................................................................43
4.4 High Resolution Melting Analysis ......................................................................................44
4.4.1 Simultaneous gene scanning and genotyping for common polymorphisms.............46
iv
4.4.2 HRMA Analysis...........................................................................................................46
4.4.3 Interpretation of HRMA results ....................................................................................48
4.5 Considerations in choosing a screening method..................................................................48
CHAPTER 5: Rationale for evaluating HRMA as a cblB screening tool ................................50
5.1 Gene scanning to detect unidentified variants..................................................................51
5.2 Genotyping of common polymorphisms.........................................................................52
CHAPTER 6: Methods and Materials.........................................................................................53
6.1 Optimization........................................................................................................................53
6.1.1 Assay design .................................................................................................................53
6.1.2 PCR optimization..........................................................................................................55
6.2 Cell line selection ................................................................................................................56
6.2.1 DNA quality control and preparation...........................................................................57
6.3 Assay protocol with mixing..................................................................................................59
6.4 Protocol for genotyping with snapback primers ...................................................................59
6.5 Analysis ................................................................................................................................60
6.6 Confirmation of results........................................................................................................61
CHAPTER 7: Results....................................................................................................................62
7.1 Variant detection by HRMA analysis...................................................................................62
7.1.1 Scanning of reference population..................................................................................62
7.2 Validation of the HRMA scanning assay for MMAB ..........................................................63
7.2.1 Amplicons with a large number of variants .................................................................66
7.2.2 Distribution of mutations .............................................................................................68
7.3 Scanning of Undiagnosed MMA samples ...........................................................................69
7.3.1 A summary of the 2 patients with compound heterozygous variants............................70
7.3.2 A summary of the four patients with a single heterozygous variant .............................76
7.3.3 Detection of additional variants ....................................................................................79
7.4 High Resolution Melting Analysis (HRMA) as a clinical tool.............................................80
CHAPTER 8: Discussion ..............................................................................................................83
8.1 Molecular findings of HRMA Positive Results...................................................................83
8.1.1 Characterization of exonic variants...............................................................................83
8.1.2 Functional characterization of atypical cblB patients...................................................85
8.2 Presentation of a clinical phenotype with a single MMAB variant .....................................88
APPENDIX I Spectrum of known MMAB mutations ....................................................................95
APPENDIX II Prepresentative Melting Analysis...........................................................................96
APPENDIX III Validation results for MMAB cohort.....................................................................97
APPENDIX IV Results for patients with unresolved MMA..........................................................98
LIST OF REFERENCES ..............................................................................................................101
APPENDIX V: Presentations .......................................................................................................108
APPENDIX VI : Certificates ........................................................................................................111
v
LIST OF TABLES
Table 1 MMAB Primers for HRMA assay .......................................................... 54
Table 2 PCR reagents.......................................................................................... 55
Table 3 PCR amplification program ................................................................... 56
Table 4 Samples tested for assay validation ....................................................... 64 Table 5 Variants identified during assay validation ......................................... 65 Table 6 Sensitivity and Specificity of Assay. ..................................................... 67
Table 7 Distribution of mutation type................................................................. 68 Table 8 Variants identified in patients with unresolved MMA ........................... 69
Table 9 MMA patients with compound heterozygous MMAB mutations ......... 71
Table10 MMA patients with a single heterozygous MMAB mutation ................ 72
Table11 Summary of benign variants ................................................................. 80
Table12 Pathogenicity Prediction for exonic variants ........................................ 84
vi
LIST OF FIGURES
Figure 1 Cobalamin Molecule ............................................................................ 16
Figure 2 ATP:Cobalamin Transferase ................................................................. 20
Figure 3: Intracellular Disorders of Cobalamin Metabolism............................... 22
Figure 4 Etiology of Methylmalonic Acidurua.................................................... 32
Figure 5 Summary of MMAB mutations and common polymorphisms ............. 39
Figure 6 Simultaneous scanning and genotyping using a snapback primer ........ 47
Figure 7 [14C]-Propionate Incorporation of atypical cblB’s ................................ 86
Figure 8 Cobalamin distribution of atypical cblB samples.................................. 87
vii
LIST OF ABBREVIATIONS
AdoCbl
ATP
ATR
Cbl
CNCbl
Cob(I)alamin
Cob(II)alamin
Cob(III)alamin
DMB
5’-deoxyadenosylcobalamin
Adenosine Triphospahte
ATP:Cobalamin(I) Transferase
Cobalamin
Cyanocobalamin
Oxidation state +1 of the cobalt atom in cobalamin
Oxidation state +2 of the cobalt atom in cobalamin
Oxidation state +3 of the cobalt atom in cobalamin
5,6-dimethylbenzamidizole
HRMA
HC
IF
FN
MAF
MCEE
MCM
MeCbl
MethylTHF
MMA
MS
MTHFR
MSR
NBS
OHCbl
PCR
SAM
SCS-A
TC
TCA
TCblR
THF
Tm
TP
High Resolution Melting Analysis
Haptocorrin
Intrinsic factor
False Negative
Minor allele frequency
Methylmalonyl-CoA epimerase
Methylmalonyl-CoA mutase
Methylcobalamin
N-5-methyltetrahydrofolate
Methylmalonic aciduria
Methionine synthase
Methyltetrahydrofolate reductase
Methionine synthase reductase
Newborn Screening
Hydroxycobalamin
Polymerase Chain Reaction
S-adenosylmethionine
SuccinylCoA synthetase
Transcobalamin, transcobalamin II
Tricarboxylic acid
Transcobalamin receptor
Tetrahydrofolate
Melting point
True Positive
viii
ORIGINAL CONTRIBUTIONS TO SCIENCE
Development of a high resolution melting assay to scan for variants in the
MMAB, the gene responsible for the subclass of vitamin B12-responsive
methylmalonic aciduria.
Identification of variants in the MMAB gene by high resolution melting
analysis in a small number of atypical cblB patients, characterized by an
isolated methylmalonic aciduria, who remain undiagnosed following
somatic cell studies.
ix
ABSTRACT
Pathogenic variants in the MMAB gene (OMIM 607958) are responsible
for the cblB class of cobalamin-responsive methylmalonic aciduria
(MMA) (OMIM 251110). MMAB encodes cobalamin
adenosyltransferase, a mitochondrial enzyme responsible for the formation
of adenosylcobalamin (AdoCbl). AdoCbl subsequently functions as a
cofactor for methylmalonyl-CoA mutase (MCM) during the isomerization
of L-methylmalonyl-CoA to succinyl-CoA. Somatic cells studies have
been used to evaluate patient samples for cobalamin related disorders.
Due to high basal levels of propionate incorporation, some patients with
mild MMA biochemical phenotypes cannot be diagnosed by
complementation analysis. A high resolution melting analysis (HRMA)
assay was developed to rapidly scan the coding exons and flanking
intronic regions for variants in the MMAB gene.
Three cohorts of samples were scanned by HRMA: an unaffected
reference population, 42 samples assigned to the cblB by complementation
analysis and 181 patients with unresolved isolated MMA. HRMA
correctly identified all of the previously reported mutations in the cblB
cohort as well as seven additional variants including a novel nonsense
variant (c.12C>A, p.C4X). Scanning of the unresolved MMA cohort
identified six samples containing MMAB variants. Two samples, WG3948
and WG4034, contained compound heterozygous variants. They shared a
c.572 G>A (p.R191Q) mutation. WG3948, the index case for this study,
x
was found to have c.398 C>T (p.S133F) as the second mutation, and
WG4034, the second patient, contained a novel variant c.394 C>T
(p.C132R). Samples from four other affected patients contained a single
variant. The c.572 G>A (p. R191Q) was found in both WG3546 and
WG4090. WG3759 contained a c.521C>T ( p.S174L) substitution, and
WG4029 contained a novel c.185 C>T (p.T62M) substitution.
The identification of two patients with compound heterozygous variants in
the MMAB gene suggests the existence of an infrequent but distinct
atypical cblB phenotype. This subclass is characterized by levels of
propionate incorporation and of AdoCbl synthesis within reference ranges,
preventing diagnosis by somatic cell studies.
xi
ABRÉGÉ
Des variantes pathogéniques dans le gène MMAB (OMIM 607958) sont
responsables de la classe cblB d’acidurie méthylmalonique (AMM)
respondant à la cobalamine (OMIM 251110). MMAB encode cobalamine
adénosyltranférase, une enzyme mitochondriale responsable de la
formation de l’adénosylcobalamine (AdoCbl). AdoCbl fonctionne par la
suite en tant que cofacteur pour méthylmalonyl-CoA mutase (MCM)
durant l’isomérisation de L-méthylmalonyl-CoA vers succinyl-CoA. Des
analyses sur des cellules somatiques ont été utilisées pour évaluer des
échantillons de patients pour des troubles reliés à la cobalamine. En raison
de niveaux de base élevés d’incorporation de propionate, certains patients
présentant des phénotypes biochimiques bénins d’AMM ne peuvent être
diagnostiqués par analyse de complémentation. Une analyse de fusion à
haute résolution (AFHR) a été développée pour balayer rapidement les
exons codants et les régions introniques avoisinnantes pour des variantes
dans le gène MMAB.
Trois cohortes d’échantillons ont été balayées par AFHR : une population
de référence non-affectée, 42 échantillons assignés au groupe cblB par
analyse de complémentation et 181 patients avec une AMM isolée sans
diagnostique. L’AFHR a correctement identifié toutes les mutations
précédemment rapportées dans la cohorte cblB ainsi que sept variantes
additionelles, incluant une nouvelle variante non-sens (c.12C>A, p.C4X).
Le balayage de la cohorte avec de l’AMM isolée a identifié six
xii
échantillons contenant des variantes dans MMAB. Deux échantillons,
WG3948 et WG4034, étaient des porteurs de variantes hétérozygotes
composés. Ils partageaient la mutation c.572G>A (p.R191Q). WG3948, le
cas index pour cette étude, était porteur du c.398C>T (p.S133F) pour la
deuxième mutation et WG4034, le deuxième patient, contenait une nouvel
variante c.394C>T (p.C132R). Les échantillons provenant de quatre autres
patients atteints contenait une seule variante. Le c.572G>A (p.R191Q) a
été trouvé dans WG3546 et WG4090. WG3759 contenait une substitution
c.52C>T (p.S174L), et WG4029 contenait une nouvelle substitution
c.185C>T (p.T62M).
L’identification de deux patients avec des variantes hétérozygotes
composées dans le gène MMAB suggère l’existence d’un phénotype rare
mais distinct de cblB. Cette sous-classe est charactérisée par des niveaux
d’incorporation de propionate et de synthèse d’AdoCbl dans les valeurs
normales, empêchant le diagnostique par analyse des cellules somatiques.
xiii
Introduction and Objectives of Study
Pathogenic variants in the MMAB gene are responsible for the cblB class of
cobalamin-responsive methylmalonic aciduria. MMAB encodes cobalamin
adenosyltransferase, a mitochondrial enzyme responsible for the formation of
adenosylcobalamin (AdoCbl), an essential coenzyme for the mitochondrial
enzyme, methylmalonyl CoA mutase (MCM). Mutations in MMAB and five
additional genes (MMAA, MMADHC variant 2, MUT, MCEE or SUCLA2) can
result in isolated methylmalonylic aciduria (MMA). More than 350 archived
patients with isolated MMA remain undiagnosed after somatic cell studies. One
patient in this cohort was later discovered to have compound heterozygous
mutations by sequencing.
High Resolution Melting Analysis (HRMA) was utilized as a fast and inexpensive
method to scan the MMAB gene in an additional 181 patients with unresolved
methylmalonic aciduria (MMA) to identify any causal variants. The development
of a fast and simple PCR-based assay with the ability to screen targeted genes of
the vitamin B12 pathway for sequence variation could be of benefit both as a
research and diagnostic tool.
14
CHAPTER 1: Cobalamin
1.1 Significance
Cobalamin (Cbl), commonly known as vitamin B12, belongs to the family of water
soluble B vitamins that are vital in mammalian metabolic pathways. Mammals
cannot synthesize Cbl directly, so it must be acquired through dietary intake of
animal products containing vitamin B12. Cbl is processed and transported through
the digestive and circulatory systems by a series of complex steps before entering
the cell to be further metabolized to produce two essential mammalian
coenzymes, adenosylcobalamin (AdoCbl) and methylcobalamin (MeCbl).
Deficiencies in Cbl metabolism can result in isolated homocystinuria, isolated
methylmalonic aciduria (MMA), or a combined presentation of the two.
1.2 Identification of cobalamin
A severe anemia was described by Thomas Addison in the mid 19th century, and
became known as pernicious anemia. George Whipple experimented with an
effective treatment in the 1920’s by administering liver extracts to correct anemia
in dogs. Georges Minot and William Murphy attempted the treatment of human
subjects with the “extrinsic factor” from liver, but some patients did not respond.
It was William Castle who recognized that treatment of anemia required the
presence of both an “extrinsic factor” from liver extract and an “intrinsic factor”
contained in gastric juice. . In the late 40’s, vitamin B12 was isolated by Karl
Folkers, Lester Smith and Mary Shorb, and successful treatment of patients
confirmed the identity of the extrinsic factor as vitamin B12. Dorothy Hodgkins
15
began work on the crystallization of the molecule and by 1955 had solved the
crystal structure of the cyanocobalamin (CNCbl) molecule using X-ray diffraction
(see Figure 1). This brief history was summarized from a reviews written by
Kunio Okuda (Okuda, 1999) and H.P.C Hogenkamp (Hogenkamp, 1999).
1.3 The cobalamin molecule
Figure 1 Cobalamin Molecule
The Cbl molecule has a planar corrin ring surrounding a central cobalt
atom. The rare Co atom of this organometallic molecule coordinates with
four nitrogen atoms in a planar corrin ring and with both a lower () and
upper () ligand. In the  position, 5,6-dimethylbenzamidizole base
(DMB) is covalently linked below the corrin ring and also coordinated to
the cobalt ion. Several chemical groups can be found in the  axial
position and each forming a functionally distinct derivative including:
cyanocobalamin (CNCbl), hydroxocobalamin (OHCbl),
adenosylcobalamin (AdoCbl), and methylcobalamin (MeCbl).
Illustration from (Froese & Gravel, 2010)
16
The reactivity of the Cbl molecule is primarily due the presence of the labile
cobalt to carbon (Co-C) bond, a stable but relatively weak bond (Pratt, 1999). The
cobalt metal ion lowers the energy required to break the C-C bonds during Cbl
metabolism and alternates among three oxidation states, from +3 to the reactive
fully reduced +1 level.
1.4 Clinical Impact
Cbl disorders may result from dietary deficiencies or inherited errors in
metabolism. Since vitamin B12 cannot be synthesized in man it must be ingested
and then metabolized to form sufficient quantities of two essential Cbl
derivatives, MeCbl and AdoCbl. Both function as cofactors for two mammalian
enzymes, methionine synthase (MS) found in the cytoplasm and MCM located in
the mitochondria (Watkins & Rosenblatt, 2011a). Deficiencies in Cbl absorption,
transport or metabolism can result in isolated homocystinuria, isolated MMA or a
combined presentation of both. Elevated levels of MMA can cause potentially
lethal metabolic acidosis.
1.5 Cobalamin Metabolism
Once the vitamin is ingested, metabolism proceeds by a complex series of steps
to absorb and transport this large hydrophilic molecule through the digestive and
circulatory systems, before delivering it to cells for processing into the AdoCbl
and MeCbl derivatives.
17
1.5.1 Extracellular Metabolism
Dietary Cbl enters the body bound to food proteins. In the digestive tract, the
protein becomes dissociated in the acid environment of the stomach, and Cbl is
re-bound by a series of transporting proteins. The exchange of carrier proteins
facilitates the movement of Cbl efficiently through the different environments
found in each organ (Fowler, Leonard, and Baumgartner, 2008).
First, haptocorrin (HC), which is present in saliva, binds Cbl in the stomach. The
TCN1 gene encodes HC and defects do not produce any known clinical defects.
The HC/Cbl complex dissociates in the intestine, and Cbl is rebound by intrinsic
factor (IF) which is excreted from the gastric parietal cells. Defects in the gene
encoding intrinsic factor (GIF) result in an inborn error of cobalamin uptake,
intrinsic factor deficiency. A block may also occur in the uptake of the IF/Cbl
complex due to defects in two receptor genes, CUBN and AMN resulting in
Imerslund–Gräsbeck syndrome. Both disorders of Cbl uptake are characterized
by serum Cbl deficiency, megaloblastic anemia and developmental delay.
Normal metabolism of Cbl proceeds when the IF-Cbl complex binds with the
CUBAM receptor and enters the distal ileal enterocytes by endocytosis. It is
digested in the lysosome and the free Cbl is transferred across the basal membrane
to the circulatory system in a process thought to include the multiple drug
resistance protein (MRP1) (Morkbak, Poulsen, and Nexo, 2007). There it binds to
both HC and transcobalamin (TC), forming both HC-Cbl and TC-Cbl complexes
(Fowler et al.,2008; Watkins & Rosenblatt, 2011a). While HC, produced by the
18
TCN1 gene, carries 70-90% of the Cbl in the circulatory system (Froese &
Gravel, 2010; Watkins & Rosenblatt, 2011a). The source of the HC-Cbl complex
remains unclear, however its role may be to bind and clear biologically inactive
Cbl derivatives from the body (Morkbak et al., 2007). The remaining 10 – 30%
of circulating Cbl forms a complex with TC. The TC-Cbl complex is transported
into most cells of the body and becomes the substrate for further intracellular
processing of Cbl for coenzyme formation. Transcobalamin is encoded by the
TCN2 gene. A deficiency is characterized by failure to thrive and megaloblastic
anemia as well as immunological and neurological complications in untreated
patients. The TC-Cbl complex enters the body's peripheral cells by receptor
mediated endocytosis through the TC receptor (TCblR) (Quadros, Lai, Nakayama,
Sequeria, Wang, Jacobsen, Fedosov, Wright, Gallagher, Anastasio, Watkins and
Rosenblatt, 2010), which is encoded by the CD320 gene. A defect in the TCblR
receptor results in decreased cellular uptake, but little or no clinical impact has
been identified to date.
1.5.2 Intracellular Metabolism
After entering the cell, the TC-Cbl complex is broken down in the lysosome.
Cbl is transported and reduced from the cob(III)alamin state by the products of
a series of four genes (LMBRD1, ABCD4, MMACHC, MMADHC). The pathway
diverges into two independent branches in order to form the two derivatives
MeCbl and AdoCbl. The functional role of each cofactor is determined by the
moiety bound.
19
The MeCbl derivative serves as the cofactor for the enzyme MS during the
conversion of homocysteine to methionine in a two step process. First, a methyl
group is transferred from N-5-methyltetrahydrofolate (MethylTHF) to the upper 
axial position of the MS-bound cob(I)alamin molecule. The methyl group is then
passed to homocysteine producing methionine (Watkins & Rosenblatt, 2011a).
The amino acid methionine is essential for human metabolism, and once activated
by ATP, it produces S-adenosylmethionine (SAM). SAM is a substrate required
for a wide variety of essential mammalian methyl transfer reactions including
nucleic acids and neurotransmitter synthesis (Durand, Prost, Loreau, LussierCacan, and Blache, 2001). A deficiency in MeCbl or a defect in MS leads to
elevated levels of homocysteine.
