Download Structure of cloned δ-globin genes from a normal subject and a

volume 10 Number 19 1982
N u c l e i c A c i d s Research
Structure of cloned 5-globin genes from a normal subject and a patient with 6-thabssemia; sequence polymorphisms found in the 5-globin gene region of Japanese individuals
Akinori Kimura, Eiji Matsunaga, Yoshiro Ohta', Toshinobu Fujiyoshi, Toshikazu Matsuo ,
Takanori Nakamura, Takashi Imamura , Toshiyuki Yanase and Yasuyuki Takagi
Department of Biochemistry and First Department of Internal Medicine, Kyushu University 60,
School of Medicine, Fukuoka 812, and 'First Department of Medicine, Faculty of Medicine,
Ehime University, Ehime 791-02, Japan
Received 3 September 1982; Accepted 18 September 1982
ABSTRACT
The <S-globin genes of a normal Japanese and a Japanese patient with homozygous 5-thalassemia were cloned, and the nucleotide sequence of a region
including the gene was determined. Comparison of the nucleotide sequences of
these two individuals with that of pH^l, 5-globin clone from the gene l i b r a r y
constructed by Maniatis et a j h , showed differences 1n the large Intervening
sequence (IVS 2 ) , at posTTions 137, 151, 186, 188, 291, 292 and 540 as one
base s u b s t i t u t i o n s , at 339 and 823 as one base a d d i t i o n s , at 548 as a one base
d e l e t i o n , and a 9 bp duplication between positions 651 and 659, and d i f f e r ences i n the 3 ' - f l a n k i n g sequence at 51 and 98 nucleotides 3' to the AATAAA
sequence. However, i n the region studied, no differences was observed in the
nucleotide sequences of the normal subject and the patient with <5-thalassemia.
Therefore, these differences may represent polymorphisms of the 5-globin gene
present i n Japanese i n d i v i d u a l s . These data suggest that IVS 2 is more d i vergent than other regions, and that a DNA region(s) other than the globin
gene may a f f e c t expression of the gene.
INTRODUCTION
Previous studies on molecular defects present i n patients with t h a l assemia, a heterogeneous group of i n h e r i t e d diseases characterized by reduced
synthesis of globin chains, have mainly been concerned with a- or 8 - t h a l assemia ( 1 ) .
6-Globin is a subunit of HbA2 (a282), a minor component of human adult
type hemoglobins, and i t s gene is located about 5 kilobase pairs (kb) away
from the (5-globin gene towards the 5' end ( 2 ) .
So f a r , ten patients with
horoozygous 5-thalassemia who have no HbA2 and do not suffer from anemia have
been reported i n Japan ( 3 , 4 ) .
However, the molecular defects i n 5 - t h a l -
assemia have not been investigated.
In t h i s work, we analyzed 5-globin genes prepared from a normal Japanese
subject and a patient with 5-thalassemia by cloning techniques.
We found no
difference i n the nucleotide sequence of the gene or i t s flanking regions in
the two DNA samples studied, but observed many sequence polymorphisms.
O I R L Pra«s Limited, Oxford, England.
0305-1048/82/1019-5725S 2.00/0
5726
Nucleic Acids Research
MATERIALS AND METHODS
Source of DMA DNAs of large molecular weight were Isolated from leukocytes
of a normal Japanese subject and from cultured lymphocytes of a patient who
was a homozygote for 5 -thalassemia, as described by Blin and Stafford (5).
Hematological data on t h i s patient (Iz) were reported previously (3, 4 ) .
Restriction enzyme analysis of DNAs DNAs were digested completely with EcoRI,
H i n d H I , B ^ I I , PstI and BamHI (Takara Shuzo Co., Ltd, Japan) at 37°C in the
buffer recommended by the manufacturer, and fractionated 1n 0.6 % agarose gel
by electrophoresis. Tnen DNA fragments were transferred onto nitrocellulose
f i l t e r s and hybridized to various DNA probes labelled with
P by nick transl a t i o n as described by Southern ( 6 ) . The DNA probe pr3.4, which was used as a
probe to detect the y globin gene, was constructed by subcloning the HindHI
3.4 kb fragment into pBR322 from y-globin gene-cloning HYG5 lambda phage ( 2 ) ,
kindly given by Dr. T. Maniatis. Pst<5 (pH5 1) ( 7 ) , PstB , pe0.7 (8) and RIH
(7) subclones were also provided from Dr. T. Maniatis.
