* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Characterization of CIC transporter proteins Moradi, Hossein
Survey
Document related concepts
Membrane potential wikipedia , lookup
Cell culture wikipedia , lookup
Protein moonlighting wikipedia , lookup
Cytoplasmic streaming wikipedia , lookup
Mechanosensitive channels wikipedia , lookup
Extracellular matrix wikipedia , lookup
Cytokinesis wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Magnesium transporter wikipedia , lookup
Cell membrane wikipedia , lookup
Signal transduction wikipedia , lookup
Transcript
University of Groningen Characterization of CIC transporter proteins Moradi, Hossein IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2009 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Moradi, H. (2009). Characterization of CIC transporter proteins: Functional analysis of clc mutants in Arabidopsis thaliana Groningen: s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 18-06-2017 University of Groningen Characterization of ClC Transporter Proteins Functional analysis of clc mutants in Arabidopsis thaliana Hossein Moradi I II RIJKSUNIVERSITEIT GRONINGEN Characterization of ClC Transporter Proteins Functional analysis of clc mutants in Arabidopsis thaliana PROEFSCHRIFT ter verkrijging van het doctoraat in de Wiskunde en Natuurwetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. F. Zwarts, in het openbaar te verdedigen op donderdag 21 september 2009 om 11.00 uur door Hossein Moradi geboren op 28 juni 1968 te Sari, Iran III Promotor: Prof. dr. J.T.M. Elzenga Copromotor: Dr. F.C. Lanfermeijer Beoordelingscommissie: Prof. dr. B. van Duijn Prof. dr. J. Hille Prof. dr. S. Shabala IV To the twelfth Imam (Mahdi ) V The research reported in this thesis was financially supported by a grant from the Ministry of Science, Research and Thechnology of Islamic Repoblic of Iran, and were performed in the Laboratory of Plant Physiology, which is a part of the Center for Ecological and Evolutionary Studies (CEES) of the University of Groningen, The Netherlands. Cover design: Farveh Norouzi Printed: Facilitairbedrijf, RuG, Groningen, The Netherlands ISBN: 978-90-367-3970-2 (printed version) ISBN: 978-90-367-3971-9 (digital version) VI Contents Chapter 1 Chloride channels: A general introduction Chapter 2 Generation and characterization of anion channel mutants in Arabidopsis thaliana 25 Chapter 3 NO3- and H+ fluxes in Atclcd mutants of Arabidopsis thaliana 43 Chapter 4 Anion channels and root elongation in Arabidopsis thaliana 57 Chapter 5 The role of AtClCa and AtClCd in heavy metal tolerance in Arabidopsis thaliana 73 Chapter 6 General discussion and conclusion 89 References 93 1 Summary (English) 107 Summary (Dutch) 109 Summary (Persian) 112 Acknowledgements 114 VII VIII Chapter 1 Chloride Channels: A General Introduction Hossein Moradi1,2 Theo Elzenga1 and Frank Lanfermeijer1 1 Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands 2 Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources University, Iran 1 Chapter 1 INTRODUCTION The physiology of plants strongly depends on solute and water fluxes across the cell plasma membrane, the tonoplast and other endomembranes. Among the different transporter systems involved in transport, ion channels represent a large class with important roles. These proteins facilitate passive fluxes of ions down their respective electrochemical gradients. The ClC proteins constitute a family of transmembrane transporters that either function as anion channel or as H+/anion exchanger. Part of the ClC family members are anion selective ion channels, which provide passive pores which allow anions to move according to their electrochemical gradient. The others are anion/proton antitransporters, which couple the transport of two anions with one proton. The first member of the ClC family, called ClC-0 was isolated from the Torpedo marmorata electric organ by expression cloning in Xenopus oocytes (Jentsch et al., 1990). Figure 1 shows the phylogenetic relationship between different members of ClC family prokaryotes and eukaryotes. The ClC family has been best characterized in mammals, in which at least nine members have been identified that can be grouped in three branches (Jentsch et al., 2002). Several studies have demonstrated the importance of ClC family in human diseases, such as kidney stones, muscle disorder myotonia, cystic fibrosis, deafness, and the bone disease osteoporosis (Jentsch et al., 2005). The first plant member of the ClC family was ClC-Nt1 from Nicotiana tabacum (Lurin et al., 1996), which was cloned by a PCR-based cDNA library screening approach (Lurin et al., 1996). ClC proteins in the two model plants, Arabidopsis thaliana and rice, have been shown to encode anion channels and transporters involved in nitrate homeostasis. ClC proteins in plants participate in various physiological processes, such as, osmoregulation, stomatal movement, cell signaling, nutrient uptake and metal tolerance (Barbier et al., 2000). However, detailed knowledge on the role of ClC proteins in plant cells is still lacking as a result of the absence of distinctive effects of knock-outs, the unknown intracellular localization and the co-operation between the different family members. 2 Chloride channels: A general introduction Figure 3. Neighbor-Joining Consensus tree of ClC proteins of various kingdoms The tree was calculated using the Geneious program. The branch containing the AtClCe and AtClCf proteins is indicated with “cyanobacteria, mitochondria, chloroplasts”. Arabidopsis thaliana: AtClCa: CAA96057.1; AtClCb: CAA96058.1; AtClCc: CAA96059.1; AtClCd: P92943.2; AtClCe: AAK53390.1; AtClCf: AAK53391.1; AtClCg: P60300.1; Escherichia coli: EcClC1: P37019.2; Homo sapiens: HsClC1: P35523.2; HsClC2: P51788.1; HsClC3: P51790.2; HsClC4: P51793.2; HsClC5: P51795.1; HsClC6: P51797.1; HsClC7: P51798.2; HsClCKa: P51800.1; Neurospora crassa: NcClCx1: EAA33130.2; NcClCx2: EAA28009.2; NcClCx3: EAA28099.2; Nostoc punctiforme: NpClCx1: YP_001868013.1; NpClCx2: BAB73778.1; NpClCx3: YP_001866371.1; NpClCx4: YP_001865245.1; NpClCx5: YP_001865422.1; Saccharomyces cerevisiae: ScClC (GEF1): P37020.1; Salmonella enterica: SeClC1: AAL19167.1; Synechococcus elongatus: SelClCx1: YP_170743.1; SelClCx2: YP_400274.1; SelClCx3: YP_400605.1; Torpedo marmorata: TmClC-0: CAA40078 Transport across cell membranes The important function of the plasma membrane is to isolate the exterior from the interior of the cell in order to allow the biochemical processes and preservation of labile biological molecules. However, in order to facilitate the exchange of substrates, products and waste this isolation can not be absolute. Because only a very small number of small lipophilic molecules, like O2 and CO2, can traverse the membrane unmediated, biological membranes contain various systems that allow the controlled passage of molecules. These systems are hydrophobic proteins that are inserted in the 3 Chapter 1 membrane and create pores or passageways for all kinds of molecules. These systems can be divided in two major groups: passive transporters and active transporters. Passive transport Transport is considered to be passive when the movement of the solute is solely driven by the concentration gradient that exists between the interior and the exterior of the cell. In this case there is always a net flux from the compartment with a high to the compartment with a low concentration. Subsequently, passive transport can be divided into simple diffusion and facilitated diffusion. Osmosis, in that sense, does not differ from solute transport. The only difference is that it concerns water transport. Osmotic water fluxes are also driven by the differences in concentration. The higher the concentration of dissolved solutes the lower the concentration of water and, thus, water moves to areas with a high solute concentration and, thus, a low water concentration (activity). Simple diffusion Simple diffusion through the membrane has only been demonstrated for a few uncharged lipophilic molecules, like for instance O2, CO2 and NH3. However, transport can be slow and can not be controlled. Hence, most fluxes of molecules are facilitated by pores, formed by proteins. Facilitated diffusion Routes for facilitated diffusion are created by the insertion of hydrophobic proteins into the membrane. These proteins have a hydrophobic surface, which allow interaction with, and thus insertion into, the lipophilic membrane. Internally they either contain a hydrophilic pore or a hydrophilic pathway, which allows the passage of the solutes. These pores can be highly specific, in the sense that they allow only passage of one single type of molecule, for instance potassium channels that only allow the passage of K+ ions. Another group of ion-specific channels are the chloride channels, they are named chloride channels because this was the first activity of these channels detected. However, they are able to mediate fluxes of a few anions (Cl-, Br-, I-, NO3-). Other pores are less specific and allow the passage of various types of molecules. Fluxes through the channels continue until equilibrium in concentration is reached (in the case of uncharged molecules) or if the Nernst potential for the ions 4 Chloride channels: A general introduction transported is established. The Nernst potential considers next to the difference in concentration also the fact that charges are transported. As soon as for instance K+ flows through a potassium-specific channel it leaves a negative charge behind and thus a potential difference across the membrane is generated. At a certain moment the polarization is so large that K+ ions cannot move anymore. The potential at which this happens is called the Nernst potential for that particular ion. An important aspect of channel-proteins is that they can be controlled. The channels can be opened or closed according to the needs of the cell. This phenomenon is called “gating”. Gating can be controlled by ligands, by membrane potential (voltage-gated), by post-translational modifications or mechanically. Worth mentioning in this context is the presence of two CBS domains in the ClC-proteins. It is suggested that the CBS domains form a sensor that switches transporters between an inactive and an active state (channels: gating) by interaction of the CBS domains with the negatively charged membrane surface in response to the ionic strength. This switching mechanism is an effective means for cells to respond to osmotic shifts, because an increase in medium osmolality will result in a decrease in cell volume, and the accompanying increase in cytoplasmic ionic strength will activate the transporter (Poolman et al., 2006). The presence of these sensors in ClC proteins can be related with the role of these channels in osmo-regulation, turgor-homeostasis and cell growth. Active transport Cells need to accumulate compounds for different reasons and, thus need to transport solutes against their concentration gradient. This can be achieved in three ways. Firstly, the uphill transport of a solute is driven by the release of chemical energy from the hydrolyzation of ATP or pyrophosphate (PPi), by redox reactions (respiratory chain) or by light energy (photosynthetic apparatus). Secondly, the uphill transport of a solute is coupled to the down hill transport of an other solute, and finally, charged molecules move as a result of membrane potential against their concentration gradient. The first type of transport is called primary active transport, the second is a form of secondary active transport and the third is passive transport down the electro-chemical gradient (but up the chemical gradient). 