AdoCbl is the cofactor for the mitochondrial enzyme MCM. This Cbl derivative
is formed through the action of the enzyme ATP:Cobalamin(I) Transferase
(ATR) (Padovani, Labunska, Palfey, Ballou, and Banerjee, 2008) and is depicted
in Figure 2.
When the DMB ligand is absent, AdoCbl is referred to as base off. The derivative
becomes more reactive and is available for binding to MCM (Banerjee, 1999).
Activation of MCM by the binding of AdoCbl facilitates the conversion of
L-methylmalonylCoA into succinylCoA. The AdoCbl/MCM complex functions
as an isomerase facilitating the exchange of a hydrogen atom and carbonylCoA
group between two adjacent atoms (Banerjee, 1999). This conversion must take
place for the normal catabolism of branched-chain amino acids and odd-chain
fatty acids in preparation for entry into the TCA cycle. Any block that prevents
20
this exchange leads to elevated levels of methylmalonic acid.
Figure 2 ATP:Cobalamin Transferase
An adenosyl moiety is transferred from ATP to the upper axial  position
of cobalamin by cobalamin adenosyltransferase (Saridakis et al., 2004)
1.6 Inherited Cobalamin Disorders (Complementation groups)
There are currently fourteen different inborn errors of Cbl transport and
metabolism with the recent identification of the cblJ complementation class
(Kim, Coelho, Miousse, Fungi, du Molin, Buers, … and Rosenblatt, 2011).
Typically, the metabolic effects are more severe for defects affecting
intracellular metabolism than extracellular disorders.
21
Figure 3: Intracellular Disorders of Cobalamin Metabolism
Intracellular Disorders of Cobalamin
Isolated Homocystinuria
MTR
Homocysteine
Methionine
CELL ME MBRA NE
Combined Honocystinuria
and Methylmalonic Aciduria
MeCbl
nt
1
MTRR
CD320
Va
ri a
me
Lysoso
LMRBD1
MMACHC
MMADHC
Va
ria
nt
ABCD4
2
Familia l
~ 25%
MMAB
MMAA
D‐Methylmalonyl CoA
MCEE
AdoCbl
L‐Methylmalonyl CoA
Succinyl CoA
MUT
Isolated Methylmalonic Aciduria
10
Intracellular disorders of Cbl metabolism can be divided into 3 broad
functional categories on the basis of two biomarkers, MMA and
homocysteine. Gene defects result in disorders characterized by:
1) Isolated homocystinuria if the cytosolic branch of the pathway
utilizing MeCbl coenzyme is affected;
2) Isolated MMA if the mitochondrial branch of the pathway utilizing
AdoCbl is affected
3) Combined homocystinuria and MMA.
Defects at specific points in the pathway can disrupt extracellular Cbl absorption,
transport, or uptake into the cells for intracellular processing. These disorders are
inherited in an autosomal recessive manner and gene defects in the pathway have
22
been well characterized. Disorders associated with defects in the genes of the
pathway are classified into nine functional complementation groups, cblA thru
cblG, cblJ and mut as depicted in Figure 3 (Gravel, Mahoney, Ruddle, and
Rosenberg, 1975; Watkins & Rosenblatt, 2011a) . Samples with gene defects are
assigned to a complementation group by complementation analysis.
Complementation Analysis
During analysis, the fibroblasts of the undiagnosed patient are fused with
fibroblasts containing a known gene defect creating a heterokaryon. If the
combined DNA is able to correct the defect and rescue cell function, the DNA of
each cell cannot have defects at the same loci. The DNA of the undiagnosed
patient is able to compensate for the known defective loci and rescue function.
Function is measured by ability of the fused cells to incorporate [14C]-propionate.
Failure of the patient’s fibroblast to complement the defective loci indicates that
the patient’s fibroblast belongs to the same complementation group as both
fibroblasts must contain the same defective loci.
1.6.1 Combined methylmalonic aciduria and homocystinuria
The cblC, cblD, cblF and cblJ groups of disorders result in combined MMA and
homocystinuria. Defects in lysosomal export of free Cbl are found in cblF and
cblJ patient fibroblasts. Both cblC and cblD fibroblast cells show normal Cbl
export from the lysosomes with defects occurring before the synthesis of AdoCbl
and MeCbl.
23
cblF (MIM #277380)
Defects in the LMBRD1 gene block the export of free Cbl into the cytoplasm
(Rutsch, Gailus, Suormala, & Fowler, 2011). In vitro studies demonstrate that
only small amounts of exogenous [57Co] CN-Cbl added to cultured fibroblasts of
cblF patients are converted into the Cbl derivatives, AdoCbl and MeCbl. The
majority accumulates as unbound CNCbl (Fons, Sempere, Sanmarti, Arias, Poo,
Pineda, … and Campistol, 2009; Fowler et al., 2008; Rosenblatt, Laframboise,
Pichette, Langevin, Cooper and Costa, 1986).
These patients present early in life with failure to thrive, feeding difficulties, and
some may have hematological disorders including macrocytic anemia,
neutropenia, and pancytopenia. Minor facial anomalies and congenital heart
defects have been seen (Fons et al., 2009; Rutsch, Gailus, Suormala and Fowler,
2011; Watkins & Rosenblatt, 2011b).
cblJ
Defects in the ABCD4 gene mimic the effects of the cblF complementation group,
also resulting in the failure to release vitamin B12 from lysosomes, and affect
synthesis of both Cbl cofactors. The gene was recently identified by microcell
mediated chromosome transfer and exome sequencing. The partial rescue of
function in cblF cells by ABCD4 overexpression suggests LMBRD1 and ABCD4
function together in the export of Cbl into the cytoplasm (Kim et al., 2011).
24
cblC (MIM #277400)
Defects in the MMACHC gene are the most common cause of inborn errors of
intracellular Cbl metabolism (Lerner-Ellis, Anastasio, Liu, Coelho, Suormala,
Stucki … and Fowler, 2009), with over 500 cases reported (Watkins &
Rosenblatt, 2011b). A decrease in the production of AdoCbl and MeCbl is
observed, affecting the function of both MCM and MS. It is thought the gene
product serves as a Cbl chaperone and also has a role in cleaving the upper axial
ligands from the -ligand position breaking the carbon-cobalt bond. (Kim,
Gherasim, & Banerjee, 2008; Kim, Hannibal, Gherasim, Jacobsen, and Banerjee,
2009). The MMACHC gene product interacts with MMADHC (Plesa, Kim,
Paquette, Gagnon, Ng-Thow-Hing, Gibbs, … Coulton, 2011). Current studies
suggest that MMACHC utilizes a combination of adjacent binding pockets and a
dimer structure to process all Cbl derivatives by either reductive decyanation or
dealkylation into a common intermediary form for further processing (Froese,
Krojer, Wu, Shrestha, Kiyani, von Delft, … and Yue, 2012; J. Kim et al., 2009).
Patients with cblC disorders have a variable age of presentation. The early onset
phenotype is severe resulting in either death or neurological defects while the later
onset phenotype is milder. Secondary complications are diverse and include:
megaloblastic anemia, neurological concerns, ocular involvement and cardiac
defects (Carrillo-Carrasco, Chandler, & Venditti, 2012).
25
cblD (MIM #277410)
The gene product of the MMADHC gene is associated with three phenotypes and
results in the pathway diverging into two independent branches. The reduced Cbl
molecule is highly reactive and normal metabolism proceeds with the
simultaneous production of both AdoCbl and MeCbl in mitochondria and cytosol
respectively. Patients with cblD disorders may present with a combined elevation
of both homocysteine and methylmalonic acid or an isolated deficiency of one or
the other metabolites (Navarro-Sastre, Tort, Stehling, Uraska, Arranz, Del Toro,
… and Lill 2011). Mutations in the N-terminus of the gene are associated with
AdoCbl deficiency (cblD variant 2) while mutations at the C-terminus are
responsible for MeCbl related disorders (cblD variant 1). Patients present with
developmental delay, seizures, megaloblastic anemia, ataxia, metabolic acidosis,
hypotonia, and encephalopathy.
1.6.2 Isolated homocystinuria
The cblE, cblG and cblD variant 1disorders result in isolated homocystinuria.
Defects affecting MeCbl production or the enzyme MS are found in patient
fibroblasts.
cblE (MIM #236270)
The protein product of the MTRR gene encodes methionine synthase reductase
(MSR). The +1 oxidative state of Cbl is unstable and is easily oxidized to a less
reactive +2 state blocking the conversion of homocysteine to methinione. MTRR
can reactivate Cbl by reducing it back to MeCbl, with the transfer of a methyl
26
group from adensoylmethionine. The repeated cycling between Cbl forms bound
to MS, MeCbl and cob(II)alamin ensures continued production of methionine.
(Leclerc, Wilson, Dumas, Gafuik, Song, Watkins, … Gravel, 1998). Symptoms
include megaloblastic anemia, developmental delay, ataxia, cerebral atrophy,
seizures and visual defects were seen in at least one case (Watkins & Rosenblatt,
2011b) .
cblG (MIM #250940)
The protein product of the MTR gene encodes the enzyme MS (Gulati, Baker, Li,
Fowler, Kruger, Brody and Banerjee, 1996; Leclerc, Campeau, Goyette, Adajalla,
Christensen, Ross, … Gravel; 1996; Li, Gulati, Baker, Brody, Banerjee and
Kruger, 1996). Defects in this gene can impact either folate or Cbl metabolism as
the pathways intersect during the conversion of homocysteine to methionine by
MS in a cyclic reaction. MethylTHF transfers its methyl group to Cbl forming
MeCbl and regenerating tetrahydrofolate (THF) in the process. MeCbl in turn
transfers the newly acquired methyl group to homocysteine producing
methionine. A Cbl deficiency perturbs the cycle resulting in a methylTHF trap
blocking the conversion of homocysteine and (Watkins & Rosenblatt, 2011b)
preventing further demethylation of MTHFR. The result is a deficiency of THF
(Hoffbrand & Jackson, 1993) blocking the regeneration of 5,10 methylenetetrahydrofolate that is essential for pyrimidine synthesis and megaloblastic
anemia develops. The production of SAM, a major mammalian methyl donor, is
also affected (see section 1.5.2).
27
1.6.3 Isolated Methylmalonic Aciduria (MMA)
The cblA, cblB, mut, epimerase and cblD variant 2 disorders result in isolated
MMA. Defects affecting AdoCbl production or the enzyme MCM perturb the
intricate interactions among the MUT, MMAA and MMAB proteins. In addition,
defects in upstream genes MCEE and cblD variant 2 can result in isolated MMA
either by producing defective methylmalonylCoA epimerase (MCEE) or
inhibiting the complete reduction of Cbl (Stucki, Coelho, Suormala, Burda,
Fowler and Baumgartner, 2012). Defects in a downstream gene, SUCLA2,
produce a mitochondrial DNA depletion disorder, but can also be responsible for
elevations in MMA.
mut ¯ / o (MIM #251000)
Mutations in the MUT gene, are the most common cause of MMA. AdoCbl must
be bound to functional MCM for the conversion of methylmalonylCoA to
succinylCoA (Worgan, Niles, Tirone, Hofmannm Verner, Sammak, … and
Rosenblatt, 2006). Two classes of the MCM protein product have been
identified: a partially active MCM enzyme (mut_ ) and a totally dysfunctional
product (mut o). The severity of MCM disorders is dependent on the residual
enzymatic activity each sequence variant produces. Patients are susceptible to
often fatal episodes of metabolic acidosis and can also experience metabolic
strokes causing neuronal and renal damage, blood marrow suppression causing
leukopenia and anemia (Manoli & Venditti, 2011) and dysfunction in
mitochondrial oxidative processes (Chandler, Zerfas, Shanske, Sloan, Hoffmann
DiMauro, … Venditti, 2009).
28
cblB (MIM #251110)
The MMAB gene product facilitates the transfer of an adenosyl moiety from ATP
to the free  ligand of Cbl to form AdoCbl. It is also hypothesized that ATR
serves as a chaperone to direct AdoCbl to its target MCM (Yamanishi, Vlasie, &
Banerjee, 2005). The AdoCbl / MCM complex facilitates the isomerasation of
methylamlonylCoA to succinylCoA. An expanded description is provided in
chapter 3.
cblA (MIM #251100)
The human MMAA gene was identified by searching for orthologs to bacterial
genes located in the same operon as MCM (Dobson, Wai, Leclerc, Kadir, Narang,
Lerner-Ellis, … and Gravel, 2002a). Continuing studies on the bacterial
orthologs, MeaB, indicate that MMAA has both a protection and stabilization role
for MCM (Padovani et al., 2008). Ongoing studies to determine MMAA’s precise
function include crystallization studies which demonstrated that MMAA binds to
MCM (Froese et al., 2012) and acts as a chaperone preventing MCM inactivation
(Takahashi-Iniguez, Garcia-Arellano, Trujillo-Roldan, & Flores, 2011). Patients
with a cblA disorder typically present during infancy, and experience failure to
thrive, developmental delay, periods of metabolic acidosis and seizures along with
possible hematological and neurological concerns (Horster, Baumgartner,
Viardot, Suomala, Bugard, Fowler, … and Baumgartner, 2007; Merinero, Perez,
Perez-Cerda, Rincon, Desviat, Martinez, … and Ugarte, 2008).
29
Epimerase deficiency (MIM# 251120)
Methylmalonyl CoA epimerase was the first Cbl related gene to be identified on
the basis of prokaryotic gene arrangements (Bobik & Rasche, 2004). Defects in
MCEE prevent the racemization of D-methylmalonyl CoA to
L-methylmalonylCoA impairing the production of succinyl CoA. MMA can
result even in the presence of fully functional MMAB, MMAA and MUT genes
(Gradinger, Belair, Worgan, Li, Lavallee, Roquis, … and Rosenblatt 2007).
Patients present with a range of clinical phenotypes including moderate
elevations of methylmalonic acid (Matsui, Mahoney, & Rosenberg, 1983). They
can experience metabolic acidosis and symptoms include ataxia, hypotonia and
seizures (Manoli & Venditti, 2011).
Succinate CoA ligase deficiency
A small number of patients were identified with mild urinary excretion of MMA,
progressive encephalopathy and decreased mitochondrial respiratory chain
activity. Having excluded more common molecular lesions, mutations were
discovered in a gene encoding an enzyme downstream of the methylmalonyl CoA
to succinyl CoA conversion, SUCLA2 (MIMC603921). The protein product
encodes the  subunit of succinyl CoA synthatase (SCS-A) (Carrozzo, Piemonte,
Tessa, Lucioli, Rizza, Meschini, … and Santorelli, 2007). SCS-A catalyses a
reversible reaction in the TCA cycle which converts succinyl CoA and ADP to
succinate and ATP. The function of SUCLA2 overlaps with another gene,
SUCLG1 (MIM 611224), which encodes the  subunit of the same enzyme
SCS-A (Ostergaard, 1993).
30
CHAPTER 2: Isolated Methylmalonic Aciduria
2.1 Organic Aciduria (acidemia): an overview
Proteins are metabolized into amino acids during digestion and serve as small
building blocks for growth, cell maintenance and DNA repairs. Any surplus
amino acids are further catabolized as excess levels are toxic to the body. The
amino acids are deaminated in the liver to remove and excrete the nitrogen atom
from the amino group as urea. The remaining carbon skeleton can enter the Krebs
cycle, undergo gluconeogenesis or serve as a substrate for fatty acid synthesis.
Defects in catabolism result in classic organic aciduria / organic acidemia.
Organic acid disorders result when defective or missing enzymes make it
impossible for the body to degrade amino acids and odd chain fatty acids
properly. Ultimately the organic acid that accumulates is determined by which
substrate precedes the dysfunctional enzyme (Perez-Duenas, Angaroni, SanchezAlcudia, Merinero, Perez-Cerda, Specola, … and Ugarte,2011).
2.2 Etiology of Methylmalonic Aciduria
Three independent pathways lead to the production of methylmalonic acid: the
catabolism of branched chain fatty acids, the -oxidation of odd chain fatty acids
and catabolism of cholesterol’s side chain. (Duane, Levitt, Mueller, & Behrens,
1983). PropionylCoA is an intermediate for all three and is carboxylated to form
methylmalonylCoA which is then converted to succinylCoA (see Figure 4).
31
MethylmalonylCoA must be isomerzied to its “L” form before it can be converted
to succinylCoA through the action of Cbl and the MCM, MMAA and MMAB
proteins. Isolated MMA disorders result from defects of the MCM apoenzyme, or
Figure 4 Etiology of Methylmalonic Aciduria
Catabolism of Branched
Chain Fatty Acids
 Oxidation of
Odd Chain Fatty
Acids
Isoleucine,Methionine
Th
i
V li
Independent
pathways
Catabolism of
Cholesterol
Propionyl-CoA
CO2
PropionylCoA
Methylmalonyl Co-A
MUT
MMAB
Methylmalonyl-CoA
Mutase
AdoCbl
MMAA
Succinyl-CoA
Normal catabolism of the amino acids isoleucine, valine, methionine or
threonine all produce propionylCoA as an end product. Other sources of
propionylCoA are the -oxidation of odd chain fatty acids and the cleavage
of the three terminal carbons from the cholesterol side chain during its
oxidation to bile acid. PropionylCoA is converted to D-methylmalonylCoA
through the action of propionylCoA carboxylase and biotin. DmethylmalonylCoA is then converted to succinylCoA. Biochemical defects
that impact the conversion of methylmalonylCoA to succinylCoA create an
accumulation of methylmalonic acid in blood and urine.
32
a reduction in the amount or inability of AdoCbl to function as a coenzyme
(Horster et al., 2007; Nicolaides, Leonard, & Surtees, 1998). Defects create an
accumulation of methylmalonic acid in the blood and urine.
2.3 Clinical spectrum – Isolated MMA
The wide range of clinical phenotypes associated with isolated MMA reflect the
variety of underlying defects in enzyme function (Horster et al., 2007). The
defining biochemical phenotype is an accumulation of methylmalonic acid in
blood and urine. Elevated levels of methylmalonic acid are responsible for
anemia, leukopenia and thrombocytopenia resulting from the suppression of bone
marrow activity and metabolic strokes involving the basal ganglia. Secondary
complications of MMA can target multiple organ systems and include variable
levels of developmental delay, progressive renal failure, an impaired immune
system and pancreatitis (Manoli & Venditti, 2011). There is also evidence that
MMA is responsible for deficient energy metabolism (Chandler et al., 2009).
Elevated levels of methylmalonic acid can inhibit oxidative metabolism and
deplete free ATP. Finally, depletion of the free CoA pool, impacts the synthesis
of myelin, urea and glucose (Perez-Duenas, Sempere, Campistol, AlonsoColmenero, Diez, Gonzalez, … and Artuch, 2011).
Clinical phenotypes can be correlated with age of onset and complementation
group. Early onset MMA disorders appear shortly after birth and severely affect
the patient. They are marked by lethargy, failure to thrive, vomiting, respiratory
distress, hypotonia and possible seizures indicative of neurological complications
33
that can lead to coma (Matsui et al., 1983). Complementation groups, assigned by
cell fusion and biochemical studies, presume that samples containing identical
mutations will produce the same phenotype. While exceptions are found, samples
within the same group display similar ages of onset, share comparable long term
outcomes and responses to supplementation with OHCbl.