Isolation of the<5-globin gene Three 10 yg portions of each DNA sample were
p a r t i a l l y digested with 40 units of E_coRI f o r 3, 5 and 7 minutes, respectively.
The three digests were combined and 10 to 17 kb DNA fragments were collected
from the mixture by sucrose density gradient centrifugation and cloned into X
phage vector to prepare a gene l i b r a r y by the method described by Maniatis et
a l . ( 9 ) , except that XCh28 was used instead of ACh4A. Recombinant phages with
large c e l l u l a r DNA inserts including the 6-globin gene were isolated d i r e c t l y
from the gene l i b r a r y without amplification by the plaque hybridization technique of Maniatis ^ t a_L(9). Furthermore, a PstI fragment of 2.3 kb, which
contains the 6-glob1n gene and i t s short flanking regions, was obtained from
the phages and subcloned into pBR322 (see RESULTS AND DISCUSSION).
Experiments using recombinant DNAs were conducted with a P3-EK2 containment system, 1n accordance with the guidelines of the Ministry of Education,
Science and Culture of Japan.
DNA sequencing DNA fragments hydrolyzed by suitable r e s t r i c t i o n endonucleases
and fractionated in an appropriate (0.6 - 2.0 X) preparative agarose gel by
electrophoresis were labelled with
P at the 51 end with polynucleotide
1
kinase (10) or at the 3 side w i t h the Klenow fragment (11) of E_. c o l i DNA
polymerasel. Y- 32 P-dATP, cr-32P-dATP and dCTP ( ^3,000 Ci/m nol) used for
labelling were purchased from Amersham. The DNA sequence was determined by
chemical degradation procedures as described by Maxam and Gilbert (12).
5726
Nucleic Acids Research
RESULTS AND DISCUSSION
R e s t r i c t i o n endonuclease mapping R e s t r i c t i o n enzyme digests o f DNAs Isolated
from a normal Japanese and from patient with &-thalassemia were f r a c t i o n a t e d
by electrophoresis and hybridized to probes containing the DNA region o f the
y6& gene complex (Table I , F i g . 1 ) . A l l fragments detected by h y b r i d i z a t i o n
were approximately the same size as those reported previously ( 7 ) . In
a d d i t i o n , no d i f f e r e n c e was found i n the r e s t r i c t i o n maps o f the two DNA
samples. These f i n d i n g s suggested t h a t t h i s homozygous p a t i e n t has a S - g l o b i n
gene o f the normal s i z e . However, the p o s s i b i l i t y t h a t non-a-globin genes are
missing completely from one chromosome of the p a t i e n t and t h a t molecular
changes responsible f o r the phenotype of thalassemia e x i s t i n the residual
5-globin gene located on the another chromosome cannot be excluded.
A s i m i l a r conclusion was reached by Wilson £ t al_. ( 1 3 ) , who made a
r e s t r i c t i o n map o f another p a t i e n t w i t h homozygous5-thalassemia. They
reached t h i s conclusion by supposing t h a t a 4.4 kb PstI fragment hybridizable
to the Pstg probe was the fragment containing the <5-glob1n gene. However, we
found t h a t a 2.3 kb PstI fragment gave a strong h y b r i d i z a t i o n band w i t h PstS
probe, whereas a 4.4 kb PstI fragment gave only a f a i n t band. Our f i n d i n g s
Table I .