5 Chapter 1 Primary active transport While the respiratory chain and the photosynthetic apparatus are special cases, solute transport is usually energized by the hydrolysis of ATP. Four transport systems exist which mediate primary active transport of solutes by ATP hydrolysis: P-type ATPases, V-type ATPases, F0F1-ATPase and ABC-transporters. Important in plant cell growth are the three primary transporters located in the plasma membrane and tonoplast. These are the plasma membrane (PM) H+-ATPAse, the tonoplast V-type H+-ATPase and the tonoplast H+-pyrophosphatase (PPase). Because these primary transporters generate the proton-motive force across the plasma membrane and tonoplast, they play an important role in the growth of cells. In that context their activity is regulated by for instance growth controlling plant hormones like auxins (Kitamura et al., 1997). The PM H+-ATPase The PM H+-ATPase has two roles in the plant cell: firstly it plays a role in maintance of the cytosolic pH and secondly it generates the proton-motive force across the PM which is used for the uptake of other solutes. The PM H+-ATPase is a single-subunit protein and belongs to the P-type ATPases that extrudes H+ from the cell. This proton pump is able to generate membrane potentials ranging from -120 to 160 mV (negative inside) and a pH gradient of 1.5 to 3 units (acid outside). The membrane potential and the pH gradient form the proton-motive force which enables the uptake of other solutes (Sze et al., 1999). The Tonoplast H+-ATPase and Tonoplast H+-pyrophosphatase The tonoplast H+-ATPase is a V-type ATPase and, as such, a multimeric complex encoded by at least 26 genes (Strompen et al., 2004). The tonoplast H+-pumping pyrophosphatase (H+-PPase) is single subunit proteins. Both these primary transporters pump H+ into the vacuole. This action results in a pH gradient and a membrane potential across the tonoplast. The pH of the vacuole is usually in the range 3-6 while membrane potentials up to 60 mV have been measured (positive in the vacuole). These two primary pumps generated a proton motive force across the tonoplast, which is used for the accumulation of solutes into the vacuole. These solutes can be waste or toxic compounds (Na+), however, the majority of these solutes are accumulated in order to generate a low water potential necessary for water uptake, 6 Chloride channels: A general introduction turgor and growth. V-type ATPases have also been found in the endoplasmic reticulum and trans-Golgi network. (Chanson and Taiz., 1985; Strompen et al., 2005 and Dettmer et al., 2005 and 2006), where they play a role in directing the transport vesicles to their destination. Secondary active transport Secondary active transporters or co-transporters couple the uphill transport of solutes to a downhill transport of another solute. In plants energy is stored in the proton motive force (PMF) generated by the three major primary proton pumps and most secondary active transporters use this PMF by coupling the transport of their solute to the downhill transport of H+. Two distinct types can be distinguished. First of all there are the symporters, where the transport of the solute is in the same direction as the co-transported H+. The second type are antiporters in which the direction of the substrate is opposite to the transport of the H+. In the large family of ClC membrane proteins, transmembrane movement of Cland NO3- is facilitated by an antiporter mechanism in which a H+ is transported in the opposite direction (Accardi and Miller 2004; Scheel et al. 2005). A recent electrophysiological and molecular study demonstrated that ClC homologues are antiporters in the vacuole of Arabidopsis that, through NO3-/ H+ exchange, concentrate NO3- in a plant vacuole (De Angeli et al 2006). Anion transporters Chloride channel proteins An important group of anion transporters in plants is the chloride channel (CIC) family. Since the cloning of first member of the ClC family from the Torpedo electric organ (ClC-0), these transporter-proteins have been identified in almost all organisms (Gurnett et al., 1995; Klock et al., 1994). In mammals, ClC proteins form a family of at least 9 different genes, which can be classified in three subfamilies (Jentsch et al 2005). While more and more individual ClC genes have been identified recently, a nice synopsis of the presence of this gene family in plants can be obtained from the complete genome sequencing projects. In the Arabidopsis genome 7 ClC genes are present (Hechenberger et al 1996). In plants, ClC proteins participate in various physiological functions, such as, osmoregulation, stomatal movement, cell signaling, 7 Chapter 1 nutritent uptake and metal tolerance (Barbier-Brygoo et al., 2000). Like for all other organisms, the discussion concerning the real substrates of the ClC proteins in plants is still continuing. Proteins are designated a chloride channel (ClC) based on the fact that the cDNA from the prime example, ClC-0, isolated from Torpedo, gave currents typical for the Torpedo electric organ chloride channel in Xenopus oocytes (Hirono 1987; Gundersen 1984). However, during the last years a dualistic character of these proteins has surfaced. Some members of this family are indeed functional Clchannels, but recently evidence has come forward showing that other members of this family mediate fluxes of NO3- and, evenmore surprising, in some cases the transport the anions is coupled to a proton counterflux, which changes the nature of the channel into that of an antiporter. Structural organisation of ClC transporters The Escherichia coli EcClC and Salmonella typhimurium StClC proteins were the first ClC proteins to be crystallized and provided the second structure of a transmembrane channel protein (Dutzler et al., 2002; Dutzler et al., 2003). These studies revealed that the members of the ClC family share a conserved structural organization, consisting of a transmembrane channel domain and in many cases of cytoplasmic regulatory domains, like the two cystathionine-β-synthetase domains (CBS1 and CBS2) at the carboxyl end (see above). EcClC crystallizes, and probably functions, as a homodimer with each subunit containing an independent ion translocation pore. The subunits exhibit an ‘antiparallel architecture’: one subunit contains two structurally related halves spanning the membrane with opposite orientations (Dutzler 2006; Dutzler et al., 2002, 2003). This topology shows similarity to other transporter proteins, namely the presence of broken α-helixes and partly inserted α-helixes and the anti-parallel architecture. A common topology of ClC proteins has been presented in Dutzler (2006), in which 18 α-helices are recognized, 8 AT5G40890.2 AT3G27170.1 AT5G49890.1 AT5G26240.1 AT4G35440.1 AT1G55620.1 AT5G33280.1 AtClCa AtClCb AtClCc AtClCd AtClCe AtClCf AtClCg S - - S S P P GS/PGIPEa E to A K to P K to P + + + + GKEGPb + E to T E to S + + + + Glub 270 + F to Y F to Y + + + + GXFXPb Presence of structural element + - - + + + + 564 Tyrc A -, no pH gating A- A- H+/Cl- H+/Cl- H+/NO3- H+/NO3- Predicted Function Marmagne et al., 2007 Gaxiola et al., 1998; Lv et al., 2009 Gaxiola et al., 1998; Hechenberger et al., 1996; Lv et al., 2009 De Angeli et al., 2006 Confirmed function by Table 1: Structural characteristics of the Arabidopsis thaliana ClC proteins and their predicted function, based upon these characteristics. a: The presence of a proline or a serine at position 2 of the motif is indicated by a “P” or an “S”, respectively. The absence of the motif in the protein is indicated by “-“. b: The presence of the exact motif is indicated by “+”, If the motif is precent in a modified form the change is indicated by the one letter amino acid code. c: The presence or the absence of the tyrosine is indicated by “+” or “-“, respectively. TIAR code Protein 9 Chloride channels: A general introduction Chapter 1 of which 17 are fully or partly inserted into the membrane. If this structure can be also applied to the plant ClC proteins, remains to be seen. At least AtClCa,b,c,d, and g, which show a high homology with EcClC and contain clearly the conserved functional domains (GP/SGIP and GK/REPG), might show this topology (Table 1). AtClCe and f have a lesser homology with the archetype and for instance lack the GP/SGIP motif (Table 1) and might therefore differ structurally. If plant ClC proteins function as homodimers, like their bacterial counterparts, also remains to be determined. Most bacteria contain only one ClC gene, whereas for instance Arabidopsis contains seven. If some of these plant ClC proteins are targeted to the same membrane the formation of heterodimers is a possibility. The ClC transporter family is an interesting group of transporters, as the overall structural organization of these proteins allow the members either to function as a channel or a transporter or even as both. This is not an oddity, but a universal property of possibly all eukaryotic CLC members (Dutzler, 2006, 2007). Therefore, the molecular