All patients with defects in MCM are assigned to a single complementation group,
mut, but can have a partially functional enzyme (mut ) or have a null enzyme
(mut o) (Cosson, Benoist, Touati, Dechaux, Royer, Grndin, … and de Lonay,
2009; Horster et al., 2007). Patients with mut o disorders typically present
symptoms in the first month of life, and display the most severe phenotypes
which may lead to severe acidosis, hyperammonemia and can lead to coma and
death if left untreated (Merinero et al., 2008). Patients with the mut  subtype
retain some enzyme activity perhaps explaining a milder clinical and biochemical
phenotype (Merinero et al., 2008). Mut  patients have a less severe disease
course than cblB patients.
Patients with cblB disorders have a neonatal onset with a significant risk of
mortality and neurological complications (Horster et al., 2007) placing their
disease course and long term outcome between the most severe mut o and the
milder cblA phenotypes (Horster et al., 2007; Matsui et al., 1983).
Typically patients with cblA disorders have a milder presentation of MMA with a
later age of onset but still within the first few months. Infants are at risk for a
metabolic crisis in times of stress until the diagnosis is established and treatment
34
initiated. They have the best long term outcome perhaps due to the less severe
symptoms and ability to respond to OHCbl supplementation.
The mildest presentation is seen in atypical MMA patients. Atypical MMA
phenotypes can be as mild as increased urinary excretion of methylmalonate with
only a slight risk of metabolic decompensation (Manoli & Venditti, 2011).
2.4 Vitamin B12 Responsiveness
In some cases, the risks and clinical effects associated with MMA can be lowered
with treatment. Differences in response to treatment became evident very early
when Oberholzer (Oberholzer, Levin, Burgess, & Young, 1967) and Stokke
(Stokke, Jellum, Eldjarn, & Schnitler, 1973) reported some patients responded to
pharmacological doses of Cbl and others did not. In vivo response to parenteral
Cbl supplementation was evaluated by recording changes in urinary and serum
methylmalonic acid levels for the different complementation groups (Matsui et
al., 1983). Patients with the most common form of MMA, mut o and mut  have
little or no response to treatment with OHCbl. The cblB patients show variable
but low levels of vitamin B12 (Cbl) responsiveness, and patients with cblA
disorders are the most responsive.
35
CHAPTER 3: The MMAB gene
3.1 Historical Overview
In the mid 1970’s two MMA phenotypes were distinguished: defects in the
synthesis of AdoCbl alone, or defects in the synthesis of both AdoCbl and MeCbl.
Defects in the synthesis of AdoCbl were subsequently subdivided by the ability of
cell extracts from wild type cells to rescue AdoCbl synthesis in broken cell assays
which contained exogenous reducing agents. Those cells whose function could be
rescued were given the cblA designation and those cells which remained defective
were assigned to the cblB group (Mahoney, Hart, Steen, & Rosenberg, 1975). It
was confirmed that fibroblast from cblB patients lacked ATR activity (Fenton &
Rosenberg, 1981).
3.2 Identification of gene responsible for cblB disorders
Identification of the causal gene resulted from a search for functional homologs in
bacteria. CobA-type, EutT-type and PduO-type adenosyltransferases are specific
to their bacterial genera (Roth, Lawrence, & Bobik, 1996). Recognizing that in
bacteria, genes in the same metabolic pathway are frequently found in the same
operon, human homologs to genes that clustered with MCM in bacterial operons
were identified and evaluated for their ability to function as an
adenosyltransferase. A gene was identified on chromosome 12 that was
homologous to a Pdu-O type ATR (Dobson, Wai, Leclerc, Kadir, Narang, LernerEllis, … and Gravel, 2002b; Leal, Park, Kima, & Bobik, 2003). Northern blot
36
analysis revealed its product was expressed in both liver and muscle. Mutational
analysis of this gene by heteroduplex analysis, DNA sequencing and restriction
digest confirmed that mutations in this gene resulted in loss of ATR activity
verifying the discovery of the MMAB gene (Dobson et al., 2002b). Corroborating
evidence was obtained by screening a bovine liver cDNA expression library and
identifying clones that complemented an ATR-deficient bacteria. Homologous
human cDNA was identified and used to demonstrate that patients with cblB
disorders show decreased expression of ATR when compared with normal
individuals. (Leal et al., 2003).
3.3 Location and Structure
The structure and location of the MMAB gene was deduced by identifying human
homologs as described above (Dobson et al., 2002b). A gene with nine exons was
identified on chromosome 12q24 that encoded a 250 amino acid protein. The
gene spans 18.87 kb and shares a promoter region with the mevalonate kinase
(MVK) gene. The gene product encodes ATP:cob(I)alamin adenosyltransferase, a
protein that catalyzes the final step of AdoCbl biosynthesis. The monomeric gene
product has 5 five helices ( 1 – 5) and interacts with two identical monomers
folding into a homotrimeric structure through a combination of ionic and
hydrophobic interactions. Identifying the location of highly conserved residues in
a 3-D structure targeted the location of putative functional sites on monomer
interfaces. Crystallization of a MMAB homolog, Thermoplasma acidophilum, a
member of the bacterial PduO family, with 32% sequence identity, identified
enzyme active sites at the interfaces where helices interact with adjacent
37
monomers (Saridakis, Yakunin, Xu, Anadakumar, Pennycooke, Gu, … and
Christendat, 2004). Crystallization of hATR with ATP bound, pointed to the
position of binding sites at trimer interfaces and the presence of invariant residues
adjacent to these ATP binding sites corroborated their hypothesized location
(Schubert & Hill, 2006). Examination of the ATP / hATR MMAB complex also
revealed the reorganization of previously unstructured
N-terminus residues with the binding of ATP. The residues formed a structural
cleft of the appropriate size and shape able to both bind ATP and also
accommodate a Cbl sized molecule (Schubert & Hill, 2006).
3.4 Function of ATR
Understanding how ATR’s two binding partners, ATP and Cbl, impact the
intricate structure of ATR is vital to understanding the mechanism of hATR’s
function(s). Three binding sites had been identified. Only two of the three active
sites bind ATP, leaving the third binding site free (Schubert & Hill, 2006). When
an ATP molecule binds to the third site, the AdoCbl bound to ATR is released
from its cleft (Padovani & Banerjee, 2009), leaving AdoCbl free to bind to MCM.
AdoCbl is bound to ATR in a “base off” conformation increasing the reactivity of
the Co+ and lowering the energy required to bind to ATR (Yamanishi et al.,
2005). Upon binding to MCM, AdoCbl is found in a “base off / His on”
conformation. A histidine residue from MCM binds to the carbon of AdoCbl at
the now unoccupied lower axial position. The presence or absence of different
binding partners may be related to the dual functions of ATR (Lofgren &
Banerjee, 2011). In addition to converting the reduced form of Cbl into AdoCbl,
38
it is also hypothesized that the MMAB protein may also act as a chaperone
ensuring AdoCbl’s delivery to its target, MCM (Yamanishi et al., 2005).
3.5 Spectrum of Variants
To date 25 variants have been reported in the literature and are depicted on the
gene map below in Figure 5. Appendix I contains a list of 23 mutations and two
common polymorphisms, c.56_57 GC>AA (p.R19Q) and c.716 T>A (p.M239K)
that are currently documented in literature (Dobson et al., 2002b).
Figure 5 Summary of MMAB mutations and common polymorphisms


Structural mutations at invariant residues 63,64,66 91,97,175,191,194,215
Cbl Binding region
ATP Binding region
Location of 23 MMAB mutations and two common polymorphisms.
The number of mutations per exon and putative functional role for each is
indicated. Exon 7 has 12 mutations and nine SNPs clustered in the 65bp
exon 7 that is part of the putative active site of the ATR enzyme (LernerEllis et al., 2006).
39
The two most frequently occurring MMAB mutations are c.556 C>T and c.700
C>T. Both mutations are predicted to substantially affect protein structure and/or
function by creating defects within the active ATP and Cbl binding sites. There is
some correlation between certain variants in the MMAB active sites and the
severity of the phenotype (Lerner-Ellis, Gradinger, Watkins, Tirone, Villeneuve,
Dobson, … and Rosenblatt, 2006). For example, the c.556 mutation, responsible
for the R186W protein change, may affect Cbl binding by perturbing the invariant
arginine nucleotide which projects into the Cbl binding cleft (Schubert & Hill,
2006). The location of the c.700 mutation in exon 9, results in a stop codon
(p.Q234X) and disrupts a loop between the two helixes at the location of the
active cleft (Schubert & Hill, 2006).
3.6 Genotype / Phenotype correlation
No strong genotypic / phenotypic correlation has been described for the MMAB
gene. However, the two most common mutations, c.556 C>T and c.700 C>T
share similar clinical phenotypes. The age of onset is usually within the first year
with a severe disease course (Lerner-Ellis et al., 2006). Interestingly, there seems
to be little relationship between the in vitro findings and the in vivo clinical
presentation for the c.700 nonsense mutation. The cultured fibroblasts from
patients with this mutation show only a mild reduction in [14C]-propionate
incorporation, with a moderate increase in the presence of OHCbl (Lerner-Ellis et
al., 2006). This is rarely translated into an in vivo response with OH-Cbl
supplementation. A second example of an inconsistency between in vitro and in
40
vivo responses is found with the splice site mutation, c.197-1 G>T. The c.1971G>T variant, which should seemingly produce a harsh phenotype, is associated
with a milder late onset disorder (Lerner-Ellis et al., 2006). Splice site mutations
are often leaky, creating the potential for variable expression which could help
explain this result (Rogan, Faux, & Schneider, 1998). In addition, discrepencies
between clinical presentation and in vitro results, suggest there are other factors
affecting gene expression. Such factors could include: the influence of common
polymorphisms; variants in the untranslated regions (UTR), introns or promoter
regions; and epigentic modifications.
Complementation class serves as a better predictor of clinical phenotypes than a
specific molecular change. Patients with mut0 and cblB defects have an earlier
onset of symptoms, a higher frequency of complications and deaths, and a more
pronounced urinary excretion of methylmalonic acid than those with mut− and
cblA defects. In addition, long-term disease outcome was found to be dependent
on the age cohort and Cbl responsiveness (Horster et al., 2007). In addition, mut0
and cblB patients have a higher frequency of morbidity, mortality, and
neurological complications (Matsui et al., 1983).
41
CHAPTER 4: Mutation detection for cblB type disorders
4.1 Overview of screening methods
Direct sequence analysis has long been regarded as the gold standard in
identifying gDNA variations. However, diagnostic sequence analysis of a
heterogeneous group of genes or large number of patients can be expensive and
time consuming. Classic electrophoretic techniques use physical differences in
size, shape or charge between wild type and variant alleles to make a diagnosis.
Commonly used methods include: single strand conformation polymorphism
(SSCP), conformation sensitive gel electrophoresis (CSGE), denaturing gradient
gel electrophoresis (DGGE), heteroduplex analysis and restriction site digests.
Each technique is capable of detecting allele heterogeneity and identifying
pathogenic mutations but all share the disadvantage of requiring extensive sample
manipulation during multi-step testing (Nollau & Wagener, 1997). Diagnostic
techniques such as somatic cell testing have been used to provide a functional
diagnosis for Cbl disorders of metabolism.
4.2 Screening by functional assays
Somatic cell studies are traditionally used to identify which gene(s) in the
intracellular vitamin B12 pathway are defective (Gravel et al., 1975). The
diagnostic protocol used in the Department of Medical Genetics at the McGill
University Health Center evaluates enzymatic function and the uptake of Cbl and
its conversion into derivative forms as first tier testing for errors in intracellular
42
Cbl metabolism. The function of the two enzymes, MS and MCM, is evaluated
by measuring the incorporation of the radio-labelled enzyme substrates,
[14C]-methyltetrahydrofolate and [14C]-propionate respectively, into high
molecular weight cellular proteins (Fowler et al., 2008). The ability of the
patient’s fibroblast to import Cbl is determined by measuring the uptake of [57 Co]
CN-Cbl. The imported Cbl is then extracted and purified to evaluate the cells’
ability to convert Cbl into the major derivative forms : MeCbl, AdoCbl, CNCbl
and hydroxocobalamin (OHCbl). Other ligands that are detectable include: sulfite,
glutathione and other thiols, nitrite and nitrate. (Hannibal, Axhemi, Gluschenko,
Moreira, Brasch, and Jacobsen, 2008).
Values which deviate from reference values for all three studies indicate which
gene(s) may be defective. Complementation studies (see section 1.6) are indicated
when the samples tested demonstrate deficient enzymatic biochemical finding.
However, after 35+ years of testing samples in the Vitamin B12 Laboratory in
Medical Genetics at the McGill University Health Center, approximately 355
cases with isolated MMA remain undiagnosed.
4.3 New advances in sequencing technology
Next generation sequencing platforms are able to sequence DNA faster and at a
lower cost than Sanger sequencing. HRMA also shares these benefits, but is next
generation sequencing as efficient as HRMA for diagnosing inborn error of
cobalamin metabolism? Modern sequencing technologies can provide extensive
quantities of data for molecular variants and even information related to their
43
function. This wealth of data may not be necessary to make a diagnosis and may
unnecessarily slow down the analysis process. A practical screening assay for Cbl
disorders may not need to provide information concerning all variants contained
in each patient’s genome or even exome. A useful tradeoff may be a simple
reduction in analysis time for a smaller, but adequate, amount of data and the
ability to eliminate wild type amplicons from further testing.
4.4 High Resolution Melting Analysis
In contrast to other techniques, scanning HRMA offers a rapid and a processing
reduced method to detect SNP’s and mutations. HRMA is used to identify
variants located in any area of interest defined by the location of forward and
reverse primers. In HRMA, the sample of interest is PCR amplified in the
presence of an intercalating fluorescent reporter, and denatured on a high
resolution instrument. Real time changes in fluorescence level are continuously
recorded as the sample denatures through an increasing temperature range. The
melting data generates a characteristic melting profile consisting of both a melting
curve and a melting point (Tm ). The shape of the curve reflects melting
behaviour along the entire length of the amplicon while the Tm is a single
temperature point at which 50% of normalized fluorescence is recorded. The
presence of sequence variations in DNA are identified by observing changes in a
sample’s melting profile.
Unknown variants may be detected anywhere along the entire length of the
amplicon of interest. The scanning assay is designed to scan all nucleotides, and
differences are most easily observed by noting difference to the shape of the curve
44
compared to a reference sample(s). An assay designed to genotype a known
variant examines a single, or limited number of nucleotide(s), and changes are
most easily observed by noting shifts in the Tm. that are caused by the differing
thermodynamic stabilities of the variable nucleotide. Genotyping may be achieved
using several techniques including small amplicon, unlabeled probes, labelled
probes and snapback primers. The method used is dependent on the information
desired and the physical nature of the gene of interest. For example, small
amplicon analysis may be difficult to analyze in highly polymorphic regions and
an unlabeled probe can provide detailed data for the area under the probe.
Mutations that are homozygous may be more challenging to detect if changes in
Tm are small. Amplification of heterozygous samples results in the formation of
three products, two homoduplexes (wild type and mutant) and heteroduplexes that
are easily detected on melting. If the Tm difference between a homozygous wild
type and homozygous mutant sample is small, the two curves may be impossible
to distinguish. This can be circumvented by mixing the homozygous sample with
known homozygous wild type DNA, and denaturing the mixture to allow for
random re-naturation. If the sample being tested is wild type, no changes to the
melting curve will be seen. If a sample is homozygous for the minor allele,
random annealing after denaturation will allow four different parings of alleles to
occur. Heteroduplex curves will be observed in addition to both homozygous
wild type and mutant curves.
45
4.4.1
Simultaneous gene scanning and genotyping for common polymorphisms
Snapback primers which are illustrated in Figure 6 provide genotype data for a
specific variant and scan the remainder of the amplicon for variants in the same
reaction. Snapback primers incorporate a probe element directly onto the 5’ end
of a standard primer circumventing potential technical issues associated with
multiple primers. The probe element is an oligonucleotide that is complimentary
to the immediate area (approximately a total of 16-20 nucleotides) surrounding
the variant of interest. The snapback functions as both primer and probe. The 5’
primer tail, or probe portion, can fold or snap back, hybridizing to the 3’ extension
production forming a loop structure on ssDNA. Both DNA loop structure and full
length amplicon duplexes are formed (Zhou, Errigo, Lu, Poritz, Seipp, and
Wittwer, 2008). Melting of these products reveals both a low temperature peak(s)
and a higher temperature peak(s). The lower temperature melting peak results
from the shorter loop structure which genotypes the variant of interest. The high
temperature peak provides scanning data for the longer length full amplicon.
4.4.2 HRMA Analysis
Data is collected by monitoring the denaturation of PCR amplified DNA in real
time on the LightScanner® 96 (Idaho Technologies, Inc., Salt Lake City, UT).
Two analysis methods were used: a program provided by Idaho Technologies
Inc., the Light Scanner® Call-IT; and a method utilizing differences observed in
46
Figure 6 Simultaneous scanning and genotyping using a snapback primer
PROBE MELTING
Genotype Variant of Interest
FULL AMPLICON MELTING
Scan Amplicon for Variants
Method
1. The sample is amplified in the presence of a snapback primer and an
intercalating fluorescent dye
2. Full amplicon formation due to strong intermolecular binding
3. 8-10X Dilution, allows strengthening of intramolecular forces during
denaturation and random annealing
4. A combination of hairpin loops (snapback primer) and full amplicon
duplexes allows genotyping of the common polymorphism (the probe
to melt at a lower temperature) and the full amplicon duplexes that
will denature at higher temperatures
melting data after normalization and exponential background subtraction (Palais
& Wittwer, 2009). Both protocols normalize the data and generate a normalized
47
curve with fluorescent values between 0 and 100%. The data is further adjusted
for temperature variations by aligning the high temperature regions of the
normalized curves creating shifted melting curves. Superimposing the curves on
each other emphasizes the differences in shape, allowing samples with small
differences to be easier to visualize (see Appendix II for representative analysis
results). The data can be further converted into a difference curve using the
derivative. It tracks the rate of change and makes it quite easy to determine the
Tm (Palais, Liew, & Wittwer, 2005).
4.4.3 Interpretation of HRMA results
The goal of analysis of a scanning HRMA assay is to identify any samples that
display changes in melting curve shape as compared to a wild type reference. If
the melting curve agrees (clusters) with both the in silico predictions and clusters
with the reference samples (i.e. the wild type cluster), the scan is negative. This
indicates the absence of any variants, and no further testing is required. Positive
samples display differences in comparison to the reference and need further
investigation to determine if they are due to a benign, common or pathogenic
variant.
4.5 Considerations in choosing a screening method
Of primary concern in choosing a clinical screening method is ability of the test to
accurately identify both positive and negative results. Clinicians calculate the
48
sensitivity and specificity of an assay to evaluate the efficacy of diagnostic tests.
Sensitivity measures the probability that a person with the disease will be
correctly identified by the test used and is calculated by dividing the total of true
positive (TP) tests by the total number of tests, both TPs and false negatives (FN)
(Reed, Kent, & Wittwer, 2007).