R e s t r i c t i o n fragments i d e n t i f i e d i n the region o f the non a globin
genes
probe
pe0.7
EcoRI
BamHI
3.8
Hindi 11
8.3
0.8
PY3.4
7.6, 2.7, 1.6
15.5, 5 . 1 , 2.7
8.2, 3.4
RIH
7.2
15.5
17.4
Pst6
PstS
2.3, 1.7
15.5, 4 .4
17.4
5.2 , 3.6
8.3 , 1.8, 0.7
7.8
(7.5, 2.7, 0.7) *
Bglll
2.1
PstI
Xbal
ND
ND
13.0
5 . 1 , 4.3, 0.9
7.5, 5 . 1 , 3.4
4.8
1.2
SacI
ND
22.0, 5.3, 2.7
22.0
2.7
7.7
2.3
10.8, 2 .9
22.0
5.2
4.4
10.8
9.2
DNAs from a normal Japanese and from a patient with homozygous
6 -thalasseraia were digested with various r e s t r i c t i o n endonucleases.
The sizes of DNA fragments Identified by blot-hybr1dizat1on using the
indicated probes are shown in kilobases. The H i n d l l l digest of
normal DNA was found to contain the fragments marked by an asterisk,
due to the presence of two H j n d l l l polymorphic sites 1n the y genes,
1n addition to fragments from DNA lacking these sites. These
polymorphic sites were not found 1n DNA from the patient with
6-thalassemia. ND means "not determined".
5727
Nucleic Acids Research
EcoRI
PN
BamHI
Hjndlll
Bjjlll
PN
PN
PN
Pstl
PN
17.4
S.2
J
4.4#n
5i
' •
"
2.3
1.7
Figure 1 . Restriction fragments identified by blot-hybridization with PstiS
probe. The sizes of DNA fragments are indicated in kilobases. Restriction
fragments containing the 6-glob1n gene marked by asterisks are generated by
cross-hybridization with Pst6 probe. N; normal Japanese. P; the patient
with homozygous 6-thaiassemia.
indicate that the 5 globin gene is located on this 2.3 kb Pstl fragment, while
the s globin gene is located on the 4.4 kb fragment. So the data described
here provided a firmer basis for this conclusion.
Isolation of the S-qlobin gene To compare the S globin genes of two DNA
samples more exactly, we next attempted amplification of the genes. The
recombinant lambda phages Nl and N2 containing the large region covering the
5-globin gene were isolated from the normal subject, while Izl and Iz2 were
isolated from the patient with 6-thalassemia. These clones were found to
contain the DNA region, as shown in Figure 2.
From each clone, a 2.3 kb Pstl fragment containing the complete 5-globin
gene together with short flanking regions was subcloned into pBR322. pSP3
EcoRI
i
7.2
3.1
.
2.3 1.r
•
•
1
!
5.2
'
3.6 '
1
kb.
N1
N2
tz1
tz2
Figure 2. The structural 6 and 6genes are shown by the rectangles on the top
line and DNA inserts 1n respective recombinant phage clones are Indicated.
Nl and N2 are from the normal Japanese, and Izl and Iz2, from the patient
with 6-thalassemia.
5728
Nucleic Acids Research
and pIP3, isolated from Nl and I z l , respectively, were observed to have
identical insertion orientations with that of pH61 (14). Then they were
digested with Al_uI, Avail, Ddel, Hae.III, Hutf I , Hpjil, MboII, Sau3A and Sau96I , and fractionated on 5 % polyacrylamide gel by electrophoresis (Fig. 3).
I t was found that the endonuclease digestion patterns of the two subclones
were identical with that of pH61.
Primary structure of the 5-globin gene from Japanese individuals We
determined the complete nucleotide sequence of a region of about 2,000 bp of
pSP3 and pIP3 in a region extending from 120 nucleotides 51 to the susceptible mRNA capping site to 130 nucleotides 3' to AATAAA sequence of thes globin
gene. Comparison of our data with those on pH5 1 (14), showed no difference
in the 5' flanking region (about 120 nucleotides), the 5' untranslated region,
and a small intervening sequence or coding region.
On the other hand, many changes were observed in the large intervening
sequence as shown in Figure 4, and summarized in Figure 5. The one base
substitutions were T to A, at positions 137 and 540, A to T at 151, C to T
il
Sa«3AH
Mbo I
A B C A B C A B C
Sau M H
MM I
Oda I
A B C A B C A B C
A:pHSI
B: p#>-3U-thaO
C: pSP-3(Nonna)
Figure 3. DNAs of pH5 1, pIP3 and pSP3 were digested with the various restriction endonucleases indicated at the top, and subjected to electrophoresis
in 5 % polyacrylamide gel.