architecture of the protein should be able to support both modes of transport. In the structure of EcClC, but also present in the amino acid sequences of the Arabidopsis ClC proteins, several essential motives and amino acids have been recognized. In the crystal structures of the ClC proteins three Cl- binding sites were recognized (Dutzler et al., 2002; 2003). The first one is, together with other elements, created by the 564Tyr residue (numbering for AtClCa) and the serine residue of the motif GSGIP (Figure 2). This site is referred to as the central binding site (Scen). The internal (close to the cytoplasm) binding site (Sint) is formed by main-chain amide nitrogen atoms of less conserved amino acid residues (Figure 2). The third binding site (Sext; Figure 2), which was only recognized after changing glutamate148 (counting in E.coli) to alanine is formed by residues from conserved motifs GK/REGP and GXFXP (Dutzler et al., 2000). Together these three sites in the channel protein form the path along which the Cl- ions travel according their electrochemical potential. Recently an important observation was made in relations to the NO3- versus Clspecificity of the transporters. The Arabidopsis AtClCa protein which is a NO3transporter in which the transport of 2 nitrates into the vacuole is tightly coupled to movement of a proton in the opposite direction, contains, instead of the serine in the GSGIP motif, a proline. Mutating AtClCa (P to S) and the mammalian ClC-5 (S to P) at this position, showed the importance of these residues in substrate specificity. In 10 Chloride channels: A general introduction Figure 2a.The gating mechanism of CLC proteins which function as channels (see text) The cartoon displays one monomer. A: Open conformation. B: Closed conformation. C- and CH; deprotonated and protonated carboxyl group, respectively, of the gating glutamate (see text). Sext, Scen and Sint indicate the three anion binding sites. The respective elements forming the binding sites are indicated in the open configuration. Sint is formed by main-chain amide nitrogen atoms. Figure 2b. Model of the transport mechanism of ClC proteins which function as 2A-/H+ antiporters The cartoon displays one monomer cycling through the different conformations. Cand CH: deprotonated and protonated carboxyl group, respectively, of the gating glutamate (see text). E- and EH: deprotonated and protonated gating glutamate (see text).The transport cycle: Step 1: All three binding site become occupied by an anion (in this case a Cl-). The gating glutamate is protonated and in the open conformation. The proton-donating becomes protonated (can also take place at step 2). Step 2: The 11 Chapter 1 gating glutamate deprotonates and “pushes” the anions through the channel. Two anions leave the channel. Step 3: The channel becomes blocked between Sint and Scen (see figure 3) which prevents back flow of anions. A proton is transferred from the proton-donating glutamate to the gating glutamate and the gates opens and the system returns at step 1. AtClCa, the P to S mutation resulted in a Cl-/H+ exchange comparable to NO3-/H+ exchange, while in the wild type protein Cl- transport is negligible. The opposite change in the mammalian ClC-5 protein, which normally transports Cl- tightly coupled to H+ and NO3- almost uncoupled, resulted in a coupled NO3- transport (Bergsdorf et al., 2009). Table 1 shows the distribution of the GS/PGIP variation over the Arabidopsis CLC proteins. Two other important residues are the glutamates at positions 203 and 270 (numbering in AtClCa). Glutamate203 is part of the motif GK/REPG and is highly conserved in the ClC proteins. In Arabidopsis only AtClCg has an alanine at this position (GKAPG), the other 6 contain this glutamate. In the first structures of the ClC proteins only two binding sites for chloride were recognized (Sint and Scen) because of there occupation by chloride ions. The third binding site (Sext) was only recognized after the respective glutamate in EcClC was mutated, resulting in an additional halogen anion in the crystal structure (Dutzler et al., 2003). As a consequence, the gating mechanism of the ClC channels is assumed to be mediated by this glutamate, which under the proper conditions (pH) mimics a chloride anion and binds in the Sext binding site and closes the channel. The change to an alanine results in a channel, which can not be closed (Dutzler et al. 2003; Dutzler, 2006; 2007; Jian et al., 2004). Recently, also a role of this glutamate in the functioning of the ClC transporters has been observed. In AtClCa, which in Xenopus shows NO3-/H+ exchange and to a lesser extend Cl-/H+ exchange, mutating 203Glu results in uncoupled anion conductances, indicating a role of this glutamate in the coupling of the transport of protons to the anions (Bergsdorf et al., 2009). This effect of this amino acid change was also observed in other ClC transporters (Accardi and Miller., 2004; Zdebik et al., 2008). Changing the 270Glu to an alanine completely abolished the anion currents mediated by AtClCa in Xenopus-oocytes. However, currents could be restored by the uncoupling Glu203Ala mutation (Bergsdorf et al., 2009). The idea is that 270Glu, which is located at the cytoplasmatic site of the membrane, binds protons and hands 12 Chloride channels: A general introduction them over to the gating 203Glu, which results in the coupling of the anion flux to the proton flux (Accardi et al., 2005; Dutzler, 2007; Lim and Miller, 2009; Zdebik et al., 2008). Based on the structural information, given above, predictions can be made about the function of the Arabidopsis ClC proteins (Table 1). The model described above can be applied to AtClCa, b, c, d and g resulting in AtClC a and b being NO3transporters and AtClCc and d being Cl- transporters. The absence of the equivalent glutamate residue of 203Glu in AtClCg suggests this might be a channel. However, its anion preference is difficult to deduce. AtClCa has been shown to function as a H+/NO3- (De Angeli et al., 2006). AtClCc and d are able to complement the chloride transporting ClC protein in yeast, GEF1. AtClCa was not able to do so. Those observations in yeast are in agreement with the role of these proteins as chloride transporter or nitrate transporter, respectively (Gaziola et al., 1998; Hechenberger et al., 1996). AtClCe and f, on the other hand, are more difficult to label. They show the lowest homology with EcClC and the other Arabidopsis ClC proteins. They even lack some critical residues (for instance the 564Tyr) and motifs (GS/PGIP), hence the function and role of these two ClC proteins based on their sequence is difficult to predict. Figure 1 shows the phylogenic tree containing a considerable set of ClC proteins from all the major kingdoms and the Arabidopsis proteins. As can be observed, 5 of the Arabidopsis proteins form their own branch. Only AtClCe and f mingle with ClC proteins from other kingdoms and more particulary with those from cyanobacteria. This suggests that these ClC proteins are more related to cyanobacterial proteins which could be explained by the cyanobacterial origine of the chloroplast and, this indicates that AtClCe and f are located in the chloroplast. Calculating a phylogenic tree of a large set of plant CLC proteins resulted in another picture (Figure 3). In this situation the ClC proteins were organized according to their characteristics as also used in Table 1. First a large branch could be split off in which the GS/PGIP motif is absent and a modified GKEGP motif was present (the lysine was replace by a proline, hence: GPEGP). In this group the proton-donating glutamate is also absent. This branch contains both AtClCe and f and in combination with the location of these two Arabidopsis proteins in figure 1 this suggests that the other plant ClC proteins of this branch are also anion channels which function in chloroplasts or mitochondria. The absence of the GS/PGIP motif has until now not 13 Chapter 1 Figure 3. Neighbor-Joining Consensus tree of plant ClC proteins The tree was calculated using the Geneious program. Branches are grouped according the presence of elements in the sequence: GP/SGIPE, GKEGP, GXFXP, “glu” indicates the proton-donating glutamate (see text). When the respective element has been striked through this element can not be detected in the protein sequences of the group. Bold and underlined residues indicate differences between this motif with the other groups or the consensus. Arabidopsis thaliana: AtClCa: CAA96057.1; AtClCb: CAA96058.1; AtClCc: CAA96059.1; AtClCd: P92943.2; AtClCe: AAK53390.1; AtClCf: AAK53391.1; AtClCg: P60300.1; Glycine max: GmClC1: AAY43007.1; Medicago truncatula: MtClCx1: ABE91957.1; Nicotiana tabacum: NtClC1: CAA64829.1; NtClC2: AAD29679.1; Oryza sativa: OsClC1: BAB97267.1; OsClC2: BAB97268.1; OsClCx3: NP_001047143.1; OsClCx4: NP_001047955.1; OsClCx5: NP_001062147.1; OsClCx6: NP_001066692.1; OsClCx7: NP_001054061.1; Physcomitrella patens: PpClCx1: EDQ80065.1; PpClCx2: EDQ78881.1; PpClCx3: EDQ52731.1; PpClCx4: EDQ64061.1; PpClCx5: EDQ63773.1; Populus trichocarpa: PtClCx1: EEE85399.1; PtClCx2: EEE77376.1; PtClCx3: EEF09978.1; PtClCx4: EEF01954.1; PtClCx5: EEF10085.1; PtClCx6: EEE99668.1; PtClCx7: EEE84906.1; Ricinus communis: RcClCx1: EEF34561.1; RcClCx2: EEF47977.1; RcClCx3: EEF31629.1; RcClCx4: EEF33157.1; RcClCx5: EEF50918.1; RcClCx6: EEF45376.1; Solanum lycopersicum: SlClCx1: CAC36403.1; Solanum tuberosum: StClCx1: CAA71369.1; Vitis vinifera: VvClCx1: CAO47567.1; VvClCx2: CAO71138.1; VvClCx3: CAO67080.1; VvClCx4: CAO66848.1; VvClCx5: CAO48998.1; VvClCx6: CAO69292.1; VvClCx7: CAO46902.1; Zea mays: ZmClCx1: ACN33881.1; ZmClCx2: AAP04392.2 been implicated with a characteristic of these ClC proteins. It is not known whether this affects ion-specificity or other transport characteristics. The effect of replacing the lysine next to the gating glutamate with a proline also is unknown, although an 14 Chloride channels: A general introduction effect on the pKa of the glutamate can be expected and, thus maybe on the transporters pH-dependence. Hence, these proteins are probably pH-sensitive anion channels. A second group, which includes AtClCc, is characterized by the presence of the two motifs GSGIP and GKEGP and the presence of the proton-donating glutamate. These proteins are therefore probably