An assay with high sensitivity can be used to rule out a disease when the patient
has a negative result. Conversely, specificity is used to evaluate the certainty that
a positive test result accurately translates to an affected patient. Specificity
predicts the percentage of negative test results that are correctly identified. The
calculation divides the number of true negative tests (TN) by the number of TNs
plus false positives (FP). The calculated sensitivity and specificity of a newly
developed assay should be compared to the sensitivity and specificity of the
currently accepted gold standard to determine its efficacy.
In addition, an increasing number of samples are arriving at clinical laboratories
as a result of expanded newborn screening programs. Current studies reveal that
only approximately 1 of 50 are true positives (Kwon & Farrell, 2000). A prescreening method to improve specificity would be both economical and prevent
laboratories from becoming overburdened.
49
CHAPTER 5:
Rationale for evaluating HRMA as a cblB screening tool
Somatic cells studies have been used to evaluate more than 1,700 samples for Cbl
related disorders at the Medical Genetics Laboratory of the Montreal General
Hospital. A total of 375 samples with MMA were successfully assigned to
complementation groups. The complementation group distribution was: 245 of
the samples were assigned to the mut complementation group, 74 to the cblA
complementation group, 49 assigned to the cblB complementation group and five
to cblD variant 2 as well one sample with mutations in MCEE. Approximately
474 samples with elevations in MMA alone or in combination with elevated
homocysteine remain undiagnosed. Determining an exact number of undiagnosed
samples with isolated MMA is not possible as the amount of clinical information
for each referral is variable. There are approximately 355 samples with isolated
MMA (no mention of homocystinurua in the clinical notes on the referral form)
that did not receive a diagnosis after testing with functional studies.
The index case for this study provides an example of an affected case which
remained undiagnosed after somatic cell studies. A female infant, identified as
having an abnormal newborn screen (NBS), began having generalized seizures at
two months of age. She presented mild but persistent MMA, normal
homocysteine, serum B12 and was non-responsive to vitamin B12 treatment.
Biochemical analysis determined that all test values were within the reference
range, and the return of results stated that no inborn errors of Cbl had been
50
identified. Subsequently, through private communications with the physician, we
learned that two heterozygous MMAB mutations had been identified: p.S133F
(c.398 C >T) and p.R191Q (c.572 T >C). A valid diagnostic approach had been
followed and yet failed to reveal the underlying cause of this child’s MMA. This
case highlights the benefits of evaluating alternate techniques to further
interrogate samples with basal incorporation levels of [14C]-propionate that are
too high to be diagnosed by complementation studies. The development of a fast
and simple PCR-based assay with the ability to screen targeted genes of the
vitamin B12 pathway for sequence variation could be of great benefit.
A HRMA scanning assay has the ability to provide fast, low cost test results with
minimal sample manipulation. To date all nine exons and adjacent introns of 181
samples with unresolved MMA have been scanned using the experimental
protocol outlined below. The goal of this project is to scan all archived samples
(approximately 355) with isolated MMA to determine if causal variants in the
MMAB gene can be identified.
5.1 Gene scanning to detect unidentified variants
Gene scanning would be able to identify any unknown variant located between
the forward and reverse primers in all amplicons. The presence of a heterozygous
variant could be easily detected due to changes in the shape of the curve
compared to a reference wild type cluster. The extent of the deviation was
determined by the nature of the specific mismatch. Detection of samples that
were homozygous for the minor allele could be difficult if the Tm difference
51
between variants was small (< 0.5º C). All samples were mixed with an
equivalent amount of PCR amplified wild type gDNA to ensure detection of all
variants, as described in section 6.3.
5.2 Genotyping of common polymorphisms
Snapback primers were designed for exons 1 and 9 to genotype p.R19Q and
p.M239K polymorphisms respectively. An assay ultizing snapback primers
would be able to genotype non-pathogenic polymorphisms, such as p.R191Q and
p.M239K eliminating unnecessary confirmation of their identity with sequencing.
The use of snapback primers will allow simultaneous scanning the full amplicon
for unknown variants and genotyping, providing both sets of data in a single
assay.
52
CHAPTER 6: Methods and Materials
The development of a clinical assay requires three phases: optimization;
validation of the assay; and the testing of unknown samples.
6.1 Optimization
Optimization was conducted to identify a robust amplification program and
ensure the absence of non-specific binding.
6.1.1 Assay design
Gene Annotation
A variety of databases were used to annotate all known variants, common
polymorphisms and physical features that might affect amplification and analysis:
Exome Variant Server (Need, Shashi, Hitomi, Schoch, Shianna, MacDonald, …
and Goldstein, 2012) (http://evs.gs.washington.edu/EVS/); UCSC database
(Kent, Sugnet, Furey, Roskin, Pringle, Zahler, and Haussler, 2002)
(http://genome.ucsc.edu/); the Single Nucleotide Polymorphism database (dbSNP)
(Sherry, Ward, Kholodov, Baker, Phan, Smigielski, and Sirotkin, 2001)
(http://www.ncbi.nlm.nih.gov/projects/SNP/) ;and Ensembl’s 1000 genome
project (The1000 Genomes Project Consortium, 2010)
(http://www.1000genomes.org/).
Primer design
Light Scanner  Primer Design Software (version 1.0) was used to design two
independent sets of primers (see Table 1). Primers were designed for all nine
53
exons including at least 15 adjacent intronic base pairs and generated PCR
products that were less than 400bp (Reed et al., 2007). Designed primers were
evaluated using OligoCalc software to minimize self complementation and
homology (http://www.basic.northwestern.edu/biotools/oligocalc.html) (Kibbe,
2007). Simultaneous evaluation of multiple primer sets minimized the time
required for optimization. In silico predictions using uMeltSM and uViewSM
(http://www.dna.utah.edu/#) (Dwight, Palais, & Wittwer, 2011) were used to
predict number of melting domains, approximate Tm and the overall curve shape.
Deviations from the expected profile would indicate insufficient optimization.
Table 1: MMAB Primers for HRMA assay
Primers used in this study
Forward Primer
Exon
5’
Reverse Primer
3’
5’
bp
G/C
215
69%
AAGCCTGCGCGGGTGCGGTGTTC
1**
AACCTGGCGGGGTCAGGT
2
CCCTCTGTGTAAGCCATCC
TGTATGCCATGAGTATTTCTTT
161
46%
3
CAGAATCTTAATTTGGGTGGCT
ACTGACTCAAACGCAAC
189
42%
4
AGGGACATTACATTACAGGCA
AGCTTGGGTGAGATGGTGTTA
130
40%
5
TGTCCAGCCCATCTCACATA
AACACCCACAGGAGTTTG
153
56%
6
CTCATGGCAGTTCCCTCT
TGTGTCTGTCACTGAACCT
195
60%
7*
GCTCCTGGAGGCAGAACA
TCCTCTCCCTCTCCCTTG
144
65%
8
GTTGAGCCCCATAATGTCA
GGCTTTCAGAGAGGAACCC
145
54%
9
AGACCCAGTTAGCGTTGATC
166
49%
GAGTTGCCCTT
TCAAATATACATGAAAAATGAGA
TCCTCCAAGCTCCCAC
Snap
back
3’
Yes
Yes
*Needs addition of 5% DMSO ** Needs addition of 7.5% DMSO
Primer pairs selected on the basis of optimization / Primers are HPLC purified
54
6.1.2 PCR optimization
Temperature gradient trials were conducted on a MJ Research PTC-200
thermocycler (Bio-Rad Laboratories Ltd. Mississauga, ON) using the reagents
described in Table 2. An annealing temperature of 67o C was found to amplify all
amplicons well using the amplification program described in Table 3. Two exons,
1 and 7 with G/C contents of 69% and 65% respectively, required the addition of
dimethyl sulfoxide (DMSO) 7.5% for exon 1 and 5% for exon 7 to the PCR
reaction in order to prevent non-specific binding. Non-specific binding in exon 3
was eliminated by lowering the primer concentration to 3.5M.
Table 2: PCR reagents
Reaction Mixture
Master
Mix
Forward
Primer
Reverse
Primer
H20
l
l
Reagent
4
2
2.5x Light Scanner Idaho Technologies
1
0.5
concentration range 3.5 -5 5M
1
0.5
concentration range 3.5 -5 5M
2
(1.25) 1 (0.625)
(1.5)
(0.75)
0.75
0.375
0.5
0.25
gDNA
2
1
Total
10
5
DMSO –
EXONS
1 & 7 only
(volume of H20 after DMSO
adjustment)
Exon 1
Exon 7
Concentration of 25ng/l
Volumes are given for one reaction. To make master mix multiply
volumes by the number of reactions being tested plus one. During testing
of the unresolved MMA samples, a smaller reaction volume of 5l was
tested and validated as a reagent saving measure.
55
Table 3 PCR amplification program
Amplification Program
1 cycle
40 cycles of
3 steps
1 cycle
Cool to
Temp.
Time
95o C
3 min
Denature
15 sec
95o C
o
76 C
1 min
o
10 C
Anneal
67o C
10 sec
Extension
76o C
10 sec
Shortened stages provide better specificity and decrease the time required
for the assay
6.2 Cell line selection
Assay Validation
A set of archived gDNA from 42 patients diagnosed with cblB disorders were
selected for use during validation (see section 7.2) and represented 20 of 23
mutations found in literature (see appendix I) . These samples were scanned to
ensure assay optimization, identify any common polymorphisms that may affect
analysis, and confirm that experimental melting curves were in agreement with in
silico predictions.
Unknown samples
DNA samples from 181 patients with unresolved isolated MMA were chosen to
be evaluated due to a basal level of propionate incorporation that was too high to
allow complementation analysis. Genomic DNA for these lines was obtained
from three sources: gDNA samples stored at -20C; or gDNA extracted from
either cells stored at -80C or fresh fibroblast cultures using the Puregene Cell Kit
(Qiagen Inc., Toronto, Ontario). Fibroblast cell lines were obtained from the
56
Repository for Mutant Human Cell Strains of the Montreal Children’s Hospital
(http:// www. cellbank.mcgil.ca/).
6.2.1 DNA quality control and preparation
Experimental variation must be minimized in order to ensure that melting curve
differences are the result of molecular variants alone (Perez et al., 2010). Quality
assurance for each phase of assay development is described below.
Normal Reference samples
Reference samples, 96 UK Caucasian DNA, Human Random Control (HRC1),
were purchased from Sigma-Aldrich Canada Ltd. (Oakville, Ontario)
Assay Validation samples – diagnosed cblB samples
Approximately 20% of archived samples from our lab were found to be
functionally insufficient during the development of a previous HRMA assay in
the laboratory of Dr. Carl Wittwer (Huang, personal communication, 2009). All
cblB samples used during assay validation were whole genome amplified using
the Illustra GenomiPhi HY DNA Amplification Kit (Product #25-660020, GE
Healthcare Waukesha, WI, USA) to ensure both adequate quantity and quality.
All 42 cblB samples were amplified and tested for quality by qPCR at Dr. Carl
Wittwer’s Laboratory (Department of Pathology/School of Medicine, University
of Utah, Salt Lake City, UT, USA).
57
Unknown samples
Quantitative PCR was performed on the Rotor-Gene RG-3000 (Corbett,
San Francisco, California USA) and was used to evaluate DNA quality after long
term storage. A standard curve was generated using five-fold dilutions of the
housekeeping ERK1 gene ( Forward primer 5’GCGCTGGCTCACCCCTACCT3’
and reverse 5’GCCCCAGGGTGCCAGAGATGTC3’) and SYBR green (Life
Technologies, Inc., Carlsbad, California). The amplification program 95o C for 15
sec / 40 cycles (94o C for 15 sec / 65o C for 30 sec / 72o C for 30 sec) / 95o C for 1
minute followed by melting from 72 - 95o C provided Ct value for all dilutions.
Testing each dilution in an HRMA assay demonstrated that function in an HRMA
assay was lost between the 1/5 and 1/25 dilution. The Ct value of the 1 in 5
dilution for each assay was used as the baseline cut-off. Samples with a higher Ct
value were reserved for whole genome amplification for later testing with samples
of similar quality.
Stock sample plate preparation
Experimental variation among assays was reduced by preparing standard sample
plates containing 50ng of 96 individual DNA samples in each well. In all cases
the DNA concentration was adjusted to 25ng/l in TE’ buffer (10Mm Tris-HCl /
0.1mM EDTA pH 8.0) using the Nanodrop spectrophotometer ND1000 (Thermo
Scientific, Wilmington, DE, USA).
A multichannel pipette was used to dispense 2l of diluted gDNA into each well
on a 96 well PCR Plate (Bio-Rad HSP9665 Bio-Rad Laboratories, Inc.
58
Hercules, CA, USA.). The plates were allowed to air dry overnight and stored in
a sealed container at room temperature. One amplicon was tested per plate and
enough plates were prepared to complete testing of all nine MMAB amplicons.
6.3 Assay protocol with mixing
A master mix was prepared for each amplicon using the primers listed in Table 1
and according to reagents outlined in Table 2. A volume of water equal to the
DNA volume listed was added to compensate for the volume that had been dried
onto the stock plates. The reaction mixture per plate was 400 l Light Scanner
2.5x Master Mix (Idaho Technologies, Inc., Salt Lake City, UT, USA), 100 l
forward primer, 100 l reverse primer and 400 l water. Each well on the stock
plate received 10 l of master mix, was placed on a shaker for 5 minutes,
protected from light and cooled with a freezer pack placed on top. Forty l of
light mineral oil (8042-47-5 Fisher Scientific, Hamptom, NH,USA) was added to
each well. The plate covered with an adhesive seal (95.1994 Starstedt AG & Co.,
Nümbrecht, Germany) and spun at 1,500g for 3 minutes before amplification.
After amplification (see program Table 3), the plate was centrifuged again and
melted using the Light Scanner System 96 from Idaho Technologies, Inc. (Salt
Lake City, UT, USA) with a melting range at least 7 degrees below and 5 degrees
above the predicted Tm. After an initial melting to identify any failed reactions, 5
l of each sample was mixed with a 5l of equivalent quantity of wild type DNA
which had also been amplified using Light Scanner 2.5x Master Mix (Rivera,
59
Merinero, Martinez-Pardo, Arroyo,Ruiz-Sala, Bornstein, … and Martin, 2010).
The plate was centrifuged at 1,500g for 3 minutes and denatured at
97 oC for 3 minutes to allow random re-naturation before melting and subsequent
analysis.
6.4 Protocol for genotyping with snapback primer
Amplicons 1 and 9 required additional processing to genotype the common
variants using snapback primers.. Five l of the amplification product was
transferred and mixed with 5 l wild type DNA as described above. The
remaining 5l was diluted with water (1:8 for amplicon 1 and 1:10 for amplicon
9). The plate was centrifuged at 1,500g for 3 minutes and denatured at 97 o C for
3 minutes to allow random re-naturation before melting and subsequent analysis..
The melting range was extended (48-98o C) to capture data for the snapbacks
which melt at a significantly lower temperature.
6.5 Analysis
Analysis was conducted using two methods. The LightScanner 96® has integral
data analysis, Call-IT®. (Idaho Technologies Inc., Salt Lake City, UT, USA) A
second method detected the presence of variants by observing a greater than 5%
difference in comparison to a reference melting after normalization and
exponential background subtraction (Palais & Wittwer, 2009) This analysis
method also provided a useful quality score index to assess uniformity among
reference samples. A quality score less than one was the standard acceptable
60
levels of sample and assay variation. This ensured that melting curve differences
reflected the presence of variants during scanning analysis. Both methods were in
agreement in identifying all variants. A range of  5% for samples after mixing
was established as the acceptable deviation due to normal variation during
training at the laboratory of Dr. Carl Wittwer (University of Utah, Salt Lake City,
UT, USA). Samples with a higher deviance were sent for confirmation.
6.6 Confirmation of results
HRMA is a non-destructive technique allowing for direct confirmation of assayed
samples. All samples with a potential variant were sequenced at the McGill
University and Genome Quebec Innovation Center using Sanger Sequencing
Platform (Montreal, Canada). The location of the scanning primers used for
HRMA assays were too close to the intron / exon boundaries to allow sequencing
of the complete exon. A second set of primers placed at least 60bp outside the
intron/ exon boundary was used (Lerner-Ellis et al., 2006) to sequence amplicons
in both directions.
61
CHAPTER 7: Results
7.1 Variant detection by HRMA analysis
7.1.1 Scanning of reference population
Analysis of the reference population, 96 UK Caucasian DNA samples, (Human
Random Control (HRC1) Sigma-Aldrich Canada Ltd., Oakville, Ontario)
demonstrated that experimental melting profiles were in agreement with in silico
predictions (Dwight et al., 2011) and formed tight clustering patterns confirming
the assay’s ability to detect all changes to the melting profile.
Two variants, p.R19Q and p.M239K found in exons 1 and 9 of MMAB, provided
a challenge for analysis due to the frequency of these two common
polymorphisms. Since the assay will detect all variants, both pathogenic and
benign, the assay may generate a high percentage of “false” positives causing time
and money to be spent on unnecessary confirmations.
In evaluating the assay’s ability to genotype the first of these polymorphisms,
p.R19Q (rs36013132) in exon 1, the pattern of clusters observed was suspicious
due to the absence of a cluster containing samples homozygous for the minor
allele (post mixing). The NHLBI Exome Sequencing Project (ESP) Exome
Variant Server cited a minor allele frequency (MAF) of 0.307 for the variant
(Need et al., 2012). Using the Hardy-Weinberg model, at least nine samples
homozygous for the minor allele would have been expected in a cohort of 96
patients. In addition, when the samples from each cluster were tested, sequencing
revealed that both wild type and heterozygous genotypes were found in both
62
clusters. The resolution of the current assay was insufficient to assign genotypes
based on clustering patterns.
A small amplicon assay was designed in order to improve resolution (Liew, Pryor,
Palais, Meadows, Erali, Lyon and Wittwer, 2004). Shortening of the amplicon
from 331bp to 109bp allowed accurate genotyping of p.R19Q, but clinically its
use would be inefficient. Clinical diagnosis would require two separate assays:
one to scan the entire amplicon and this second small amplicon assay to genotype
the polymorphism.
A new approach, the use of snapback primers to provide simultaneous genotype
data for known polymorphisms and full amplicon scanning for unknown variants
(Zhou et al., 2008) was tested. After designing the snapback primer for this
amplicon, the assay was optimized in collaboration with the Dr. Carl Wittwer’s
lab (Department of Pathology, University of Utah, UT, USA). Sequencing
confirmed the samples’ genotypes were in agreement with the HRMA clustering
patterns. Consequently, a second snapback primer was designed for the second
common polymorphism, p.M239K, in exon 9 (rs9593). Once again sequencing
also confirmed the accuracy of the clustering patterns observed. Use of the
snapback primer assays was implemented for analysis of p.R19Q in exon 1 and
p.M239K in exon 9.
7.2 Validation of the HRMA scanning assay for MMAB
A blinded study of 48 samples was conducted including 42 patients who had
been assigned to the cblB group by complementation analysis plus three controls,
one repeat sample and two patients of interest (see Table 4). Information on the
63
mutations was available for 37 samples which had received full Sanger
sequencing with 36 patients having at least two mutations identified, and only a
single mutation was discovered in the 37th (WG1680) (Lerner-Ellis et al., 2006).