5729
Nucleic Acids Research
at 186, 188 and 292, and T to C at 291. There were 2 one base additions of
C to CC and TT to TTT at 339 and 823, respectively. One nucleotide at 548
was deleted. There was a 9 nucleotide (AGCATATAT) duplication between 651
and 659, which was probably generated by unequal crossing over.
There were also changes in the 31 flanking sequence at 51 and 98 nucleotides 31 to the AATAAA sequence, these changes were CC to C at 51 and C to G
at 98.
Since all these changes were found in all subclones of phage lambda
clones from both the normal subject and the patient with 6 thalassemia, they
seem to be sequence polymorphisms present in Japanese individuals. There
have been some reports about sequence polymorphisms in the coding sequence,
intervening sequence and 3' untranslated region of y (15) andS (16) globin
genes. Though Lawn £t^^l_.(17) reported a polymorphic PstI site in the IVS 2
of 5 globin gene, it was surprising to notice the many changes described
above. Our data are consistent with the findings of Slightom et al .(15),
,
G
T
T
137
Figure 4. Nucleotide sequence of the coding strand 1n the region of IVS 2 at
positions including 137, 151, 186 and 188. One base substitutions are underlined.
5730
Nucleic Acids Research
33d
548
651
659
\0A
PHJ1 QQCTC ATTCAA TA0AGCATATATGT
823 824
plP3
pSP3
pHJ1 TATTT AAAAT ATCTCT TTTCQC TTTAT GTCCAG TTCTT
PW
i
i
A
137
T
151
i
i
i i
T T
CT
186 188 291 292
i
\/
|
A
540
C
G
Figure 5. Sequence polymorphisms found 1n the 6 - g l o b i n gene o f Japanese
I n d i v i d u a l s : The gene i s i n d i c a t e d as p r o t e i n coding ( f i l l e d boxes), 3' unt r a n s l a t e d sequence (hatched box ) or large i n t e r v e n i n g seguence (IVS 2)
(open box ) . Nucleotide changes as d e l e t i o n or i n s e r t i o n (upper) and as base
s u b s t i t u t i o n s (lower) are shown i n comparison w i t h the sequence o f pH6 1 .
The positions o f nucleotides from the 5' end of IVS 2 are i n d i c a t e d .
t h a t i n the y globin gene, IVS 2 and the 3' untranslated region are more
d i v e r g e n t , and 110 bp o f IVS 2 a d j o i n i n g the 5' s p l i c e p o i n t and 80 bp o f
IVS 2 adjoining the 3' s p l i c e p o i n t are markedly conserved.
In the p a t i e n t w i t h 6-thalassemia, no molecular defects were found i n the
6 - g l o b i n gene or i t s f l a n k i n g r e g i o n s . Thus we thought t h a t a more upstream
region might a f f e c t expression of the 5 globin gene, as observed i n the case
of the histone gene o f the sea u r c h i n ( 1 8 ) . So we also determined the nucleot i d e sequence o f normal and <5-thalassemia clones up t o 300 nucleotide 5' to
the capping s i t e , as shown i n Figure 6. However, so f a r as determined, no
d i f f e r e n c e was found between these clones.
Possibly a " r e g u l a t o r y sequence(s)" i s located f a r apart from the s t r u c -
-300
GCCCGATCATTCCACTATATTAGTCCAAACACTCTACGAAATAGAACTAAGGAGGATATT
TTTAGAAACAACTGCTGAAAGAGATGCGGTGGGGAGATATGCAGAGGAGAACAGGGTTTC
TGAGTCAAGACACACATGACAGAACAGCCAATCTCAGGGCAAGTTAAGGGAATAGTGGAA
TGAAGGTTCATnnCATTCTCACAAACTAATGAAACCCTGCTTATCnAAACCAACCTG
CTCACTGGAGCAGGGAGGACAGGACCAGCATAAAGGCAGGGCAGAGTCGACTGnGCTTA
*
Figure 6. Nucleotide sequence of the 5' flanking region of the 6 globin gene
up to 300 nucleotides 5' to the susceptible mRNA capping site marked by an
asterisk. The CCAAT and TATA boxes are underlined.