H+/Cl- exchangers. AtClCg is a member of a third group, which is typified by the presence of the motifs GSGIP and GKAGP. Also the proton-donating glutamate is present in this branch. As shown in Bergsdorf et al (2009) the engineered combination of the presence of the proton-donating glutamate and the absence of the gating glutamate in AtClCa resulted in an uncoupled Cl- and NO3- conductance. Consequently, this branch probably represents genuine anion channels. However, AtClCa is a H+/NO3exchanger, based on the presence of the motif GPGIP which changes to an anion channel with a higher conductance for Cl- than for NO3- when the proline is changed to a serine. How the serine in the GSGIP motif in the branch of AtClCg affects the characteristics of these ClC proteins is unknown. The final branch, which can be distinguished, is a branch representing H+/NO3exchangers. The proteins in this branch contain the GPGIP and GKEGP motifs and the proton-donating glutamate, which are all features in accordance with a H+/NO3exchanger. Moreover, if one considers the few plant species of which a (almost) complete genome is available, Vitis vinifera, Oryza sativa, Arabidopsis thaliana and Populus, all branches of the tree contain at least one protein of these species. This suggests an early diversification of the ClC proteins in plants and a low redundancy of function between the members of the different branches. Tissue and intracellular localization An important indication for the function of proteins is their functional localization. In this respect both tissue and intracellular localization are important. Those two levels of localization are mainly regulated in two different ways. Whereas tissuespecific expression and developmental stage-specific expression are controlled at the gene level, intracellular localization is controlled by sorting peptides present in the protein. However, the nature of the translation product (different splice forms or alternative translation initiation), controlled at gene or RNA level, can also affect 15 Chapter 1 intracellular localization (Millar et al., 2009). Tissue expression is studied by geneexpression studies or by promoter fusions. Lv et al., (2009) made a thorough analysis of tissue-specific AtClC-gene expression by RT-PCR and promoter-driven GUS expression. In their RT-PCR experiments ubiquitous expression of all ClC genes throughout the plant was observed with only small variations in the level of expression amongst the tissues. Such an expression profile suggests that the various ClC proteins have distinct individual functions and roles and have little or no redundancy. Interesting in this context, are the more or less inverse expression profiles of AtClCe and f. While AtClCe is more expressed in leaf, flower and silique, AtClCf is more expressed in root and stem. As suggested above these two proteins are probably functioning in either the chloroplast or mitochondrion. The histochemical study of Lv et al. (2009) also demonstrated that ClC members have individual functions. There expression patterns overlapped, but they had also their differences. The largest differences were observed between AtClCa, b, c, d and g, on the one hand, and AtClCe and f on the other. The temporal and spatial distribution of AtClCe and f suggest a relation with the presence of functional chloroplasts. No evident expression was observed for these genes in the root. Moreover, it has been shown that photosynthesis is disturbed in mutants of AtClCe (Marmagne et al., 2007). Another important issue is the subcellular localization of the ClC proteins. Predictions can be made using the Aramemnon web-based prediction tool (Table 2) but recently several studies using fusions of the AtClC proteins with fluorescent passenger proteins (FP) like Green Fluorescent Protein derivatives or Discosoma sp. Red (DsRed) has been used (De Angeli et al., 2006; Fecht-Bartenbach et al., 2007; Lv et al., 2009; Marmage et al., 2007) (Table 2). Also, a few ClC proteins of Glycine max and Oryza sativa have been localized using fusions to fluorescent markers (Li et al., 2006; Nakamura et al., 2006). However, as Moore and Murphy (2009) state: “Determining protein localization inevitably is an exercise in imperfection.” They (Moore and Murphy, 2009) and Millar et al. (2009) discuss the state of the art of intracellular protein localization, summarize the strengths and weaknesses of the employed protocols and give guidelines for validation of the localization of proteins. Amongst the issues they raise are the use of strong, heterologous promoters to generate aesthetically pleasing images and the positioning of the fluorescent passenger proteins in an construct. Another important feature, which increases the risk 16 strongly secretory.pathway weakly secretory.pathway weakly secretory pathway secretory pathway mitochondrion>chloroplast> secretory pathway mitochondrion > secretory pathway weakly secretory pathway AtClCa AtClCb AtClCc AtClCd AtClCe AtClCf AtClCg tonoplast golgi thylakoid golgi tonoplast tonoplast tonoplast Experimentally determined 35S 35S 35S 35S 35S 35S 35S 35S 35S 35S 35S Promotera C C C C C C C C C C C Location FPb Fecht-Bartenbach et al., 2007 Lv et al., 2009 Marmage et al., 2007 Lv et al., 2009 Marmage et al., 2007 Lv et al., 2009 Lv et al., 2009 Lv et al., 2009 De Angeli et al., 2006 Lv et al., 2009 Lv et al., 2009 Reference Table 2: Predicted and experimentally determined localization of the Arabidopsis thaliana ClC proteins a : promoter of the fusion protein of the ClC and fluorescent protein, 35S: Cauliflower Mosaic Virus 35S promoter; b: location of the fluorescent protein, C: C-terminal. Aramemnon prediction Protein 17 Chloride channels: A general introduction Chapter 1 of creating artifacts, is the routing of most proteins through various compartments before they reach their destination. This movement requires saturable transport and signaling systems, which can result in missorting (Moore and Murphy, 2009), especially in the case of over-expression. Moreover, during trafficking the various stations passed could have different amounts of the trafficking proteins. As a result higher protein amounts can be present at the intermediate stations and the fluorescence at these locations could outshine the fluorescence of the protein at the final destination. Even alternative locations, like the tonoplast or the plasma membrane could be reached due to congestion of the original route (Moore and Murphy, 2009). Hence, it can be asserted that in the case of membrane proteins, like ClC proteins, these artifacts are probable to occur. Membrane proteins have a lower degree of freedom and have to traffic via membranes. If we consider the guidelines for validation of the location of proteins as suggested by Millar et al. (2009), the experiments performed in order to determine the location of the ClC proteins are not optimal. Some of the major concerns are: 1) all studies use the Cauliflower Mosaic Virus 35S promoter, which results in an uncharacteristically high expression, presenting for membrane proteins an even larger ‘congestion’ problem, 2) in those studies the fluorescent passenger protein is attached to only one location in the protein. In the studies with the Arabidopsis, Glycine ClC proteins the FPs were all fused to the C-terminus of the proteins (De Angeli et al., 2006; FechtBartenbach et al., 2007; Li et al., 2006; Lv et al., 2009; Marmage et al., 2007). In the studies with the Oryza proteins the FPs were fused to the N-terminus (Nakamura et al., 2006). Although the results are in agreement with the ideas of the function of the ClC protein, this means care must still be taken with the interpretation of the recent fluorecence data on the localization of the ClC proteins. For example, the Glycine max ClC1 protein was placed in the tonoplast because of its co-localization with GmNHX1 (Li et al., 2006). NHX1 is an established tonoplast protein. However, in this study both proteins were visualized by the use of the strong Cauliflower Mosaic Virus 35S promoter. Although both proteins display a similar localization, we are doubtful about the result that shows a tonoplast localization. Apparently, both proteins accumulate in endomembrane vesicles which either outshine the proteins in the tonoplast, or are the result of congestion of the transport systems. Lurin et al. (2000) studied the localization of NtClC1 using fractionation and Western-blotting and concluded that this protein localizes to mitochondria. The 18 Chloride channels: A general introduction closest homologue of NtClC1 in Arabidopsis is AtClCc, which is experimentally located in the tonoplast (Table 2). In spinach a ClC protein was found in the outer envelope of chloroplast by mass-spectrometry and membrane fractionation (Teardo et al., 2005). This spinach protein gave three peptides that had sequences identical to the partial sequences of the AtClCf protein. However, the AtClCf protein is experimentally located in the Golgi membrane, but predicted to be targeted to the mitochondria (Table 2). Differences between patch-clamp and molecular studies Electro-physiological studies have been performed on plants for at least 60 years. In the early years only membrane potentials could be measured by impalement of electrodes into cells and tissues. This is a technique that only allows a general study of the behavior of the membrane potential of plant cells upon varying conditions. Presently the high-resolution electro-physiological method, the patch-clamp technique, allows the study of single conductances in membranes. However, both patch clamp and the impalement of electrodes are invasive techniques, which require isolation of cells or protoplasts or wounding of the tissue. Especially, the patch clamp technique revealed an enormous number of ion-conductances present in plasma membrane and tonoplast. However, the matching of conductances with proteins and their corresponding genes is a laborious process. Forward genetics appears difficult, starting from a current and trying to find a protein, which is responsible for the current. However, reverse genetics has proved useful in identifying the transporter proteins, responsible for the conductances observed by patch clamp. A nice example of such a study is the characterization of the AtClCa protein in the tonoplast of Arabidopsis thaliana (De Angeli et al., 2006). In this study it is shown that in two independent knock-out plant lines, in which AtClCa is absent, a certain nitrate current could no longer be observed in the tonoplast, indisputably matching the nitrate conductance to the AtClCa protein. Recently, a new electrophysiological technique has been developed. The Micro-Electrode Ion Flux Estimation (MIFE) technique allows the noninvasive and simultaneous monitoring of different ion fluxes from intact tissues with a high spatial and temporal resolution (Shabala et al., 1997; Newman, 2001; Tegg et al., 2005; Vreeburg et al., 2005; Lanfermeijer et al., 2008). Without damaging the tissue this technique is able to detect changes in fluxes of 19 Chapter 1 various ions by the use of ion-specific electrodes. However, no studies with this technique on ClC proteins are known to us. The physiology of anions The most abundant anions in plants are nitrate, chloride, sulfate, phosphate and malate. Carbonate, despite its low concentration, compared with other inorganic anions, occupies a particular status, as it plays a role in intracellular pH regulation and is the major carbon input for photosynthesis (Barbier et al., 2000). Most anions have important metabolic functions and most can be accumulated in the vacuole. In plant cells relative concentrations of anions vary, depending on the tissue and physiological and environmental parameters. In plant cells, the highest anion concentrations are found in the vacuole, while cytosolic levels are maintained in the millimolar range. Of these, the inorganic ions have to be taken up from the environment. In higher plants the root system is responsible for the uptake of nutrients and, thus, most inorganic anions. Subsequently, the anions (and their counter cations) are transported to the shoot by the transpiration stream. Although, most of the transport by the transpiration stream can be apoplastic and does not need passage of membranes, at least at the Casparian strips in the roots the ions have to enter the symplast. Hence, they have to pass the plasma membrane at least twice. Anion channels have been reported in the xylem parenchyma cells of barley roots (Wegner and Raschke., 1994; Kohler and Raschke. 2000; Kohler et al. 2002), root stellar cells of maize (Gilliham and Tester. 2005) and Arabidopsis root pericycle cells (Kiegle et al. 2000). Kohler and Paschke (2000) identified fast and slow activating anion channels in barley xylem parenchyma cells. After the anions have arrived at the sink tissue (growing leaves, fruits, etc) they have to enter cells. It is hypothesized that the influx of chloride occurs via H+ /anion symporters or OH- /anion antiporters (Zeiger et al., 1978). Anion fluxes in the plant cells The different cell compartments require all their specific concentrations of metabolites and minerals. These concentrations are all maintained by transport systems, which are energized by ion-gradients and potential differences, generated by the primary pumps. Anion fluxes play an important role in these processes. First of all 20 Chloride channels: A general introduction in the generation of the proton motive force. They relieve the membrane potential generated as a consequence of the transmembrane transport of protons. When for each proton moved an anion is transported in the same direction the membrane protential does not rise so drastically. This allows more protons to be transported and the proton gradient to become larger than in the absence of anion fluxes. Although the driving force on protons is thereby reduced, the power for transport of solutes coupled to protons is increased. This is the so called shunt-function of anion fluxes. The second function of anion fluxes is related to the role of anions as osmotically active solutes. The accumulation of anions and their counter ions in cells drives the uptake of water into the cells and, subsequently, the generation of cell turgor. Cell turgor, in its turn drive cell expansion and cell growth. Their role in water movement and turgor regulation makes anion fluxes also important in the opening and closing of stomata. Stomata are microscopic pores in the aerial parts of the plant, which provide a passageway for CO2, that is needed for photosynthesis, to enter the leaf. Guard cells surround the pore and the swelling and shrinking of these cells modulate stomatal pore size by coordinating responses to environmental and physiological factors, including light, temperature, Ca2+, and the plant hormone abscisic acid. During stomatal opening and closing, chloride and malate are the major anionic species involved in turgor generation for opening. It has been known for several decades that guard cells can take up chloride ions during stomatal opening, but the molecular mechanism of that is still not fully understood. The role of pH in plant cell growth Many different physiological events in plant cells are regulated by changes in pH or depend on proton gradients. In plant cells pH is well characterized as a regulator of processes, such as modulation of Ca+2 signaling, protein synthesis, and enzyme activity. In plant cells, according to the plant species and the technique of measurement used, cytosolic pH values in resting conditions are between 6.8-7.9 (Guern, 1991). In response to osmotic stress and hormone treatment, the cytosolic and apoplastic pH both fluctuate (Guern., 1991; Tretyn et al., 1991; Nuhse et al., 2000). In plant cells, the PM H+-ATPase is the primary active transport system and mainly responsible for generating the membrane potential and the proton gradient and maintaining the cytosolic pH (Assman and Haubrick., 1996). It is also known that changes in cytosolic pH can act as a second messenger in plant cells (For review, see 21 Chapter 1 Felle, 1989; Guern et al., 1992; Zimmermann et al., 1999). According to the acid growth theory (Rayle et al., 1970; Cleland, 1971; Hager et al., 1971) , low pH induces rapid cell wall loosening and cell elongation. In pea leafs the increased extrusion of protons by the activated PM H+-ATPase results in the enlargement of the pH gradient and the hyperpolarization of membrane potential across the plasma membrane, which result in an increase of the proton-motive force. This stimulates the uptake of nutrients and osmotically active solutes. Subsequently, water is also absorbed as a result of osmosis and cell turgor increases (Staal et al., 1994). The extracellularly located expansins react to the acidification of the cell wall by activation of their cellulose and hemicellulose degrading properties (Cosgrove, 1998), while Ca2+-pectin cross-links are broken as a result of displacement of the Ca2+ by H+ (Proseus & Boyer, 2006; den Os et al., 2007). Both these reactions increase the cell wall elasticity. The increases in turgor and cell wall elasticity result in cell expansion. But also in roots the elongation is regulated by acid growth phenomena (Edwards and Scott., 1974; Buntemeyer et al, 1998; Peters and felle, 1999). In Arabidopsis root, changes in root cap pH are required for the gravitropism (Fasano et al 2001). Anion and cation channels play an important role in this growth process. The movement of cations in the opposite direction or an anions in the same direction as the proton flux, can aid in the generation of the proton gradient (the shunt function; see above) and increase the extracellular acidification. Changes in the activity of ion channels can therefore result in changes in the membrane potential and in the pH gradient (Johannes et al., 1998) and therefore the ability of cells to grow. Secondly, anions are used as osmotics and a change in the transport capacity of these solutes can affect growth. The importance of anion fluxes is demonstrated by the fact that in AtClCd knock out mutants root growth is reduced compared to wildtype at a slightly alkaline pH of the growth medium (Fecht-Bartenbach et al). Perspectives Although their importance in processes like pH homeostasis, growth, abiotic and biotic stress resistance, osmotic acclimation, nutrient uptake and transport has been amply demonstrated, the physiological characterization and the knowledge of the position of ClC proteins in the complex network of membrane transport and solute fluxes is still incomplete. Mutant analysis, combined with detailed physiological 22 Chloride channels: A general introduction studies can provide us with much of the data necessary to fill these gaps in our understanding. In this study we used knock-out mutants to elucidate the role of members of the AtClC transporter family with the use of the MIFE technique. In this thesis the role of AtClCa and AtClCd in pH homeostasis and metal-tolerance has been demonstrated 23 24 Chapter 2 Generation and characterization of anion channel mutants in Arabidopsis thaliana Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1 1 Department of Plant Biology, University of Groningen, 9750 AA Haren, the Netherlands 2 Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources University (SANRU), Sari, Iran 25 Chapter 2 ABSTRACT The chloride (Cl-) and nitrate (NO3-) anions are major inorganic constituents of plant cells. These anions play a role in turgor maintance, signaling (Cl-) and metabolism (NO3-). An important group of anion transporters are the Chloride Channel (ClC) proteins, which facilitate the transport of Cl- and NO3- ions. These proteins are reported in all plant cell membranes and appear to be involved in various physiological processes such as the control of stomata movements, xylem loading and plant pathogen interactions. To study the role of these ClC proteins in plants we obtained three T-DNA insertion lines for the AtClCa, b, and d genes. In order to characterize the ability of these genes to complement each other we generated the three double and the single triple mutants. Seed germination on media with supplemented with different concentrations of NaCl, CholineChloride, KCl and KNO3 did not show a difference between the different genotypes. The Micro-Electrode Ion Flux Estimation technique was used to monitor and characterize H+ and Cl- fluxes from intact leaf tissue and the changes in these fluxes induced by changes in the external NaCl concentration. Although NaCl induces a transient change in the fluxes of chloride and protons, the responses of the mutant plants were not distinguishable from wild type. Also morphologically the mutant plants were similar to the wild type. However, when the pH of the growth medium was increased from 5.8 to 6.2 root growth in mutant lines, Atclca and Atclcd, the double mutant Atclcad and triple mutant Atclcabd was reduced. 