The five additional cblB samples were tested by restriction digest for three
common mutations (c.556 C>T, c.700 C>T and c.567_571dup CCGCC). A
genotypically matched sibling (WG2488) was substituted for the original sample
(WG2487) due to mycoplasm contamination. Additional samples included a
repeat sample that had receivied a separate ID, three controls and finally two
samples of interest. WG1997 appeared to complement some cblA lines, but the
correction was suspect as it occurred both with and without fusion of the cells.
This sample was later diagnosed to have compund heterozygous samples in
Table 4 Samples tested for assay validation
A summary of samples used for validation of the MMAB HRMA assay.
42 of 48 samples had been diagnosed by complementation. Six additional
samples included: two patients of interest, one duplicate sample and three
controls.
64
SUCLA2 by exome sequencing. WG4138, the second patient of interest, remains
undiagnosed.
Data was analyzed after scanning using the protocol described in chapter 6.5. A
more stringent approach was taken during validation and all samples deviating
more then 3% (not 5%) from reference samples, both before and after mixing with
wild type DNA were sent for validation by sequencing.
The results confirmed that 33 of 36 cblB samples had been correctly identified as
containing the known variants in the appropriate exon by HRMA. Investigation
revealed that clerical errors were responsible for the three erroneous results. An
unclear label caused an incorrect sample to be tested for WG1586, and the
remaining two errors were due to a sample switch between WG2345 and
WG2350. A new extraction of gDNA from these three stored samples was tested
and confirmed the suspected errors had transpired. The new samples provided the
Table 5 Variants identified during assay validation
Previously
identified by
Restriction Enzyme
Identified as a result
of HRMA
WG1680 c.700 C>T p.Q234X
c.571 C>T (p.R191W)
WG3430 --
c.569 G>A (p.R190H)
Identified as a result
of HRMA
WG3574 c.556 C>T p.R186W
WG3826 --
c.291-1 G>A
c.571 C>T (p.R191W)
WG3979 c.556 C>T p.R186W c.12 C>A (p.C4X)
WG4070 --
c.291-1 G>A
Six cblB patients had none or a single variant identified. Six previously
undetected mutations were discovered as a result of HRMA
65
correct results for all three samples resulting in 42 of 42 known samples from
cblB patients being correctly identified and validating the assay for the detection
of variants in the MMAB gene (see Appendix III). Only three of twelve mutations
had been identified by restriction endonuclease (RE) analysis in the remaining six
samples (five patients recently identified by complementation and WG1680 from
the above study). Six additional mutations were discovered using HRMA and are
listed in Table 5. All patients had at least a single mutation identified (three with
two mutations identified and three with one mutation discovered). No mutations
were identified in either the two patients of interest or the three control samples
(see Appendix III). Of note was the identification of a novel sequence variant,
c.12 C>A (p.C4X) in WG3979. The patient was discovered on newborn
screening and had no pertinent clinical manifestations. Follow-up testing revealed
an unusual biochemical phenotype for this patient, given the absence of a clinical
phenotype. Testing revealed low AdoCbl synthesis, a slight decrease in [14C]propionate incorporation, and a brisk response to OHCbl. In conclusion, variants
in all 43 patient samples (42 +1 repeat) were correctly detected, indicating HRMA
is well suited for clinical use.
7.2.1 Amplicons with a large number of variants
Analysis of exons 7 and 9 was difficult due to the large number of variants in
these two exons for this cohort of affected cblB patients. Exon 7 contains the
most common MMAB mutation, c.556 C>T (p.R186W), and an additional 11
mutations plus nine SNP’s have been reported in the literature. For this cohort, 29
66
of the 48 samples contained variants in exon 7. All samples with variants were
easily distinguishable from the wild type cluster consisting of 19 samples, and
consequently would have been sent for confirmation by sequencing. Exon 9
contains the 2nd most common mutation, c.700 C>T (p.Q234X), as well as the
common polymorphism, p.M239K, and 2 additional mutations. Variants were
identified in 25 of 43 (42 +1 repeat) cblB samples in exon 9. Nine of these 43
samples had variants different than p.M239K. All variants in exon 9 were
distinguishable from the wild type cluster.
After unblinding the study, samples identified as having possible variants in exons
7 and 9 by HRMA were compared to known mutations. If the test result and
record were in agreement, the sample was considered to be a true positive. The
Table 6 Sensitivity and Specificity of Assay
Exon
Sensitivity
+
Specificity
False +
False -
1
100%
100%
0
0
2
100%
100%
0
0
3
100%
97.6%
1
0
4
100%
97.6%
1
0
5
100%
100%
0
0
6
100%
97.8%
1
0
*7
100%
100%
0
0
8
100%
100%
0
0
100%
100%
0
0
+
*9
Overall
100%
> 99%
3
0
* Samples with variants clustered separately from wild type
+
Use of snapback primer to genotype polymorphism and scan
Three samples were identified as possible variants and were shown
to be false positives after sequencing resulting in an overall
sensitivity of 100% and specificity > 99%.
67
observed change in the melting profile would have indicated a positive result, and
the sample would have been sequenced to confirm and identify the variant. All
samples were in agreement for these two exons. Positive samples in the
remaining exons (1,2,3,4,5,6 and 8) were sent for sequencing as confirmation,
making it possible to calculate the sensitivity and specificity for each exon (see
Table 6).
7.2.2 Distribution of mutations
Eighty-three of 86 alleles in 43 samples (42 + 1 repeat) from patients with the
cblB disorders were found to contain a mutation in the MMAB gene as
summarized in Table 7. The mutations represent 21 individual mutations types.
The most common mutations were missense mutations and included c.556 C>T at
30.2% (26/86) and c.700 C>T at 11.6% (10/36). In total 54.7% (47/86) were
missense mutations, 12.8% (11/86) were nonsense mutations, 19.8% (17/86) were
Table 7 Distribution of mutation type
Types of Mutations
# of types
% of total alleles
Missense variants
11
54.7
Nonsense
2
12.8
Splice Site
3
19.8
Duplication
1
Insertion
2
Deletions
2
Undiagnosed
n/a
9.3
3.4
21 individual mutations types have been identified by HRMA
68
splice site mutations, 9.3% (8/86) were deletions, insertions and duplications, and
3.4% (3/86) remain undiscovered.
7.3 Scanning of Undiagnosed MMA samples
All nine exons of the MMAB gene were scanned for variants in 181 different
isolated MMA patients using the HRMA assay. Two patients (1.1% of total) were
found to contain two mutations in the MMAB gene. A single heterozygous
mutation was discovered in four additional patients (2.2% of total). Results for all
patients are found in Appendix IV. Results for the eight variants discovered in all
six patients represent five different missense changes and are listed in Table 8.
Table 8 Variants identified in patients with unresolved MMA
1st Mutation
2nd Mutation
Ethnicity
WG3948
c.572 G>A
R191Q
c.398 C>T S133F
White
WG4034
c.572 G>A
R191Q
c.394 T>C C132R
White
WG3546
c.572 G>A
R191Q
None
Detected
None
Detected
White
WG4090
c.572 G>A
R191Q
None
Detected
None
Detected
White
WG4029
c.185 C>T T62M
None
Detected
None
Detected
WG3759
c.521 C>T
None
Detected
None
Detected
African
American
Asiatic
Indian
S174L
A total of five exonic missense variants were identified in six patients
identifying two compound heterozygous patients not previously detected.
69
Four of six clinically affected patients share a common mutation in exon 7,
c.572 G>A (p.R191Q), and all are described as white. Two of the four patients
have had a second variant identified (see Table 9), while the other two remain
with only a single variant identified (see Table 10).
The two patients with a single variant are not described as white and had variants
different from p.R191Q identified. A patient summary and characterization of
variants will follow in section 7.3.1 and 7.3.2.
7.3.1 A summary of the two patients with compound heterozygous variants
Clincial Summary
WG3948
Patient WG3948 is a white female infant who was identified as a result of an
abnormal newborn screen. Persistent seizures began at one to two months of age.
The following workup revealed a mild but persistent MMA which did not resolve
after a vitamin B12 injection, and had normal homocysteine levels. Her serum
MMA level was 1391pg/ml (normal 200 -1,100 pg/ml) and serum vitamin B12
was 470 pg/ml (normal range for a newborn 60 - 1300 pg/ml). Somatic cell
studies showed that incorporation of propionate and methylTHF were within
normal limits, making complementation analysis infeasible. Cbl uptake was
above the reference range, but is suspected to be a result of erroneous cell counts.
No inborn errors of Cbl could be diagnosed. Scanning by HRMA revealed two
70
Table 9
A summary of MMA patients with compound heterozygous MMAB mutation
WG3948
1st Mutation
WG4034
Average value
for cblB
R191Q
R191Q
2 Mutation
S133F
C132R
Ethnicity
White
White
Age of onset
2 months
13 month
14.6  14
12.2  12.6
1.3  2.0
379  697
320  385
190  370
Synthesis of AdoCbl
adequate
adequate
Synthesis of MeCbl
adequate
adequate
60.8
8.2
7.2
2.6
8.35 ± 3.9
CNCbl
23.4
21.1
11.27 ± 6.9
AdoCbl
11.1
10.8
15.29 ± 4.2
MeCbl
56.3
63.2
61.6 ± 6.7
Others
2
2.3
7.18 ± 2.7
nd
14
[ C] propionate
-OHCbl  +OHCbl
nmoles / mg protein / 18hr
[14C] MethylTHF
-OHCbl  +OHCbl
nmoles / mg protein / 18hr
57
[ Co] CNCbl in PG
PG / 106 cells
10.3 ± 4.7
B12 Distribution
OHCbl
A summary of somatic cell test results performed by Maria Galvez,
Jocelyn Lavallé and Dr. David Watkins in the Medical Genetics
Laboratory at the Montreal General Hospital. Tests are described
in section 4.2.
Values for [14C]-propionate and [14C]-MethylTHF are presented as
without OHCbl supplementation With OHCbl supplementation
to evaluate if exogenous Cbl can rescue fibroblast function.
71
Table 10
A summary of MMA patients with one heterozygous MMAB mutation
WG3546
WG4090
WG4029
WG3759
1st Mutation
R191Q
R191Q
T62M
S174L
Other Variant(s)
R19Q
M239K
homozygous
polymorphism
I96I
R19Q
M239K
homozygous
polymorphism
Ethnicity
White
White
African
American
East Indian
Age of onset
2 months
?
Tested 1yr
3 months
-OHCbl  +OHCbl
7.4  8
6.7  6.6
16.5  17.6
13.5  16
16.3 17.6
1.3  2.0
194  324
320  385
383  600
168  406
190  370
nmoles / mg protein /
18h
14
[ C] MTHFR
-OHCbl  +OHCbl
heterozygous
heterozygous
14
[ C] propionate
Avg cblB
Values
pmoles / mg protein /
[57Co] CnCbl
PG / 106 cells
Synthesis of AdoCbl
19.5
8.2
5.4
3.4
adequate
adequate
adequate
lower
Synthesis of MeCbl
adequate
adequate
adequate
adequate
10.3 ± 4.7
Control
Values
B12 Distribution
OHCbl 5.6
CNCbl 6.3
1.4
1.4
4.7
8.35 ± 3.9
15.7
15.4
9.2
11.27 ± 6.9
AdoCbl 12.2
64.4
MeCbl
7.6
11.4
12 and 3
15.29 ± 4.2
66.3
66
61.6
61.6 ± 6.7
9
5.8
21.5
Others 11.5
7.18 ± 2.7
A summary of somatic cell test results performed by Maria Galvez,
Jocelyn Lavallé and Dr. David Watkins in the Medical Genetics
Laboratory at the Montreal General Hospital. Tests are described
in section 4.2.
Values for [14C]-propionate and [14C]-MethylTHF are presented as
without OHCbl supplementation With OHCbl supplementation
72
variants. The first, p.R191Q, was present in exon 7, a putative active site, and has
been described in the literature as one of several substitutions at this position.
The second, p.S133F, was identified in exon 5 and has not been described in the
literature.
WG4034
Patient WG4034 is a white female, who was the only child of her healthy
biological mother and an anonymous sperm donor. Seizures began at
approximately six months and are controllable with medication, but break through
with fevers. The clinical information notes “moderate” MMA as well as “mild
Homocystinuria”. She has a variant of unknown significance in a seemingly
unrelated sodium channel gene, SCNN1A, and a synonymous homozygous
variant in the MMACHC gene. Follow-up at three and a half years revealed
developmental delay but normal growth. Findings of somatic cell studies were all
within the reference range. HRMA scanning revealed two variants including a
p.R191Q substitution in exon 7 and a p.C132R substitution in exon 7, which has
not been described in the literature.
Characterization of variants identified
R191Q
The missense change, p.R191Q is found at an invariant arginine residue. There
are multiple substitutions at this location which is involved with interactions
between trimer interfaces (Schubert & Hill, 2006). Although the frequency of the
73
R191Q variant is unknown, the discovery of a heterozygous variant in four of 181
patients with isolated MMA (2% of samples) suggests that this variant may be
significant. The levels of [14C]-propionate incorporation in patients containing the
variant lies midway between the low mean levels found in cblB affected patients
and those levels found in normal controls.
Functional studies have been conducted in Thermoplasma acidophilum (TA1434)
to study the affects of protein changes at this location (Saridakis et al., 2004). The
p.R191W (c.571 C>T) substitution had reduced stability compared to wild type
samples demonstrating an approximately 70% reduction in activity (Zhang,
Dobson, Wu, Lerner-Ellis, Rosenblatt and Gravel, 2006). The location of this
amino acid may be key in determining pathogenicity as it projects into the central
cavity of the trimeric structure and is involved with trimer interactions through
hydrogen bounding (Jorge-Finnigan et al., 2010). While these studies were
conducted on mutant proteins for the p.R191W variant (Jorge-Finnigan et al.,
2010), any observations based on the location of the variants could be pertinent to
the p.R191Q (c.572 G>A) substitution as well. Any significant amino acid
changes at this position could affect enzyme activity by disrupting overall stability
of the trimer caused by disruptions to the physical interactions among subunits. It
is also worth noting that all four patients with the p.R191Q mutation are
ethnically described as white.
S133F
The conservation at this position reveals that the amino acid is highly conserved
and mutational prediction software indicates a p.S133F substitution would be
74
damaging (Adzhubei, Schmidt, Peshkin, Ramensky, Gerasimova, Bork, … and
Sunyaev, 2010). The p.S133F substitution changes a nucleophilic amino acid,
serine, to an aromatic amino acid, phenylalanine. This variant is located in the
same set of ordered residues as another documented pathogenic substitution,
p.A135T (Dobson et al., 2002b) (Manoli & Venditti, 2011). Similar to p.A135T,
this variant is found in combination with a heterozygous mutation at an invariant
arginine residue, (R191Q) in this sample.
C132R
The p.C132R substitution is predicted to be a benign variant by several prediction
software programs (Adzhubei et al., 2010; Li, Krishnan, Mort, Xin, Kamati,
Cooper, … and Radivojac, 2009; Ng & Henikoff, 2001) even though it is
immediately adjacent to the “damaging” substituion, p.S133F, and also found in
same set of ordered residues as the previously described p.A135T. While the
p.C132R amino acid is non-conserved (Kent et al., 2002), the nearby p.A135T
amino acid is also a non-conserved position and was considered to be pathogenic
(Dobson et al., 2002b; Schubert & Hill, 2006). The amino acid substitution
results in a significant amino change. It replaces a nucleophilic cysteine amino
acid to arginine, a basic amino, and eliminates a very reactive sulfhydrl group
during the process. The strongest indication that this variant should be further
evaluated for pathogenicity is the observation that was found in a clinically
affected patient in whom only one known causal mutation for a cblB disorder
was identified.
75
7.3.2 A summary of the four patients with a single heterozygous variant
Clincial Summary
WG3546
Patient WG3546 presented with acute seizures at two months of age and was
treated for gastroduodnum reflux at three months of age. She was born to healthy
non-consanguineous parents with no family history of metabolic disorders, and
has a healthy sibling. The referral form describes her ethnicity as white but also
notes a Spanish / Italian heritage. MMA levels of 172 and 300 ng/ml in blood
were reduced to 27 ng/ml after OHCbl injections. The results from somatic cell
results were all within the normal range (see Table 10) preventing
complementation studies. HRMA scanning revealed variants in exons 1 and 7.
Sequencing confirmed the variants to be the p.R191Q mutation in exon 7.and a
homozygous substitution for the common polymorphism p.R19Q in exon 1.
WG3759
Patient WG3759 presented with developmental delay, hypotonia and a history of
seizures. He is East Indian, has an unaffected sister and non-consanguineous
parents with a healthy family history. He had normal serum vitamin B12 and
homocysteine, but a “mild” elevation in MMA. Somatic cell testing was repeated
due to a questionable result for synthesis of AdoCbl, but on repeat it was found to
be in the control range (see Table 10). No inborn error of metabolism was
detected. HRMA scanning revealed variants in exons 7 and 9. Sequencing
76
confirmed the presence of a novel variant p.S174L in exon 7, an active site of the
MMAB gene, and a heterozygous polymorphism in exon 9, p.M239K.
WG4029
Patient WG4029 was a one year old African American female being evaluated for
an elevation in glutaric acid. Clinical notes indicate she is developmentally
delayed, has a heart murmur and maculopathy. Results from somatic cell testing
were all within the reference range (see Table 10) and consequently no inborn
error of Cbl metabolism could be diagnosed. Scanning with HRMA revealed
three variants, a novel missense change in exon 2, p.T62M, and a synonymous
change, p.I96I both in exon 2 as well as a heterozygous variant for the common
polymorphism, p.19Q, in exon 1.
WG4090
Patient WG4090 is a white female, unique to this cohort due to her age of 28
years. Her mother died at the early age of 36, and she also has a deceased brother.
She has bilateral hearing loss and a “low” vitamin B12 level with a slight response
to supplementation. All somatic cell studies were within the normal range and no
diagnosis could be provided. Scanning HRMA revealed two variants. A missense
mutation, p.191Q, in exon 7 that is predicted to be pathogenic, and a
homozygous variant for the common polymorphism, p.M239K, in exon 9.
77
Characterization of variants identified
T62M
The novel variant p.T62M is immediately adjacent to two amino acids, p.G63 and
p.D64, known to play a structural role in trimer formation. The amino acid
change replaces a small nucleophilic amino acid with a sulfur containing
hydrophobic residue. The T62M change is located at a highly conserved position
and is predicted to be probably damaging using in silico software prediction.
The p.T62M substitution is found in conjunction with an I96I synonymous
variant located in the 1 helix. A non-synonymous substitution at this amino acid
position, p.I96T, is found to disrupt the stability of the structure and binding of the
substrates without affecting trimer structure (Jorge-Finnigan, Aguado, SanchezAlcudia, Abia, Richard, Merinero, … and Perez, 2010). While it would not be
expected that the synonymous substitution would have an impact, the I96I
substitution has been observed in four of 181 samples.
S174L
The S174L missense variant changes the nucleophilic amino acid serine to leucine
a hydrophobic amino acid. The change occurs near the enzyme active site and
may affect enzyme function. This is the fourth example of a missense
substitution in this small group of five variants (others p.C132R, p.S133F and p.
T62M) which eliminates a nucleophilic amino acid. There are several enzymatic
mechanisms by which catalysis proceeds. Covalent catalysis requires the
presence of a nucleophile in the active site, which facilitates the reaction by
transiently binding to the substrate. The S174L substitution creates the loss of a
78
hydroxo group, which can serve as a nucleophile in enzyme active sites, and may
impact the catalytic ability of the enzyme.