5731
Nucleic Acids Research
t u r e gene, because Van der Ploeg e_t a\_. (19) reported t h a t the 8 g l o b i n gene
was not expressed i n a p a t i e n t with y - S - thalassemia who has a d e l e t i o n only
i n a region between the z and 6 g l o b i n gene. T h e r e f o r e , though we could not
detect any s t r u c t u r a l changes around the y$B g l o b i n gene complex by the b l o t h y b r i d i z a t i o n technique, we think t h a t t h i s p a t i e n t w i t h homozygous 5 - t h a l assemia may have a small d e l e t i o n or a d d i t i o n a f f e c t i n g the normal " r e g u l a t o r y
sequences" i n some p a r t other than the region o f the sequence determined.
ACKNOWLEDGEMENT
We thank Dr. T. Maniatis for providing us w i t h the pe0.7, Pst5, PstS and
RIH subclones and HrG5 phage lambda clone.
REFERENCES
~T. M a n i a t i s , T . , F r i t s c h , E.F., Lauer, J . and Lawn, R.M. (1980) Ann. Rev.
Genet. 14, 145-178
2. F r i t s c h , E . F . , Lawn, R.M. and M a n i a t i s , T. (1980) Cell 19, 959-972
3. Yasukawa, M., S a i t o , S . , F u j i t a , S . , Ohta, Y . , Ikeda, K., Matsumoto, I .
and Kobayashi, Y. (1980) B r i t , J . Haemat. 4 6 , 199-206
4. Ohta, Y . , Yasukawa, M., S a i t o , S . , F u j i t a , S. and Kobayashi, Y. (1980)
Hemoglobin 4 , 417-425
5. B l i n , N. and S t a f f o r d , D.W. (1976) Nucl. Acid Res. 3 , 2303-2308
6. Southern, E.M. (1975) J . Mol. B i o l . 98, 503-517
7. F r i t s h , E . F . , Lawn, R.M. and M a n i a t i s , T. (1979) Nature 279, 598-603
8. B a r a l l e , F . E . , Shoulders, C.C. and Proudfoot, N.J. (1980) Cell 2 1 ,
621-626
9. M a n i a t i s , T . , Hardison, R.C. , Lacy, E . , Lauer, J . , 0 ' C o n n e l l , C , Quon,
D., Sim, G.K. and E f s t r a t i a d i s , A. (1978) Cell 15, 686-701
10. Berkner, K.L. and F o l k , W.R. (1977) J . B i o l . Chem. 252, 3176-3184
1 1 . Klenow, H. and Henningston, I . (1970) Proc. N a t l . Acad. S c i . USA 65,
168-175
12. Maxam, A.M. and G i l b e r t , W. (1977) Proc. N a t l . Acd. S c i . USA 74,
560-564
13. Wilson, J . T . , Wilson, L.B. and Ohta, Y. (1981) Biochem. Biophys. Res.
Coran. 99, 1035-1039
14. S p r i t z , R.A., DeRiel, J . K . , Forget, B.G. and Weissman, S.M. (1980)
Cell 2 1 , 639-646
15. S l i g h t o m , J . L . , B l e c h l , A.E. and S m i t h i e s , 0. (1980) Cell 2 1 , 627-638
16. O r k i n , S . H . , Kazazian, H.H.Jr., A n t o n a r a k i s , S . E . , Goff, S . C . , Boehm,
C D . , Sexton, J . P . , Waber, P.G. and G i a r d i n a , P.J.V. (1982) Nature 296,
627-630
17. Lawn, R.M., F r i t s c h , E.F., Parker, R . C , Blake, G. and M a n i a t i s , T.
(1978) Cell 15, 1157-1174
18. Grosschedl, R. and B i r n s t i e l , M.L. (1982) Proc. N a t l . Acad. Sc1. USA
79, 297-301
19. Van der Ploeg, L . H . T . , Konings, A . , O o r t , M., Roos, D., B e r n i n i , L. and
F l a v e l l , R.A. (1980) Nature 283, 637-642
5732