26 Generation and characterization of anion channel mutants INTRODUCTION Although chloride concentrations in plants are considerable, usually the compound is considered to be an essential micro-nutrient (Broyer et al. 1954). Chloride is essential for the optimal activity of several enzymes. In photosynthesis chloride plays a role in the water splitting complex. Chloride also plays an important role in osmoregulation and growth (Barbier-Brygoo et al. 2000). Cell expansion is driven by turgor pressure which results from the osmotically driven uptake of water into the cell. Water enters the cells due to the high concentrations of potassium and anions, like chloride and malate. During rapid growth, chloride accumulates in the vacuole of plants cells, where concentrations up to 40 mM can be measured (BarbierBrygoo et al., 2000). A specialized, but closely related, role is the involvement of chloride in the opening and closing of stomata. Stomata open as a result of an increase in turgor. This turgor increase results from the uptake of water into the guard cells. The continuous redistribution of chloride between the guard cells and the surrounding tissue upon changing conditions, is one of the mechanisms controlling the opening and closing of the stomata (Pandey et al 2007). Another role of chloride is associated with the negative charge of the ion. Transport of anions across a membrane can compensate for the currents, which result from transport of positive ions (like protons), thereby allowing a steeper concentration gradient of these cations across the membrane. In this context a role of chloride has been demonstrated in proton transport by the plasma membrane H+- ATPase and the vacuolar V-type ATPase (Felle 1994). Other transport processes were chloride is either directly of indirectly involved are for instance Na+/H+ and HCO3-/ Cl- exchange (Jentsch et al 2002). Mechanistically, at low external concentrations, Cl- can be taken up via a H+/ Cl- cotransporter, while at high Cl- concentrations the anion might enter passively through anion channels. Active chloride uptake and transport by roots has been demonstrated (reviewed by White and Broadley, 2001) and also Cl- transport to the shoot is controlled by the roots (Sauer, 1968; Downton, 1977; Storey et al., 2003). It is unknown which systems actually mediate Cl- uptake into the symplast of the root. Considering the concentration gradient, which exists between the apoplast and the symplast, the systems involved should be active transporters. Only under high saline conditions the concentration gradient might be in favor of passive uptake of Clmediated by chloride-specific channels or more non-specific anion channels. 27 Chapter 2 An important group of anion transporting proteins is the Chloride Channel (ClC) proteins. Seven ClC genes have been identified in the Arabidopsis genome. ClC genes are present in most organisms: their presence has been shown in fungi, bacteria, animals, and plants. The ClC protein family has been best characterized in mammals, in which nine different ClC members are present. These proteins can be divided into three groups based on their localization in the plasma membrane or intracellular membranes (Jentsch et al., 2002). The 3D structure of these proteins has been solved (Dutler et al., 2002; Dutzler et al., 2003) which allows a detailed study of the structure-function relationship in these proteins. In Arabidopsis the seven members can be divided into two groups (Lv et al., 2009). This division is based on their molecular structure and seems to be related to their mode of action. The seven proteins have been demonstrated as a group to be present in cell membranes where the different members have their own specific localization (De Angeli et al., 2007; Marmagne et al., 2007; Lv et al., 2009). They are involved in turgor and osmoregulation, membrane potential control, vesicle trafficking, nutrient transport, stomatal movement, and resistance to heavy metals and salt stress (Barbier-Brygoo et al., 2000; Skerett and Tyerman., 1994; Tyerman et al., 1997). Despite the key role of chloride in various processes, little is known about the role of the ClC proteins in Cl- homeostasis and, for instance, salinity stress. Moreover, interaction and coordination of the activities of the seven ClC proteins can be expected. In order to address these issues we set out to isolate mutants of ClC genes. We have identified three Arabidopsis mutants lines which carry a T-DNA insert in the AtClCa, AtClCb, and AtClCd genes, respectively. We show the absence of transcripts of these genes in the mutant plants and made the three double mutants and the triple mutants and performed a preliminary evaluation of those six mutant lines. Under the conditions we used no obvious phenotypes were observed for the single mutants. We could only observe a phenotype in the double and triple mutants containing insertions in both the AtClCa, and AtClCd genes when the plants were grown at a pH higher than 5.8. 28 Generation and characterization of anion channel mutants MATERIALS AND METHODS Plant material and growth conditions Seeds of Arabidopsis T-DNA insertion lines were obtained from NASC (AtClCa: WiscDsLox477-480I4; AtClCb: SALK_ 27349; AtClCd: SALK_42895). For in vitro growth experiments, seeds were surface sterilized with gaseous chlorine (derived from acidified sodium hypochlorite) and sown on a half-strength Murashing and Skoog medium (MS/2), supplemented with 1% w/v sucrose and buffered with 10 mM MESTris, pH 5.8 and with 0.8% w/v of agar. For the selection of the mutants 50 μg/ml kanamycin was added. The dishes were sealed with surgery tape (3M). For the growth analysis the proper salts and additives were added or the pH was adjusted accordingly. For growth on soil, seeds were surface sterilized and sown in pots contain an organic-rich soil (TULIP PROFI No.4, BOGRO B.V., Hardenberg, The Netherlands). All dishes and pots, were incubated in the dark at 4oC for 3 days. Subsequently, the dishes were transferred to growth chamber set at a 16h/8h light light/dark cycle, 20±2 o C temperature at 72% relative humidity while the pots were transferred to the greenhouse at 20±1 oC during the 16 h day period and 18±1 oC during the night period at 72% relative humidity and with supplementary light when necessary, or to the growth chamber with the conditions as described above. Screening for T-DNA insertion mutants The T-DNA insertion disrupting AtClCb and AtClCd were identified in the database at the SALK Institute Genome Analysis Laboratory (Salk-027349 for AtClCb ,Salk-042895 for AtClCd) and Wiscd Siox 477-480i4 was identified in the WiscDsLox T-DNA collection for AtClCa. To obtain homozygous mutants lines, resistance to kanamycin was checked and PCR-based screens with the respective primers for each T-DNA were performed according to Salk and Wisc protocols (Table 1). To generate double mutants, single mutant plants were crossed to each other. The genotypes of F1 plants were checked using a PCR-based screen with respective primers for each gene (Table 1). All F1 double mutants (Atclcab, Atclcad, and Atclcbd) were allowed to self-pollinate. Seeds were sown on plates. Plants were subsequently checked again with the primer sets of the respective T-DNAs (Table 1) and segregated in the F2 population progeny in a 1:15 ratio. A triple mutant was 29 Chapter 2 created by crossing between two double mutants Atclcad and Atclcbd. F1 progeny from this cross were allowed to self-pollinate. Seeds were sown and the progeny was checked and analyzed for their genotypes (Figure 1). Figure 1. The T-DNA insertion in the three single mutant parental lines Left: The position of the T-DNA insertions in AtClCa, AtClCb and AtClCd genes. Right: PCR-based markers for the presence and absence of the T-DNA insertions. Lane 1: Homozygous wild type genotype, 2: Heterozygous genotype 3: Homozygous T-DNA insertion genotype. Indicated on the left are the sizes of the MW markers in the marker lane and on the right the gene studied is indicated. Reverse Transcript PCR Total RNA from shoots and roots was isolated according to Chomczynski et al. (1997) using TRIZOL reagent (Invitrogen). First-strand cDNA synthesis on 3μg of total RNA was done using reverse transcriptase (Fermentas) and a Oligo(dT) primer according to the suppliers manual. Two microliters from the total 20 μl volume of cDNA was used for PCR amplification using polymerase in a 50 μL reaction volume according to the following program: 94°C for 2 min, then 32 (AtClCa and AtClCd) or 35 (AtClCb) cycles consisting of 94°C for 15 s; 54°C for 30 s (AtClCa and AtClCd), 45°C for 30 s (AtClCb) ;72°C for 1 min and 72°C for 5 min . Table 1 shows the RNA-specific primers for the ClC genes and the control gene, tubelin. Ion flux measurement in MIFE technique Net fluxes of H+ and Cl- from leaves were measured using H+- and Cl--selective microelectrodes with the MIFE technique (Shabala et al., 1997; Newman, 2001; 30 Left primer 5’-CCTACCATGATGTGACCTCCTC 5’-GGAACTGGATTAGCTGCTGTG AtClCd 5'-AGGCTTGTAGAATGTTGTAT 5’-TTGACTGTTGGAGTTCCACT 5'- ACACCAGACATAGAGCAGAAATCAAG 5'-ACTGCATCTTGGGGCTTT 5’-TTTACACATTAGCTGTAG 5’-GAGCCTTACAACGCTACTCTGTCTGTC AtClCb AtClCd β-Tubelin Table 1: . The PCR Primers for T-DNA confirmation and gene expression analysis, used in this study. 