7.3.3 Detection of additional variants
HRMA will detect any variant located between the forward and reverse primers.
The sensitivity (100%) and specificity (>99%) demonstrated during the validation
phase of development (see Table 6) indicates that all variants present in the exonic
regions and splice site regions should have been detected.
A summary of eight additional variants, considered to be non-pathogenic was
identified during the course of this study (three exonic and five intronic) and is
presented in Table 11. Of the eight variants found, five have been documented in
the dbSNP database (Sherry et al., 2001), but no information was available on the
remaining three. The two common variants, p.R19Q and p.M239K, are described
as normal allelic variants (Manoli & Venditti, 2011). No reports were found in
the literature to suggest the p.I96I synonymous variant was pathogenic. All
intronic variants are well outside the splice area and are likely to be benign.
The majority, 87.3% of samples (158/181), contain at least one variant (see
Appendix IV). The most frequently observed variants are the result of two
common polymorphisms c.716 T>A (p.M239K) and c.56_57 GC>AA (p.R19Q).
The p.M239K polymorphism, (rs9353) was found in 153 of 181 samples (84.5%)
with the distribution being 15.6% wild type, 56.6% heterozygous and 27.8 %
homozygous for the minor allele. The p.R19Q polymorphism (rs10774775 and
rs10774774 / combined rs36013132) was found in 93 of 181 samples (51.4%)
79
Table 11 Detection of Non-causal variants
Variant
# of samples
identified
Location
ID#
Expected frequency
Type
Exonic
c.56_57 GC>AA
p.R19Q
c.288 T>C
p.I96I
c.716 T>A
p.M239K
74 Heterozygous
Exon 1
16 Homozygous
Minor Allele
4
102 Heterozygous
Exon 3
Exon 9
50 Homozygous
Minor Allele
rs10774774
(MAF 0.307)
Missense
rs62000414
(MAF 0.30)
Synonymous
rs9593
(MAF 0.402)
Missense
Intronic
c.1-17 T>C
1
c.135-24 T>C
14
IVS1
c.349 -17 T>C
5
IVS4
c.584+24 A>G
IVS8-173 G>A
28 Heterozygous
IVS 7
4 Homozygous
Minor allele
IVS 7
1
IVS8
rs66580225
(MAF 0.0521)
rs78599682
(MAF 0.048)
Detection of intronic variants outside the splice sites regions (± 15bp)
were incidental findings based on primer placement.
with a distribution of 50% wild type, 41.1% heterozygous and 8.9% homozygous
for the minor allele.
7.4 High Resolution Melting Analysis (HRMA) as a clinical tool
Scanning HRMA for patients with isolated MMA has proven to be a valuable tool
in the identification of mutations in atypical cblB patients. It has been
80
demonstrated that the current diagnostic protocol at the Medical Genetics
Laboratory (MUHC) using somatic cell studies has been unable to identify two
patients with isolated MMA. While these functional somatic cell studies are able
to diagnose patients with severe reductions in the level of propionate
incorporation, there are limitations in evaluating patients who present with less
severe phenotypes. In addition, somatic cell studies require time consuming
protocols involving multiple manipulations. In contrast, HRMA was able to
correctly and efficiently identify all known mutations previously reported in our
laboratory and also identify a total of eight additional variants in six patients with
isolated MMA. These variants are either documented in the literature to be
pathogenic (p.R191Q and S174L) or predicted to be pathogenic for the reasons
discussed in sections 7.3.1 and 7.3.2.
The design of an HRMA scanning assay for MMAB required extensive
optimization, but once validated, the assay is able to quickly and inexpensively
identify sequence variants with minimal sample manipulation. After gDNA is
extracted, a scanning HRMA assay for each amplicon can be run and analyzed
within a single working day. MMAB has multiple exons that may be amplified
under common conditions, which allows amplicons to be run concurrently and
further reduces the time required to evaluate the entire gene. Variant confirmation
has been conducted by Sanger sequencing to date, requiring a total turn around
time projection of 10 – 14 days for testing and confirmation. Diagnosis by a
private sequencing based diagnostic lab, GeneDx, Inc. (Gaithersburgh, MD, USA)
81
quotes a turn around time of four weeks to complete their sequence based
approach.
As an added benefit to the diagnostic process, HRMA effectively pre-screens all
samples and identifies exons containing variants. Exons without variants do not
need additional evaluation allowing the focus to be directed to positive samples.
With the increased number of samples arriving at diagnostic labs due to positive
newborn screening results, both time and cost saving are critical to prevent
overburdening diagnostic laboratories.
The ability of the assay to detect both heterozygous and homozygous mutations
was well documented through the validation of the assay with our previously
characterized cblB samples. All previously identified mutations in the cblB
patients were detected in addition to the identification of four new potentially
pathogenic mutations
Sensitivity and specificity can only be calculated when the patient’s disease state
is already known. In general, a more useful clinical measure is the predictive
power of the assay, which evaluates the ability of the test to accurately predict
disease state. Predictive value depends on the sensitivity and specificity as well
as the frequency of the disease in the population. The positive predictive value
(probability that a positive test indicates a true disease state) decreases when the
prevalence of the disease in the population is low (Moran, Rivera, SanchezArago, Blazquez, Merinero, Ugalde, … and Martin, 2010) and may not be useful
when discussing HRMA.
82
CHAPTER 8: Discussion
The spectrum of variants in the MMAB gene was investigated in 181 patients with
unresolved isolated MMA using HRMA. HRMA is a technique based on
detecting the differences between the physical properties of molecular variants.
Functionally based somatic cell studies were not possible because the fibroblasts
from these patients demonstrated a basal level of [14C]-propionate incorporation
that was too high to allow for complementation analysis. Consequently, these
patients were not able to receive a diagnosis for possible intracellular errors of Cbl
metabolism. During HRMA, two samples with an atypical presentation of the
cblB type disorder were detected, and an additional four samples containing single
heterozygous mutations were identified.
8.1 Molecular findings of HRMA Positive Results
Of the 181 isolated MMA patients tested, six (3.3%) were identified to have
known mutations or potentially pathogenic variants in the MMAB gene (see Table
9 and 10). In addition, two common polymorphisms, one synonymous variant
and five intronic variants were identified (see Table 11) resulting in 158 of 181
samples (87.3%) containing at least one variant detected by HRMA scanning.
8.1.1 Characterization of exonic variants
In total eight exonic variants were discovered in six individual samples from
patients with clinical isolated MMA phenotypes.. The five missense variants
83
were evaluated for pathogenicity using mutation prediction software (Adzhubei et
al., 2010) and conservation of the variant nucleotide (Kent et al., 2002). The
results are summarized in Table 12. An additional three variants were detected
including: two normal allelic variants, p.R19Q and p.M239K, (minor allele
frequencies (MAF) of 0.301 and 0.402 respectively) (Manoli & Venditti, 2011),
and a third synonymous variant was found in exon 3, p.I96I.
Table 12 Pathogenicity of exonic variants identified by HRMA
R191Q
 of
Patients
4
C132R
1
White
Benign
0.001
Conserved to
opossum
S133F
1
White
Probably damaging
0.949
Highly
Conserved
T62M
1
African
American
Probably Damaging
1.0
Highly
conserved
S174L
1
Asiatic
Indian
Probably Damaging
1.0
Highly
conserved
Ethnicity
White
Polyphen Prediction
Conservation
Score
Probably damaging Highly
1.0
conserved
Five different exonic variants were identified in six patients with isolated
MMA. p.R191Q was found in four of six patients all described as white. Four
of five were predicted to be pathogenic and were highly conserved.
While functional assays would be needed to confirm their impact on function, the
missense changes listed above are predicted to disrupt biochemical activity of the
MMAB protein. The nature of all five amino acid substitutions was significant
and their location in the 3D structure of the trimeric protein is consistent with a
deleterious impact to the function of the gene product. Operating from the
84
premise that clinical phenotypes for Mendelian disorders are related to the
pathogenicity of variants identified, these amino acid substitutions may all be
considered as playing a possible casual role for the patients isolated MMA.
HRMA was able to identify compound heterozygous mutations in two patients,
but only a single mutation was identified by HRMA in the remaining four. These
four patients present a biochemical phenotype consistent with isolated MMA yet
only one of two mutations had been identified for this recessively inherited group
of Cbl disorders. Similar examples in which only a single heterozygous mutation
has been identified in patients with isolated MMA have been demonstrated for
other genes in the vitamin B12 pathway namely MUT (Worgan et al., 2006) and
MCEE (Gradinger et al., 2007).
8.1.2 Functional characterization of atypical cblB patients
Somatic cell data for the six samples containing the putative missense mutations
discussed above has been summarized in Tables 9 and 10. The data from the
[14C]-propionate incorporation assay and Cbl distribution study which provides an
indirect measure of AdoCbl synthesis could be useful in determining if samples
with a specific phenotype would benefit from diagnosis by HRMA. A graph of
the data for all six samples in comparison to the MUHC historical cblB reference
range is found in Figure 7.
85
Figure 7 [14C]-Propionate Incorporation of atypical cblB’s
Nmoles / mg protein
In vitro [14C]-propionate incorporation of fibroblasts from six atypical
cblB’s patients were compared to mean values for cblB (bold line
with the shaded box indicating a ± 2 SD range n=41) A normal
reference range is indicated by controls at the far right of the graph.
*Means and SD’s compiled by Dr. David Watkins
The mean [14C]-propionate incorporation value for 41 known cblB patients
diagnosed by complementation analysis was determined to be 1.3 ± 1.1
nmoles/mg of protein without OHCbl supplementation rising to 2.0 ± 2.0
nmoles/mg of protein with OHCbl supplementation. The mean
[14C]-propionate incorporation for the six atypical samples was 12.3 rising to
12.7 with OHCbl supplementation. This places the mean level of propionate
incorporation well above the accepted value of two standard deviations for
determining significance. In fact, the mean for the six atypical cblB samples fell
within ± 2 SD’s of the normal controls making them indistinguishable from
normal patients on the basis of [14C]-propionate incorporation. Figure 7
86
demonstrates why patients with atypical cblB disorders were not able to be
identified by complementation analysis.
Figure 8 Cobalamin distribution of atypical cblB samples
% of Total Cobalamin
Cbl distributions provide an indirect measure of AdoCbl synthesis
The bold line indicates the mean value of cblB fibroblasts for each Cbl
derivative form with the shaded box indicating a ± 2 SD range.
Historic means and SD’s compiled from control fibroblast cell lines by Dr.
David Watkins, Medical Genetics Laboratory, Montreal General Hospital
The synthesis of AqCbl, CNCbl and MeCbl for the six atypical cblB patients are
all within ± 2SD’s of the cblB mean value (see Figure 8). However, the synthesis
of AdoCbl lies between the mean percentage (3.1 ± 2.4%) for known cblB
patients and the mean percentage for control fibroblast lines (15.3 ± 4.2 %). The
mean of AdoCbl synthesis compared to total Cbl for all six atypical cblB samples
87
was 9.35%. While both compound heterozygous patients (WG3928 and
WG4034) have a level of AdoCbl synthesis that was closer to the cblB cohort, the
four patients with a single variant did have a significantly higher level of
synthesis. Figure 8 indicates that AdoCbl synthesis in atypical cblB fibroblasts is
significantly higher than AdoCbl synthesis of classic cblB patients. This question
arises: does an in vitro responsiveness to OHCbl translate into less severe in vivo
clinical phenotypes for atypical cblB patients?
Functional studies evaluating MMAB expression would be needed to confirm
these observations that were based on only a small number of samples. Once
verified, the observation that [14C]-propionate incorporation and AdoCbl
synthesis is significantly higher in atypical cblB patients could provide a
convenient metric to determine when HRMA of cblB patients is a more
efficacious diagnostic technique than complementation analysis.
8.2 Presentation of a clinical phenotype with a single MMAB variant
Four of five variants identified in Table 8 are predicted to be damaging and are
likely responsible for the clinical phenotypes seen in isolated MMA patients as
discussed in sections 7.3.1 and 7.3.2, outlined in Table 12 and demonstrated using
somatic cell studies in section 8.1.2. The fifth variant, p.C132R, could also be
pathogenic given its location and significant amino acid change. However, four
of the six samples identified by HRMA contain only single mutations and fall
short of the accepted standard requiring two identified mutations to diagnose a
88
recessive disorder. In order to resolve this inconsistency, it is logical to consider
that second variant affecting gene expression is located in a non-exonic location
outside of the regions scanned. Gene expression can be affected by: variants
located in non-protein coding regions including elements that regulate
transcription or intronic variants that induce alternative splicing. Alternative
splicing is post-transcriptional event that influences gene expression by creating
additional mRNA isoforms. Alternate isoforms can regulate gene expression by
changing the intronic or exonic sequences that are then translated into modified
protein products. Changes can affect protein function, activity or interactions or
create truncated proteins due to premature stop codons. In the absence of a
second undetected variant, there maybe additional modifiers that could be
responsible for influencing the clinical phenotype including: synergistic
heterozygosity, modulating polymorphisms, epigenetic modifications, or
structural features related to functional features of the MMAB gene product.
Synergistic Heterozygosity
The concept of synergistic heterozygosity suggests that the mutations discovered
in MMAB may work in cooperation with mutations with another gene in the
vitamin B12 pathway to regulate gene expression (Vockley, P, Bennett, Matern, &
Vladutiu, 2000). If synergy among genes was responsible for the clinical
phenotypes found, the MUT and/or MMAA genes(s) are the two most likely
candidates to be functional partners. The same 181 samples with unresolved
MMA tested in this study were also scanned in a separate project for MMAA
variants. Only a single heterozygous variant was found in one of 181 samples and
89
no MMAB variants were identified in that same sample indicating there is no
synergy with MMAA. These samples have not yet been screened for MUT.
While the MMAB common polymorphisms, p.R19Q and p.M239K, are not
considered to pathogenic by themselves (Manoli & Venditti, 2011), it is
interesting to consider that they may have a synergistic role.
Modulating polymorphisms
Three SNPs, all considered to be non-pathogenic, were identified in these six
samples, two non-synonymous common polymorphisms, p.R19Q and p.M239K
and a synonymous p.I96I variant. The p.I96I variant should not affect activity
and will not be discussed here except to note that another substitution at this
residue p.I96T results in misfolding of the protein (Jorge-Finnigan et al., 2010),
indicating that any change at this position could impact function.
Of higher probability is the consideration that either or both of the common
polymorphisms could impact gene expression. A synergistic role has been
demonstrated for a polymorphism in another gene associated with an inborn error
of Cbl metabolism, MSR. The function of this gene is affected by the combined
presence of a mutation and polymorphism. This opens the door for discussion
that p.M239K could similarly affect the expression of MMAB. At least one of two
common polymorphisms in the MSR product, p.I22M and p.S175L (with
frequencies of 0.51 and 0.61 respectively) impact the expression of a rare
pathogenic mutation, c.166G>A (p.V56M) (Gherasim, Rosenblatt, & Banerjee,
2007). The circumstances are similar to those associated with p.M239K in
MMAB, where both variants were demonstrated to be physiologically equivalent
90
in their ability to synthesise AdoCbl in vivo (Leal et al., 2003). The MSR study
demonstrated that both variants of the p.V56M mutation had kinetic properties
that were also physiologically in the reference range. However, when the
p.V56M mutation was present on an allele containing the common polymorphism,
p.I22M, MSR activity was reduced four to seven fold due to a proposed
weakening in interactions between MSR and MS products (Gherasim et al.,
2007). Functional assays monitoring the expression of MCM containing
pathogenic mutations, with and without the presence of the p.M239K variant,
would be needed to determine if the polymorphism may impact enzyme function.
Initial observations indicated the frequency of both MMAB polymorphisms was
noticeably higher in the cohort of 181 isolated MMA patients than the reference
group. Unsuccessful attempts were made to calculate a “p” value from the
genotype data provided by the use of the snapback primers. The data was skewed
by the use a Caucasian reference population and our reliance on sporadic reports
of ethnic background in clinical reports. Better controls would be needed before a
determination could be made.
Epigenetic modifications
The p.R19Q polymorphism is both located in the mitochondrial leader sequence
(Magrane, 2011: available from http://www.uniprot.org/uniprot/Q96EY8) and
contained in a large CpG island covering exon 1 (Kent et al., 2002). A mutation
in this region could have the ability to reduce gene expression if a disruption in
the leader sequence reduces the amount of Cbl imported into the mitochondria.
Also worth considering is that the presence of a variant could allow increased
91
levels of methylation to occur. DNA methylation, a well known epigenetic
modification, frequently occurs in the cytosines found in CpG island such as the
one noted at the 5’ end of the MMAB gene. The ability of methylation to reduce
gene expression was demonstrated to affect both the uptake of Cbl and MCM
function for another gene, MMACHC, required for the intracellular conversion of
Cbl into both AdoCbl and MeCbl (Loewy, Niles, Anastasio, Watkins, Lavoie,
Lerner-Ellis, … and Rosenblatt, 2009). Epigenetic changes could also affect the
p.M239K polymorphism and be responsible for gene suppression at the protein
level. While several post translational epigenetic changes are possible, arginine
and lysine residues are known to be susceptible to protein methylation which in
turn reduces enzyme activity (Smith & Denu, 2009) The p.M239K substitution
may be a benign change at the molecular level, but it is worth considering its
functional impact on the MMAB protein. Assays to evaluate the methylation
status of both polymorphisms in affected patients would be useful in determining
they affect function.
Structural features
Unique structural features of the MMAB gene may also allow a single
heterozygous variant to contribute to a disease phenotype. The characterization of
the p.191Q, p.T62M and p.S174L variants indicate that these variants are
pathogenic, and they have been identified as a heterozygous variant in clinically
affected patients. It is possible that a single pathogenic allele may interfere with
the function of a separate wild type allele especially if the functional gene product
needs to form a multimer to ensure normal function. The MMAB gene product
92
functions as a trimer creating active sites between the interfaces of the interacting
monomer subunits. A mutation in one subunit could impact overall function. In
patients with a single heterozygous mutation, one half of the alleles will be
affected. Since there are three subunits in the final gene product, the effect is
magnified three-fold ( ½ x ½ x ½ ). The cumulative result is that only 1/8 of
the total trimers contain three wild type monomers. If the enzyme function were
reliant on a monomeric protein product, a 50% ( ½ X) reduction of enzyme
activity would be insufficient to create a clinical phenotype. However the
enzyme function associated with a trimeric gene product such as MMAB would
be projected to have a 12.5% ( 1/8 ) of the total enzyme activity increasing the
probability it would be pathogenic.
The identification of MMAB variants in patients who remained undiagnosed after
somatic cell studies, demonstrates the usefulness of HRMA as a clinical
technique. Investigation of the variants identified may also provide a clearer
understanding of intracellular errors of cobalamin metabolism.
Summary and Conclusion
The spectrum of variants in the MMAB gene was investigated in 181 patients with
unresolved isolated MMA by HRMA. HRMA detected exonic variants in a total
of six samples. Compound heterozygous variants were identified in two of six
samples. The p.R191Q missense change, shared by both patients, is known to be
pathogenic. The second variant in each patient results in a significant amino acid
93
change, is located at an active site and is likely to be causal. Samples from the
remaining four clinically affected patients contained single variants that were
predicted to be pathogenic. This suggests the existence of additional molecular
defects in MMAB gene outside the coding region or non-molecular factors that
contribute to the cblB disease state.