5'- GAAATGCTTGTAGAATGTTA 5'-ACTGCATTTTGGGTCTTA AtClCa 31 5’-TGGTTCACGTAGTGGGCCATCG 5’-GTAATCGGTGGAATTCTTGGG 5’-GGAGTTCTGTAGCCCCAGTTG AtClCb Gene expression analysis 5’-TGGTTCACGTAGTGGGCCATCG 5’-TGTCAATGCCATTAAGGTAAGC 5’-GCGTGGACCGCTTGCTGCAACT Left Border primer 5’-CCAGATAAATCTTCACTTTCTGATGG Right primer AtClCa T-DNA insertion Target Generation and characterization of anion channel mutants Chapter 2 Lanfermeijer et al., 2008). Microelectrodes were pulled from borosilicate glass capillaries (GC150-10; Harvard Apparatus) and silanized with tributylchlorosilane (Fluka 90974). The H+- selective electrodes were back filled with 15 mM of NaCl plus 40 mM of KH2PO4 and front filled with Hydrogen Ionophore II (Cocktail A; Fluka 95297). The Cl--selective electrodes were back filled with 500 mM of KCl adjusted to pH 6 with NaOH and front filled with Cl− (chloride ionophore I, cocktail A, Fluka 24902). The response of the electrode was typically 48 mV/decade. This somewhat low response voltage was always observed and is considered to be the result of a small leakage of ions in the tip of the electrode. Apparently, the sealing between the silanized glass and the ionophore mix was not optimal. To avoid potassium ion leakage from the reference electrode, the reference electrode was placed in a compartment different from the measuring chamber. The two compartments were electrically connected via a salt bridge, which consisted of 300 mM (NH4)2SO4 in 2% (w/v) agar. Leaf material was immobilized on a glass capillary using grease (consisting of 49% petroleum jelly, 34% bee wax, and 17% lanoline) with the abaxial epidermisless side exposed to the solution and placed in a measuring chamber with a transparent bottom. The chamber was filled with 1 ml of basic measuring solution (BMS; 1 mM KCl plus 0.5 mM CaCl2, pH 5.8), submerging the leaf material. The whole chamber was placed on a Nikon TMS inverted microscope. The ion-selective microelectrodes were mounted at an angle between 30° and 40° with the horizontal in a holder (MMT-5; Narishige) on a three-way piezo-controlled micromanipulator (PCT; Luigs and Neumann) driven by a computercontrolled motor (MO61-CE08; Superior Electric). The electrodes were positioned 10 μm from the surface of the tissue. During measurements, the distances between the tissue and the electrodes were changed from 10 to 50 μm at a frequency of 0.1 Hz. The chemical activities of H+ and Cl- in solution were continuously recorded at the two distances from the tissue, and from these data, net H+ and Cl- fluxes were calculated according to Newman (2001). Whereas positioning the material in the MIFE apparatus was performed under light conditions (150 μmol·m-2·s-1), the measurements were performed in the dark at ambient room temperature. 32 Generation and characterization of anion channel mutants RESULTS Isolation of homozygous knockout lines with PCR-based screen The obtained three single homozygous T-DNA insertion lines in Arabidopsis ecotype Columbia in AtClCa, AtClCd and AtClCb were used to generate the three double and the one triple mutant combinations. The exact locations of the T-DNA insertions in the loci At5g40890, At3g27170 and At5g26240 were obtained from the TAIR database (http://www.Arabidopsis.org) (Figure 1a). The correct genetic conformation of the three parental single mutant lines was confirmed by PCR (Figure 1b). Tissue specific expression of the AtClCa, b, and d genes Transcripts of AtClCa, and d could be detected in both the shoot and the root. Transcripts of AtClCb could only be detected in the root (Figure 2). In the T-DNA insertion lines only transcripts of the ClC genes, which were not disrupted, could be detected (Figure 3). Figure 2. Semi-quantative expression of AtClCa, AtClCb and AtClCd in different plant tissues. Shown are the amounts of PCR product resulting from 32 (AtClCa and AtClCd) or 35 (AtClCb) PCR cycles. The Tubulin transcript levels are shown as a loading control. The used primers for the respective genes are shown in Table 1. Figure 3. The absence of expression of the AtClCa, AtClCb and AtClCd genes in their respective T-DNA insertion lines. The three genotypes were analysed using the primers shown in table 1. The Tubulin transcript levels are shown as a loading control. 33 Chapter 2 Ion fluxes The MIFE technique allows monitoring of ion fluxes in and out of almost intact tissues. We explored the potential of this technique to study NaCl induced changes in ion fluxes in leaf tissue. We focused on H+ and Cl- fluxes because the potential role of the so-called ClC proteins in Cl- fluxes and the potential linkage between this flux and the H+ flux (Figure 4). Essential in this figure is the meaning of the graphs. By convention a positive flux means an influx of the ions, both in the case of cations and anions (Newman 2001). To relate this to the currents measured in electrophysiology an influx of cations causes an inward current and a depolarization while an influx of anions causes an outward current and a hyperpolarization. Suddenly challenging the leaf tissue with 65/75 mM of NaCl caused the influx of protons transiently to increase from around 25 μmol·m-2·s-1 to 150 μmol·m-2·s-1. After 20 minutes the proton influx returned to its pre-salinity values and started slowly to change into a small efflux. Chloride fluxes were zero before NaCl was added but as soon as 65 mM of Cl- was added this changed to an influx of chloride. However, no differences in the response to the sudden application of NaCl of the mutants mutually and wild type could be observed. Figure 4. Typical changes in proton and chloride fluxes from wildtype Arabidopsis thaliana (upper panel) and the Atclca genotype (lower panel) leaf tissue induced by 65 mM of NaCl. The vertical line indicates the moment of the addition of 65 mM of NaCl. When the flux becomes more positive, this means either an increase of the influx or a reduction of the efflux. Typical experiments of at least three experiments are shown. 34 Generation and characterization of anion channel mutants Phenotypical characterization of mutant plants For none of the mutant lines a difference in their growth and development could be observed when they were grown on soil (data not shown). The effects on germination were studied on MS/2 agar media supplemented with different concentrations (0-300 mM) of NaCl, KCl, KNO3 and cholinchloride (Figure 5). No differences were observed between the six mutant lines mutually and in comparison with wild type. However, germination was affected by the presence of different salt species. Germination was the least inhibited by KCl. A 50% reduction of germination was obtained at KCl concentrations above 275 mM. For both choline chloride and NaCl the concentration at which 50% reduction of germination was obtained was around 250 mM. The largest reduction in germination was observed when seeds were allowed to germinate on KNO3, in this case 50% germination was already obtained at 200 mM. In order to study the effect on growth and development plants were allowed to germinate and grow on vertical plates under a large number of different physiological conditions, like different salts, different concentrations of these salts and different pHvalues. Whereas, no differences could be observed when plants were grown under standard conditions and the various salt conditions (data not shown), a difference in the growth of some plant lines could be observed when the plants were grown on MS/2 media with a higher pH: pH 6.2 instead of 5.8 (Figure 6). The single mutants Atclca and Atclcd had a significantly reduced primary root length compared with the wild type and the Atclcb mutant (Figure 6). Combining the mutations showed that when AtClCb was also absent the effects of the absence of AtClCa and AtClCd were reduced. The double mutant Atclcad showed no additive effect of the presence of both disrupted genes. However, the triple mutant Atclcabd showed the largest reduction in root elongation (Figure 6). 35 Chapter 2 Figure 5a. Germination of Arabidopsis seeds of the 8 genotypes on a half strenght MS medium, supplemented with the indicated salts. Upper panel: Concentration dependent inhibiton of germination. Lines are only drawn through the two outermost datasets. Datapoints are the average of 3 experiments and the error bars indicate the standard deviation. Lower pannel: Germination of the 8 genotypes at a single salt concentration. The data are same data as shown Figure 5a but for clarity shown separately. Datapoints are the average of 3 experiments and the error bars indicate the standard error 36 Generation and characterization of anion channel mutants Figure 6 Upper panel: Primary root growth of the indicated Arabidopsis genotypes on a half strenght MS medium at two different pH values. Upper panel; pH 5.8; lower panel: pH 6.2. Length of the reference is 2.5 cm. Lower pannel: Length of the primary root of the indicated Arabidopsis genotypes on a half strenght MS medium at two different pH values. Datapoints are the average of 4 experiments and the error bars indicate the standard deviation. wt indicates wild type; a till adb indicate genotypes Atclca till Atlcabd. 37 Chapter 2 DISCUSSION ClC proteins are an enigmatic group of proteins in plants. This family was named based on the annotation of the first protein of this family, which was isolated from Torpedo marmorata electric organ and characterized as being a chloride channel (Jentsch et al., 1990). However, it has become oblivious that the function of these proteins is not as clear cut as the name suggests. Reports have shown that these proteins can function as channels but also can function as co-transporters and not only as transporters of chloride but also of nitrate-ions (Bergsdorf et al., 2009). The MIFE technique has shown to be very useful in assessing fluxes from and out of almost intact tissues and the effect of various manipulations, which range from elicitors and hormones to light and solutes (Lanfermeijer et al., 2008; Vreeburg et al., 2005; Zepeda-Jazo et al., 2008). This technique is the link between electrophysiology and whole plant physiology. We presently explored the potential of this technique to study the physiological relevance of the Cl- fluxes in plants. Using a double barreled configuration we assessed the changes of the H+ and Cl- fluxes when plants were suddenly exposed to a concentration of 65/75 mM of NaCl. The addition of such a concentration has two effects. Firstly, the external concentrations of Na+ and Clchange drastically and secondly the external water potential drops. As a result of the latter water will move osmotically out of the cells resulting in a decrease of the turgor pressure in the cell. Turgor pressure has been shown to control ion-fluxes, either via mechano-sensitive channels (Chang et al., 1998) or via the plasma membrane H+ATPase (Sabala and Lew, 2002). We observed a transient increase in the proton efflux upon NaCl exposure followed by a slow change into a small proton efflux. The time course of this phenomenon can be compared with the observations of Shabala et