An infrequent but distinct atypical cblB class of intracellular disorders of
cobalamin metabolism has been identified and can be detected using HRMA.
The HRMA technique is well suited to provide fast and accurate clinical results.
A scanning HRMA assay allows the concurrent analysis of a large number of
samples concurrently making it possible to uncover unrecognized molecular
patterns that may add to the understanding of metabolic disease mechanisms.
94
APPENDIX I
SPECTRUM OF KNOWN MUTATION ANDS PUTATIVE FUNCTIONS
Variant
Protein
change
Function
c.56_57delGCinsAA
p.R19Q
Mitochondrial leader sequence
c.197-1G>T
c.287T>C (Martínez)
p.I96T
c.290 G>A+
p.G97E
Improper slicing affects the last base of exon 3
Invariant residue – disrupt 3/4 loop in active site
c.403G>A *
p.I117_Q118
del
p.A135T
Non-conserved
c.454 G>T
p. E152X
c.521 C>T+
p.S174L
c.539C>G+
p.S180W
c.556C>T *
p. R186W
c.557 G>A
p.R186Q
c.291-1G>A*
c. 349-1 G>C $
c.558_559 del GGinsC
c.563_577 dupTGTGC
CGCCGGGCCG+
Replace conserved residues in region of active site
Invariant residue – disrupt 3/4 loop in active site
Replace conserved residues in region of active site
Nonconserved by Schubert
Invariant arginine residue in putative active site
No interaction with ATP but cobalamin?
Invariant arginine residue in putative active site
No interaction with ATP but cobalamin?
Pospisilova
p186_190dup
Insertion of 5 amino acids within the active site
c.567_571
dupCCGCC+
p.R191PfsX25
c.568C>T *
p.R190C
c.569G>A*
p.R190H
c.571C>T *
p.R191W
Truncated protein lacking part of the putative enzyme
active site
Invariant arginine residue in putative active site
Forms H bonds with ATP
Invariant arginine residue in putative active site
Forms H bonds with ATP
Invariant residue affecting trimer interface
c.572G>A *
p.R191Q
Invariant arginine residue in putative active site
c.575 G>A
p.E193K
Invariant residue – Hydrogen bonds
Alternate splicing at beginning of exon 8
c.585-2 A>C+
c.656A>G *
p.Y219C
c.656_659 del +
p. Y219fsX4
c.700C>T *
p.Q234X
c.716T>A*
p.M239K
Nonconseved
Stop codon creates instability of truncated protein
Invariant residue – disrupt 3/4 loop in active site
References for further information on mutations
* (Manoli & Venditti, 2011)
 (C. M. Dobson et al., 2002)
+ (Lerner-Ellis et al., 2006)
 (Schubert & Hill, 2006)
95
APPENDIX II
REPRESENTATIVE MELTING EXPERIMENT
EXON 5 MMAB
UNKNOWN SAMPLES
WG3948
Index case for study
c.398 C>T p.S133F
Melting Curves
Difference Curves
WG4086 / WG4010
Intronic Variant
c.349-17 T>C
WG4034
2nd Compound Heterozygous Patient
c.394 T>C / p.C132R
Analysis using Light Scanner® Call-IT software (Idaho Technologies, Inc.)
Top pane - Raw data is presented as melting curve.
Bottom pane – The derivative curve is plotted after background fluorescence was
subtracted and raw data normalized.
The grey cluster contains 91 wild type samples. Also present are two samples
containing intronic variants (red cluster), one sample with a p.S133F missense change
tested in duplicate (blue sample) and one sample with a p.C132R missense change
(green sample).
96
APPENDIX III
Results for Assay Validation (cblB knowns)
WG #
Identified
by HRMA
1st Mutation
Identified
by HRMA
2nd Mutation
Notes
Polymorphisms
p.R19Q p.M239K
Patients with 2 mutations identified
Homozygous
117
c.700 C>T
c.700 C>T
√
√
1185
c.556 C>T
c.556 C>T
√
√
1493
c.556 C>T
c.556 C>T
√
√
1586
c.556 C>T
c.556 C>T
1641
c.700 C>T
c.700 C>T
√
√
1771
c.556 C>T
c.556 C>T
√
√
1792
c.556 C>T
c.556 C>T
√
√
2147
c.577 ins 9
c.577 ins 9
√
√
2186
c.556 C>T
c.556 C>T
√
√
2235
c.521 C>T
c.521 C>T
2350
c.291-1 G>A
c.291-1 G>A
2816
c.197-1 G>T
c.197-1 G>T
√
√
2846
c.556 C>T
c.556 C>T
√
√
3117
c.556 C>T
c.556 C>T
√
√
3176
c.197-1 G>T
c.197-1 G>T
√
√
3224
C.571 INS 4
C.571 INS 4
√
√
3230
c.585-2 A>C
c.585-2 A>C
√
√
3274
c.557 G>A
c.557 G>A
√
√
3293
c.197-1 G>T
c.197-1 G>T
√
√
3296
C.569 G>A
C.569 G>A
√
√
3522
C.563_77
C.563_77
√
√
Compound
Heterozygous
1879
C.569 G>A
c.556 C>T
√
√
2027
c.291-1 G>A
c.556 C>T
√
√
2127
C.654_7 del 3
c.700 C>T
√
√
2268
c.585-2 A>C
c.556 C>T
√
√
2345
c.700 C>T
c.556 C>T
2488
c.571 C>T
c.656 G>A
√
√
2492
c.571 C>T
c.700 C>T
√
√
2523
c.197-1 G>T
c.557 G>A
√
√
2545
c.290 G>A
c.394 C>T
√
√
2633
C.572_6 del6
c.556 C>T
√
2776
c.700 C>T
c.556 C>T
√
√
2779
c.572 G>A
c.556 C>T
√
√
2980
c.539 C>G
c.568 C>T
√
√
3185
c.290 G>A
c.568 C>T
√
√
3332
c.291-1 G>A
c.700 C>T
√
√
Patient with 1 mutation identified
c.700 C>T
1680
c.571 C >T
√
√
3574
c.556 C>T
none
3979
c.556 C>T
√
√
c.12 C>A p.C4X
Patients with NO mutations identified
3430
c.569 G >A
none
3826
c.291-1 G>A
c.571 C >T
4070
c.291-1 G>A
none
Repeat Sample
3982
c.291-1 G>A
c.556 C>T
√
√
Patients of Interest
1997
none
none
4138
none
none
Controls
24
none
none
39
none
none
64
none
none
none
√ Indicates HRMA identified known mutation
cates previously undiscovered muta
HOM
het
HOM
HOM
het
HOM
Clerical Error
Sample Switch
HOM
het
HOM
het
het
het
het
het
het
HOM
HOM
het
het
het
het
het
het
het
Sample Switch
√ c.403 G>A
Sibling of 2487
√ c.403 G>A
het
het
het
het
het
HOM
het
het
het
het
=WG2027
het
het
het
Distribution of
Polymorphisms
30 WT 19 WT
12 het 15 het
0 HOM 8 HOM
97
APPENDIX IV
Variants identified in unresolved MMA Patients (1 of 3)
98
Variants identified in unresolved MMA Patients (2 of 3)
99
Variants identified in unresolved MMA Patients (3 of 3)
100
LIST OF REFERENCES
Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., . . .
Sunyaev, S. R. (2010). A method and server for predicting damaging missense
mutations. Nat Methods, 7(4), 248-249. doi: 10.1038/nmeth0410-248
Banerjee, R., (1999). Methylmalonyl Co-A mutase. In R. Banerjee (Ed.), Chemistry and
Biochemistry of B12 (pp. 707 -729). New York: John Wiley and Sons, Inc.
Bobik, T. A., & Rasche, M. E. (2004). Purification and partial characterization of the
Pyrococcus horikoshii methylmalonyl-CoA epimerase. Appl Microbiol
Biotechnol, 63(6), 682-685. doi: 10.1007/s00253-003-1474-5
Carrillo-Carrasco, N., Chandler, R. J., & Venditti, C. P. (2012). Combined
methylmalonic acidemia and homocystinuria, cblC type. I. Clinical presentations,
diagnosis and management. J Inherit Metab Dis, 35(1), 91-102. doi:
10.1007/s10545-011-9364-y
Carrozzo, R., Piemonte, F., Tessa, A., Lucioli, S., Rizza, T., Meschini, M. C., . . .
Santorelli, F. M. (2007). Infantile mitochondrial disorders. Biosci Rep, 27(1-3),
105-112. doi: 10.1007/s10540-007-9039-y
Chandler, R. J., Zerfas, P. M., Shanske, S., Sloan, J., Hoffmann, V., DiMauro, S., &
Venditti, C. P. (2009). Mitochondrial dysfunction in mut methylmalonic
acidemia. FASEB J, 23(4), 1252-1261. doi: 10.1096/fj.08-121848
Cosson, M. A., Benoist, J. F., Touati, G., Dechaux, M., Royer, N., Grandin, L., . . . de
Lonlay, P. (2009). Long-term outcome in methylmalonic aciduria: a series of 30
French patients. Mol Genet Metab, 97(3), 172-178. doi:
10.1016/j.ymgme.2009.03.006
Dobson, C. M., Wai, T., Leclerc, D., Wilson, A., Wu, X., Dore, C., . . . Gravel, R. A.
(2002a). Identification of the gene resposible for the cblA complementation
groups of vitamin B12-responsive methylmaloinc acidemia beased on the analysis
of prokaryotic gene arrangements. Proceedings of the National Acadmeny of
Sciences US, 99(24), 15554-15559.
Dobson, C. M., Wai, T., Leclerc, D., Kadir, H., Narang, M., Lerner-Ellis, J. P., . . .
Gravel, R. A. (2002b). Identification of the gene responsible for the cblB
complementation group of vitamin B12-dependent methylmalonic aciduria. Hum
Mol Genet, 11(26), 3361-3369.
Duane, W. C., Levitt, D. G., Mueller, S. M., & Behrens, J. C. (1983). Regulation of bile
acid synthesis in man. Presence of a diurnal rhythm. J Clin Invest, 72(6), 19301936. doi: 10.1172/jci111157
Durand, P., Prost, M., Loreau, N., Lussier-Cacan, S., & Blache, D. (2001). Impaired
homocysteine metabolism and atherothrombotic disease. Lab Invest, 81(5), 645672.
Dwight, Z., Palais, R., & Wittwer, C. T. (2011). uMELT: prediction of high-resolution
melting curves and dynamic melting profiles of PCR products in a rich web
application. Bioinformatics, 27(7), 1019-1020. doi: 10.1093/bioinformatics/btr065
101
Fenton, W. A., & Rosenberg, L. E. (1981). The defect in the cblB class of human
methylmalonic acidemia: deficiency of cob(I)alamin adenosyltransferase activity
in extracts of cultured fibroblasts. Biochem Biophys Res Commun, 98(1), 283-289.
Fons, C., Sempere, A., Sanmarti, F. X., Arias, A., Poo, P., Pineda, M., . . . Campistol, J.
(2009). Epilepsy spectrum in cerebral creatine transporter deficiency. Epilepsia,
50(9), 2168-2170. doi: 10.1111/j.1528-1167.2009.02142.x
Fowler, B., Leonard, J. V., & Baumgartner, M. R. (2008). Causes of and diagnostic
approach to methylmalonic acidurias. J Inherit Metab Dis, 31(3), 350-360. doi:
10.1007/s10545-008-0839-4
Froese, D. S., & Gravel, R. A. (2010). Genetic disorders of vitamin B12 metabolism: eight
complementation groups--eight genes. Expert Rev Mol Med, 12, e37. doi:
10.1017/s1462399410001651
Froese, D. S., Krojer, T., Wu, X., Shrestha, R., Kiyani, W., von Delft, F., . . . Yue, W. W.
(2012). Structure of MMACHC reveals an arginine-rich pocket and a domainswapped dimer for its B12 processing function. Biochemistry. doi:
10.1021/bi300150y
Gherasim, C., Rosenblatt, D. S., & Banerjee, R. (2007). Polymorphic background of
methionine synthase reductase modulates the phenotype of a disease-causing
mutation. Hum Mutat, 28(10), 1028-1033. doi: 10.1002/humu.20563
Gradinger, A., Belair, C., Worgan, L., Li, C. D., Lavallee, J., Roquis, D., . . . Rosenblatt,
D. S. (Producer). (2007). Atypical Methylmalonic Aciduria: Frequency of
Mutations in the Methylmalonyl CoA Epimerase Gene (MCEE). Mutation in
Brief.
Gravel, R. A., Mahoney, M. J., Ruddle, F. H., & Rosenberg, L. E. (1975). Genetic
complementation in heterokaryons of human fibroblasts defective in cobalamin
metabolism. Proceedings of the National Acadmeny of Sciences USA, 72(8),
3181-3185.
Gulati, S., Baker, P., Li, Y. N., Fowler, B., Kruger, W., Brody, L. C., & Banerjee, R.
(1996). Defects in human methionine synthase in cblG patients. Hum Mol Genet,
5(12), 1859-1865.
Hannibal, L., Axhemi, A., Glushchenko, A. V., Moreira, E. S., Brasch, N. E., &
Jacobsen, D. W. (2008). Accurate assessment and identification of naturally
occurring cellular cobalamins. Clin Chem Lab Med, 46(12), 1739-1746. doi:
10.1515/cclm.2008.356
Hoffbrand, A. V., & Jackson, B. F. (1993). Correction of the DNA synthesis defect in
vitamin B12 deficiency by tetrahydrofolate: evidence in favour of the methylfolate trap hypothesis as the cause of megaloblastic anaemia in vitamin B12
deficiency. Br J Haematol, 83(4), 643-647.
Hogenkamp, H. P. C. (1999). B12: 1948-1998 In R. Banerjee (Ed.), Chemistry and
Biochemistry of B12 (pp. 3-8). New York: John Wiley and Sons, Inc.
Horster, F., Baumgartner, M. R., Viardot, C., Suormala, T., Burgard, P., Fowler, B., . . .
Baumgartner, E. R. (2007). Long-term outcome in methylmalonic acidurias is
influenced by the underlying defect (mut0, mut-, cblA, cblB). Pediatr Res, 62(2),
225-230. doi: 10.1203/PDR.0b013e3180a0325f
Huang, Q., August 2009). [Assistant Professor Xiamen Univerity].
102
Jorge-Finnigan, A., Aguado, C., Sanchez-Alcudia, R., Abia, D., Richard, E., Merinero,
B., . . . Perez, B. (2010). Functional and structural analysis of five mutations
identified in methylmalonic aciduria cblB type. [Research Support, N.I.H.,
Extramural
Research Support, Non-U.S. Gov't]. Hum Mutat, 31(9), 1033-1042. doi:
10.1002/humu.21307
Kent, W. J., Sugnet, C. W., Furey, T. S., Roskin, K. M., Pringle, T. H., Zahler, A. M., &
Haussler, D. (2002). The human genome browser at UCSC. Genome Res, 12(6),
996-1006. doi: 10.1101/gr.229102. Article published online before print in May
2002
Kibbe, W. A. (2007). OligoCalc: an online oligonucleotide properties calculator. Nucleic
Acids Res, 35(Web Server issue), W43-46. doi: 10.1093/nar/gkm234
Kim, J., Gherasim, C., & Banerjee, R. (2008). Decyanation of vitamin B12 by a
trafficking chaperone. Proc Natl Acad Sci U S A, 105(38), 14551-14554. doi:
0805989105 [pii]
10.1073/pnas.0805989105
Kim, J., Hannibal, L., Gherasim, C., Jacobsen, D. W., & Banerjee, R. (2009). A human
vitamin B12 trafficking protein uses glutathione transferase activity for processing
alkylcobalamins. J Biol Chem, 284(48), 33418-33424. doi:
10.1074/jbc.M109.057877
Kim, J. C., Coelho, D., Miousse, I., Fung, S., Moulin, M. d., Buers, I., . . . Rosenlatt, D.
S. (2011). Novel inborn error pf vitamin B12 metabolism caused by mutations in
ABCD4. Paper presented at the 12th International Congress of Human Genetics,
Montreal, Quebec.
Kwon, C., & Farrell, P. M. (2000). The magnitude and challenge of false-positive
newborn screening test results. Arch Pediatr Adolesc Med, 154(7), 714-718.
Leal, N. A., Park, S. D., Kima, P. E., & Bobik, T. A. (2003). Identification of the human
and bovine ATP:Cob(I)alamin adenosyltransferase cDNAs based on
complementation of a bacterial mutant. J Biol Chem, 278(11), 9227-9234. doi:
10.1074/jbc.M212739200
Leclerc, D., Campeau, E., Goyette, P., Adjalla, C. E., Christensen, B., Ross, M., . . .
Gravel, R. A. (1996). Human methionine synthase: cDNA cloning and
identification of mutations in patients of the cblG complementation group of
folate/cobalamin disorders. Hum Mol Genet, 5(12), 1867-1874. doi: 6w0265 [pii]
Leclerc, D., Wilson, A., Dumas, R., Gafuik, C., Song, D., Watkins, D., . . . Gravel, R. A.
(1998). Cloning and mapping of a cDNA for methionine synthase reductase, a
flavoprotein defective in patients with homocystinuria. Proc Natl Acad Sci U S A,
95(6), 3059-3064.
Lerner-Ellis, J. P., Anastasio, N., Liu, J., Coelho, D., Suormala, T., Stucki, M., . . .
Fowler, B. (2009). Spectrum of mutations in MMACHC, allelic expression, and
evidence for genotype-phenotype correlations. Hum Mutat, 30(7), 1072-1081. doi:
10.1002/humu.21001
Lerner-Ellis, J. P., Gradinger, A. B., Watkins, D., Tirone, J. C., Villeneuve, A., Dobson,
C. M., . . . Rosenblatt, D. S. (2006). Mutation and biochemical analysis of patients
belonging to the cblB complementation class of vitamin B12-dependent
103
methylmalonic aciduria. Mol Genet Metab, 87(3), 219-225. doi:
10.1016/j.ymgme.2005.11.011
Li, B., Krishnan, V. G., Mort, M. E., Xin, F., Kamati, K. K., Cooper, D. N., . . .
Radivojac, P. (2009). Automated inference of molecular mechanisms of disease
from amino acid substitutions. Bioinformatics, 25(21), 2744-2750. doi:
10.1093/bioinformatics/btp528
Li, Y. N., Gulati, S., Baker, P. J., Brody, L. C., Banerjee, R., & Kruger, W. D. (1996).
Cloning, mapping and RNA analysis of the human methionine synthase gene.
Hum Mol Genet, 5(12), 1851-1858.
Liew, M., Pryor, R., Palais, R., Meadows, C., Erali, M., Lyon, E., & Wittwer, C. (2004).
Genotyping of single-nucleotide polymorphisms by high-resolution melting of
small amplicons. Clin Chem, 50(7), 1156-1164. doi:
10.1373/clinchem.2004.032136
Loewy, A. D., Niles, K. M., Anastasio, N., Watkins, D., Lavoie, J., Lerner-Ellis, J. P., . . .
Rosenblatt, D. S. (2009). Epigenetic modification of the gene for the vitamin B12
chaperone MMACHC can result in increased tumorigenicity and methionine
dependence. Mol Genet Metab, 96(4), 261-267. doi:
10.1016/j.ymgme.2008.12.011
Lofgren, M., & Banerjee, R. (2011). Loss of allostery and coenzyme B12 delivery by a
pathogenic mutation in adenosyltransferase. Biochemistry, 50(25), 5790-5798.
doi: 10.1021/bi2006306
Mahoney, M. J., Hart, A. C., Steen, V. D., & Rosenberg, L. E. (1975).
Methylmalonicacidemia: biochemical heterogeneity in defects of
5'-deoxyadenosylcobalamin synthesis. Proc Natl Acad Sci U S A, 72(7), 27992803.
Manoli, I., & Venditti, C. P. (2011). Methylmalonic Acidemia. In R. A. Pagon, T. D.
Bird, C. R. Dolan & K. Stephens (Eds.), GeneReviews. Seattle WA: University of
Washington, Seattle.
Magrane, M., Uniprot Consortium. (2011). Uniprot Knowledgebase: a hub of integrated
protein knowledge. Database, Vol 2011, Article bar009,
doi:10.1093/database/bar009.
Matsui, S. M., Mahoney, M. J., & Rosenberg, L. E. (1983). The natural history of the
inherited methylmalonic acidemias. N Engl J Med, 308(15), 857-861. doi:
10.1056/nejm198304143081501
Merinero, B., Perez, B., Perez-Cerda, C., Rincon, A., Desviat, L. R., Martinez, M. A., . . .
Ugarte, M. (2008). Methylmalonic acidaemia: examination of genotype and
biochemical data in 32 patients belonging to mut, cblA or cblB complementation
group. J Inherit Metab Dis, 31(1), 55-66. doi: 10.1007/s10545-007-0667-y
Moran, M., Rivera, H., Sanchez-Arago, M., Blazquez, A., Merinero, B., Ugalde, C., . . .
Martin, M. A. (2010). Mitochondrial bioenergetics and dynamics interplay in
complex I-deficient fibroblasts. Biochim Biophys Acta, 1802(5), 443-453. doi:
10.1016/j.bbadis.2010.02.001
Morkbak, A. L., Poulsen, S. S., & Nexo, E. (2007). Haptocorrin in humans. Clin Chem
Lab Med, 45(12), 1751-1759. doi: 10.1515/cclm.2007.343
104
Navarro-Sastre, A., Tort, F., Stehling, O., Uzarska, M. A., Arranz, J. A., Del Toro, M., ...
Lill, R. (2011). A fatal mitochondrial disease is associated with defective NFU1
function in the maturation of a subset of mitochondrial Fe-S proteins. Am J Hum
Genet, 89(5), 656-667. doi: 10.1016/j.ajhg.2011.10.005
Need, A. C., Shashi, V., Hitomi, Y., Schoch, K., Shianna, K. V., McDonald, M. T., . . .
Goldstein, D. B. (2012). Clinical application of exome sequencing in undiagnosed
genetic conditions. J Med Genet. doi: 10.1136/jmedgenet-2012-100819
Ng, P. C., & Henikoff, S. (2001). Predicting deleterious amino acid substitutions.
Genome Res, 11(5), 863-874. doi: 10.1101/gr.176601
Nicolaides, P., Leonard, J., & Surtees, R. (1998). Neurological outcome of
methylmalonic acidaemia. Arch Dis Child, 78(6), 508-512.
Nollau, P., & Wagener, C. (1997). Methods for detection of point mutations: performance
and quality assessment. IFCC Scientific Division, Committee on Molecular
Biology Techniques. Clin Chem, 43(7), 1114-1128.
Oberholzer, V. G., Levin, B., Burgess, E. A., & Young, W. F. (1967). Methylmalonic
aciduria. An inborn error of metabolism leading to chronic metabolic acidosis.
Arch Dis Child, 42(225), 492-504.
Okuda, K. (1999). Discovery of vitamin B12 in the liver and its absorption factor in the
stomach: a historical review. J Gastroenterol Hepatol, 14(4), 301-308.
Ostergaard, E. (1993). SUCLA2-Related Mitochondrial DNA Depletion Syndrome,
Encephalomyopathic Form, with Mild Methylmalonic Aciduria. In R. A. Pagon,
T. D. Bird, C. R. Dolan, K. Stephens & M. P. Adam (Eds.), GeneReviews. Seattle
WA: University of Washington, Seattle.
Padovani, D., & Banerjee, R. (2009). A rotary mechanism for coenzyme B12 synthesis by
adenosyltransferase. Biochemistry, 48(23), 5350-5357. doi: 10.1021/bi900454s
Padovani, D., Labunska, T., Palfey, B. A., Ballou, D. P., & Banerjee, R. (2008).
Adenosyltransferase tailors and delivers coenzyme B12. Nat Chem Biol, 4(3), 194196. doi: 10.1038/nchembio.67
Palais, R., & Wittwer, C. T. (2009). Mathematical algorithms for high-resolution DNA
melting analysis. Methods Enzymol, 454, 323-343. doi: 10.1016/s00766879(08)03813-5
Palais, R. A., Liew, M. A., & Wittwer, C. T. (2005). Quantitative heteroduplex analysis
for single nucleotide polymorhpism genotyping. Analytical Biochemistry, 346(1),
167-175.
Perez, B., Angaroni, C., Sanchez-Alcudia, R., Merinero, B., Perez-Cerda, C., Specola, N.,
. . . Ugarte, M. (2010). The molecular landscape of propionic acidemia and
methylmalonic aciduria in Latin America. J Inherit Metab Dis, 33(Suppl 2),
S307-314. doi: 10.1007/s10545-010-9116-4
Perez-Duenas, B., Sempere, A., Campistol, J., Alonso-Colmenero, I., Diez, M., Gonzalez,
V., . . . Artuch, R. (2011). Novel features in the evolution of adenylosuccinate
lyase deficiency. Eur J Paediatr Neurol. doi: 10.1016/j.ejpn.2011.08.008
Plesa, M., Kim, J., Paquette, S. G., Gagnon, H., Ng-Thow-Hing, C., Gibbs, B. F., . . .
Coulton, J. W. (2011). Interaction between MMACHC and MMADHC, two human
proteins participating in intracellular vitamin B metabolism. Mol Genet Metab,
102(2), 139-148. doi: 10.1016/j.ymgme.2010.10.011
105
Pratt, J. M. (1999). The Roles of Co,Corrin and Protein. I. The Roles of Co, Corrin, and
Protein. In R. Banerjee (Ed.), Chemistry and Biochemistry of B12 (pp. 73 - 112).
New York: John Wiley and Sons, Inc.
Quadros, E. V., Lai, S. C., Nakayama, Y., Sequeira, J. M., Hannibal, L., Wang, S., . . .
Rosenblatt, D. S. (2010). Positive newborn screen for methylmalonic aciduria
identifies the first mutation in TCblR/CD320, the gene for cellular uptake of
transcobalamin-bound vitamin B(12). Hum Mutat, 31(8), 924-929. doi:
10.1002/humu.21297
Reed, G. H., Kent, J. O., & Wittwer, C. T. (2007). High-resolution DNA metling analysis
for simple and efficient molecular diagnotsitcs. Pharmacogenomics.
Rivera, H., Merinero, B., Martinez-Pardo, M., Arroyo, I., Ruiz-Sala, P., Bornstein, B., . . .
Martin, M. A. (2010). Marked mitochondrial DNA depletion associated with a
novel SUCLG1 gene mutation resulting in lethal neonatal acidosis, multi-organ
failure, and interrupted aortic arch. Mitochondrion, 10(4), 362-368. doi:
10.1016/j.mito.2010.03.003
Rogan, P. K., Faux, B. M., & Schneider, T. D. (1998). Information analysis of human
splice site mutations. Hum Mutat, 12(3), 153-171. doi: 10.1002/(sici)10981004(1998)12:3<153::aid-humu3>3.0.co;2-i
Rosenblatt, D. S., Laframboise, R., Pichette, J., Langevin, P., Cooper, B. A., & Costa, T.
(1986). New disorder of vitamin B12 metabolism (cobalamin F) presenting as
methylmalonic aciduria. Pediatrics, 78(1), 51-54.
Roth, J. R., Lawrence, J. G., & Bobik, T. A. (1996). Cobalamin (coenzyme B12):
synthesis and biological significance. Annu Rev Microbiol, 50, 137-181. doi:
10.1146/annurev.micro.50.1.137
Rutsch, F., Gailus, S., Suormala, T., & Fowler, B. (2011). LMBRD1: the gene for the
cblF defect of vitamin B12 metabolism. J Inherit Metab Dis, 34(1), 121-126. doi:
10.1007/s10545-010-9083-9
Saridakis, V., Yakunin, A., Xu, X., Anandakumar, P., Pennycooke, M., Gu, J., . . .
Christendat, D. (2004). The Structural Basis for Methylmalonic Aciduria. The
Journal of Biological Chemistry, 279(22), 23646-23653.
Schubert, H. L., & Hill, C. P. (2006). Structure of ATP-bound human ATP:cobalamin
adenosyltransferase. Biochemistry, 45(51), 15188-15196. doi: 10.1021/bi061396f
Sempere, A., Arias, A., Farre, G., Garcia-Villoria, J., Rodriguez-Pombo, P., Desviat, L.
R., . . . Campistol, J. (2010). Study of inborn errors of metabolism in urine from
patients with unexplained mental retardation. J Inherit Metab Dis, 33(1), 1-7. doi:
10.1007/s10545-009-9004-y
Sherry, S. T., Ward, M. H., Kholodov, M., Baker, J., Phan, L., Smigielski, E. M., &
Sirotkin, K. (2001). dbSNP: the NCBI database of genetic variation. Nucleic
Acids Res, 29(1), 308-311.
Smith, B. C., & Denu, J. M. (2009). Chemical mechanisms of histone lysine and arginine
modifications. Biochim Biophys Acta, 1789(1), 45-57. doi:
10.1016/j.bbagrm.2008.06.005
Stokke, O., Jellum, E., Eldjarn, L., & Schnitler, R. (1973). The occurrence of betahydroxy-n-valeric acid in a patient with propionic and methylmalonic acidemia.
Clin Chim Acta, 45(4), 391-401.
106
Stucki, M., Coelho, D., Suormala, T., Burda, P., Fowler, B., & Baumgartner, M. R.
(2012). Molecular mechanisms leading to three different phenotypes in the cblD
defect of intracellular cobalamin metabolism. Hum Mol Genet, 21(6), 1410-1418.
doi: 10.1093/hmg/ddr579
Takahashi-Iniguez, T., Garcia-Arellano, H., Trujillo-Roldan, M. A., & Flores, M. E.
(2011). Protection and reactivation of human methylmalonyl-CoA mutase by
MMAA protein. Biochem Biophys Res Commun, 404(1), 443-447. doi:
10.1016/j.bbrc.2010.11.141
Vockley, J., P, R., Bennett, M., Matern, D., & Vladutiu, G. (2000). Synergisitic
Heterozygosity: disease resulting from multiple partial defects in one or more
metabolic pathways. Molecular Genetic Metabolism, 71(1-2), 10-18.
Watkins, D., & Rosenblatt, D. S. (2011a). Inborn errors of cobalamin absorption and
metabolism. Am J Med Genet C Semin Med Genet, 157(1), 33-44. doi:
10.1002/ajmg.c.30288
Watkins, D., & Rosenblatt, D. S. (2011b). Inherited Disorders of Folate and Cobalamin
Transport and MetabolismScrivers Online Metabolic and Molecular Bases of
Inheritated Disease. In D. Valle, A. L. Beaudet, B. Vogelstein & K. W. Kinzler
(Series Eds.): The McGraw-Hill Companies, Inc. Retrieved from
http://www.ommbid.com/. doi: http://dx.doi.org/10.1036/ommbid.172
Worgan, L., Niles, K., Tirone, J., Hofmann, A., Verner, A., Sammak, A., . . . Rosenblatt,
D. S. (2006). Spectrum of mutations in mut methylmalonic acidemia and
identification of a common Hispanic mutation and heplotye. Human Mutation,
27(1), 31-43.
Yamanishi, M., Vlasie, M., & Banerjee, R. (2005). Adenosyltransferase: an enzyme and
an escort for coenzyme B12? Trends Biochem Sci, 30(6), 304-308. doi:
10.1016/j.tibs.2005.04.008
Zhang, J., Dobson, C. M., Wu, X., Lerner-Ellis, J., Rosenblatt, D. S., & Gravel, R. A.
(2006). Impact of cblB mutations on the function of ATP:cob(I)alamin
adenosyltransferase in disorders of vitamin B12 metabolism. Mol Genet Metab,
87(4), 315-322. doi: 10.1016/j.ymgme.2005.12.003
Zhou, L., Errigo, R. J., Lu, H., Poritz, M. A., Seipp, M. T., & Wittwer, C. T. (2008).
Snapback primer genotyping with saturating DNA dye and melting analysis.
[Research Support, N.I.H., Extramural
107
APPENDIX V: Presentations
12th International Congress of Human Genetics
11 – 15 October 2011
Montreal, Quebec
Published abstract and Poster
Mutation screening of two genes involved in intracellular Vitamin B12 metabolism genes
by high resolution melting analysis (HRMA)
Margaret L. Illson, Qiuying Huang, Laura Dempsey Nunez, Alison Brebner,
Brian M. Gilfix, David Watkins, David S. Rosenblatt, Carl T. Wittwer
Intracellular vitamin B12 (cobalamin) transport and metabolism require the products of at
least 10 genes. Some of the inherited diseases involving the cobalamin pathway cannot
be distinguished through simple biochemical assays. Time consuming and expensive
testing methods such as somatic cell studies and sequencing have traditionally been used
for precise diagnosis.
HRMA was tested as an alternative screen to identify variants in the cobalamin pathway:
MMACHC, responsible for the cblC disorder and MUT, responsible for classic
methylmalonic aciduria. A total of 16 coding exons and flanking introns were amplified
by PCR (fragments sizes 145-359 bps) and melted in the presence of a saturating dye.
Screening of 96 normal DNA samples revealed 6 common polymorphisms, and
confirmed that melting curves (max. 4 melting domains) were accurately predicted by
uMeltSM and uViewSM, (http://www.dna.utah.edu/). A blinded study of 197 whole
genome amplified (WGA) patient samples compared HRMA results to sequencing.
Melting after PCR identified all heterozygous variants. While homozygotes could be
detected in exons containing multiple domains, single domain exons required mixing
with known PCR products before re-melting.
241 heterozygous (114 different) and 69 homozygous (48 different) mutations were
found. The sensitivity and specificity of variant detection by melting were both >99%.
Errors were either clerical or resulted from allele bias secondary to WGA. Unlabeled
probes and snapback primers were used to genotype common variants. Batch analysis
(many samples, one exon) was easier to interpret than patient-centric analysis (fewer
samples, many exons), although both were successful. Having demonstrated the efficacy
of HRMA for the recessively inherited genes of the B12 pathway, 16 additional coding
exons and flanking introns have been optimized for two genes implicated in vitamin B12responsive methylmalonic aciduria- MMAA and MMAB (fragments sizes 145-357 bps).
Screening of 96 normal DNA samples confirmed melting curve predictions and revealed
5 common polymorphisms. HRMA provides a cost effective, simple and rapid screening
method facilitating clinical diagnosis of overlapping phenotypes for genes in the vitamin
B12 pathway.
108
Federation of American Sciences for Experimental Biology
Science Research Conferences
22 - 27 July 2012
Crete, Greece
Oral Presentation Monday July 23, 1012
Poster
Screening of the MMAB gene by high resolution melting analysis (HRMA)
Margaret Illson, 1, Laura Dempsy Nunez,1, Jana Kent, 2, Luming Zhou, 2, David Watkins, 1,
Brian Gilfix, 3, Carl Wittwer, 2, David Rosenblatt, 1.
1) Department of Human Genetics, McGill University, Montreal, Quebec; 2) Department of
Pathology, University of Utah Medical Center, Salt Lake City, Utah USA; 3) Division of
Medical Biochemistry, Department of Medicine, McGill University, Montreal, Quebec,
Background: Intracellular vitamin B12 metabolism requires the products of five
genes for the synthesis and transport of adenosylcobalamin (AdoCbl), an essential
coenzyme for the mitochondrial enzyme, methylmalonyl Co-A mutase (MCM).
Mutations in MMAA, MMAB, MMAD, MUT, or MCEE can result in isolated
methylmalonylic aciduria (MMA). High Resolution Melting Analysis (HRMA)
was utilized as a fast and inexpensive method to scan for mutations in MMAB.
Methods: DNA from 96 reference, 42 cblB and 91 patients with undiagnosed
MMA were scanned by HRMA. gDNA was extracted from fibroblast cell lines
and PCR amplified in the presence of LCGreen Plus fluorescent dye (Idaho
Technology, Utah, USA). The PCR product was denatured on the Light
Scanner 96 (Idaho Technology) and sequence variations were detected by
changes in the melting profiles compared to reference samples.
Results: A blinded study of gDNA from 42 cblB patients, diagnosed by
complementation analysis, validated the efficacy of the assay by detecting the
presence of all 73 previously known mutations. Variants in 7 of the 11
unresolved alleles, from patients who had not had complete gene sequencing,
were detected. Sanger sequencing confirmed their identity as mutations including
one novel nonsense mutation, c.12 C>A, (p.C4X). Sensitivity of the HRM assay
was 98.9% and specificity  99%.
109
34
 of Mutations Previously
Known
1st
2nd
34
34
 of Mutations Identified by
HRMA
1st
2nd
34
34
5*
5
5
42 cblB
patients
0
3
3*
0
0
3
1
*Tested for only 3 common mutations (c.556C>T, c.700C>T and 571
ins5)
HRMA was then used to scan the fibroblast cells from 91 patients with isolated
methylmalonic aciduria of unknown etiology for variants in MMAB. The
propionate incorporation of these lines was within the reference range, making
complementation analysis infeasible. HRMA scanning identified 8 variants in 6
patients. Two patients (P1 and P2) have 2 sequence variants in the MMAB gene,
while 4 contain only a single variant. Five of the 8 variants have been previously
characterized as mutations. Of the remaining 3, one variant, c.398 C >T (S133F),
is novel, affects a highly conserved residue and is predicted to be possibly
damaging by Polyphen (http://genetics.bwh.harvard.edu/pph/). Two variants,
c.185 C >T (T62M), and c.394 T >C (C132R) are predicted to be probably
(T62M) or possibly (C132R) damaging. T62 is conserved across species but the
conservation of C132 is variable.
1st Mutation 2nd Mutation
SNPs
P1
c. 398 C > T c.572 T > C
p.S133F
p.R191Q
none
P2
c.394 T > C
p.C132R
p.M239K
(rs9593)
c.572 T > C
p.R191Q
Homozygous
Clinical Phenotype
Seizures at 2 months
Persistent isolated MMA
Non–responsive to vitamin
B12
Seizures at 3 months
Persistent isolated MMA
No information on B12
responsiveness
Conclusion: The identification of 2 compound heterozygous patients for
mutations in the MMAB gene suggests the existence of an unrecognized mild
MMA phenotype that cannot be identified through complementation studies, and
demonstrates the efficacy of HRMA to screen clinical samples.
110
APPENDIX VI : CERTIFICATES
111