al. (2005) and Cuin et al. (2008), although those were made on roots. Their membrane potential measurements show a transient depolarization and a partial recovery of the membrane potential 10 to 15 minutes after the addition of salt. Our observed transient influx of protons fits well with the transient depolarization and while the partial recovery could be due to the emerging efflux of protons. However, Shabala et al. (2005) did not observe this transient efflux of protons, they only observed the decreasing influx. The increase of chloride influx is caused first of all by the concentration gradient which favors an influx and, secondly, by the depolarization of the membrane potential. Our observations are in accordance with those of Shabala et al. (2005), who observed an increase of the chloride flux from 40 to 100 nmol·m-2·s-1 38 Generation and characterization of anion channel mutants upon the exposing the barley leaf tissue to 20 mM of NaCl. The slow decrease of the chloride flux could be ascribed to either the slow recovery of the membrane potential or to the equilibration of the Cl- ions across the membrane (Figure 4). We could not observe a difference between the response of the wild type and the mutants in the MIFE system. Single mutants reacted in an identical manner to a sudden exposure to 65 Mm NaCl (data not show), which implies that disruption of the three ClC-proteins studied does not affect the observed fluxes. Also no effects of the disruption of the ClC genes alone or in combination with the others could be observed on germination. The effects of the different salt species show that KCl is the preferred salt for germination. This salt probably is accumulated rapidly and without any problems and increases the ability of the seedling to take up water and grow. Sodium can not replace potassium in these experiments due its toxicity and nitrate can not replace the chloride. Nitrate is probably partly assimilated and turned into amino acids and proteins, while maybe at higher nitrate concentrations the nitrate is not fully assimilates and becomes nitrite. Nitrite is toxic and will inhibit growth. Hence, equivalent amounts of chloride and nitrate can not exert the same effect on the water potential in growing cells. Also other experiments failed to show differences between any of the mutants and the wild type suggesting either delicate roles of the chloride channels, which could not be observed by our crude observation methods. Moreover, it shows that the role of the ClC proteins is not that obviously related with chloride and for instance salt and salinity stress. The experiments on root growth show an involvement of the ClC proteins with growth. Two explanations can be given. Firstly, the AtClCa and AtClCd proteins are involved in establishment of the proton-motive force (PMF). Root and cell growth, in general, is driven by pH gradient across the cell. The proton motive force resulting from this gradient across the membrane drives the uptake of solutes necessary from generation of a low water potential, which subsequently is needed for the osmotically driven uptake of water and the generation of turgor pressure. When taking the external pH into account it is more difficult to establish the same PMF at the higher pH. This is because at higher pH more protons are needed to achieve the same pH gradient. And more protons transported across the membrane result in a larger membrane potential. Hence, at higher external pH values it is advantageous to compensate for the positive charge moved across the membrane when a proton is extruded in order to limit the 39 Chapter 2 polarization of the membrane. Polarization of the membrane impedes the transport of the positively charged proton. Next to the coordinated influx of potassium ions the coordinated efflux of chloride-ions can be used for this charge compensation. In this model removing AtClCa and At ClCd hampers this process, reduces the generation of the PMF and subsequently inhibits root growth. Secondly, the AtClCa and AtClCd proteins are required for the accumulation of the osmotically active anions, Cl- and NO3-, which is needed for cell expansion. Absence of the transporters limits the uptake of these osmolytes and, thus, reduces growth. Recently a study appeared also describing a similar effect of the disruption of the Atclcd mutation of root growth in relation with pH of the external medium (FechtBartenbach et al., 2007). They also suggested a role of the AtClCd protein in charge compensation in relation with the establishment of a pH-gradient across the membrane of a Golgi-derived transport vesicle. However, the AtClCd protein has all characteristics of being an H+/2A- antiporter and this is difficult to match with a shunt function of this system. Also AtClCa and AtClCb show characteristics which suggest that these proteins are also H+/2A- antiporters, however, these proteins are considered to be localized in the tonoplast membrane (Lv et al., 2009). The root-specific expression of the three ClC proteins is highly similar, with expression mostly restricted to maturation zone, and primarily in the vascular tissues (Lv et al., 2009) although AtClCd seems to have considerable expression in the division zone as well. In the study of Lv et al. (2009) the expression levels of AtClCa and AtClCd were comparable, while AtClCb had a lower expression level. Although AtClCa and AtClCd are localized in two different membranes their effect on root growth could be similar. Cell growth needs an increase in volume but also an increase in surface or in other words of plasma membrane area. The increase of volume requires the generation of a PMF or the uptake of osmotically active solutes. If this is disturbed by disruption of tonoplast-located AtClCa cells will not grow. The increase of plasma membrane surface is accomplished by the continuous delivery of plasma membrane material (lipids and proteins) by golgi-derived vesicles. The trafficking of these vesicles is controlled by their internal pH. Hence, if the establishment of this pH is interrupted by for instance the removal of AtClCd the plasma membrane can not increase its surface area, hence, cells and, thus, roots stop growing. 40 Generation and characterization of anion channel mutants Our results point to a role of ClC proteins closely related to energizing of the membrane. Apparantly ClC proteins are important electrical circuits in the membrane allowing the generation of steep ion gradients in combination with moderate membrane potentials. As such, these proteins play an important role in the general physiology of the cell. Further research will investigate the role and involvement of ClC proteins in growth. 41 Chapter 2 ACKNOWLEDGEMENTS I would like to thank Bert Venema for his help in the greenhouse.This work was supported in part by a grant from the Ministry of Science, Research and Technology of the Islamic Republic of Iran. 42 Chapter 3 NO3- and H+ fluxes in Atclcd mutants of Arabidopsis thaliana Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1 1 Department of Plant Physiology, University of Groningen, 9750 AA Haren, The Netherlands 2 Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources University, Iran 43 Chapter 3 ABSTRACT In the Arabidopsis genome seven ClC genes have been identified, including AtClCa and AtClCd that are involved in nitrate accumulation in the vacuole and cell expansion, respectively. The effect of NO3- on H+ and Cl- fluxes from leaf tissue of Arabidopsis was determined for wildtype and and AtClCd T-DNA insertion mutants. When leaf tissue of wildtype plants is exposed to increased levels of nitrate in the external medium the influx of protons and chloride ions is decreased. These effects are absent of much smaller in the AtClCd mutant plants These results are consistent with a function of the AtClCd protein as H+/anion antiporter. 44 NO3- and H+ fluxes in Atclcd mutants INTRODUCTION The protein family of chloride channels and anion transporters (ClC) is widely distributed in prokaryotes and eukaryotes. They play important roles in cell signaling, osmo-regulation, nutrient uptake and distribution, and metabolism. In higher plants the first anion transporter proteins were described in tobacco and their identity was inferred from homology with the ClC family of voltage-gated chloride channels in animals (Lurin et al., 1996). Since then the function of only a few of these proteins in plants has been established. In the Arabidopsis genome seven ClC genes can be identified (AtClCa-g), and all of them have been isolated (Hechanberger et al., 1996; Geelen et al., 2000; Lv et al., 2009). The intracellular localization of the respective proteins was deduced from expression studies with green fluorescent protein (GFP) fusion proteins (Hechenberger et al., 1996; Lv et al., 2009), but direct evidence for their transport activity in plant cells is still lacking. GFP fusion protein studies point to a subcellular localization of AtClCa, -b, -c and -g in the tonoplast, AtClCd and AtClCf in the Golgi membrane and AtClCe in the thylakoid membrane (De Angeli et al., 2007; Marmagne et al., 2007; Lv et al., 2009). However, most of these studies used the 35S promotor, resulting in very high expression levels, possibly resulting in a-typical localization of the fluorescent protein (see Chapter 1). Lv et al. (2009) found that the highest expression of AtClCa and AtClCd is in the leaf and the root. As uptake of Cl- is normally against its electrochemical gradient, which requires an active mechanism, for instance, through a symporter with H+ as the second ion (the suggested mechanism in plants (Felle, 1994)). Several mammalian ClCs have been recognized to function as chloride/proton exchangers (Picollo and Pusch 2005; Scheel et al., 2005). In plants the function and mechanism of the different ClCs is still under debate. A common characteristic of chloride channels is that they are also permeable for nitrate (Pusch et al., 1995), a feature that in animals is of limited physiological importance. In contrast, the nitrate transporter function of ClCs in plants could be the most important one. In Arabidopsis thaliana AtClCa even appears to be much more selective for NO3-, I- and Br- than for Cl- (De Angeli et al., 2006). As the concentrations of cytosolic NO3- and Cl- in plant cells are approximately 4 and 10 mM, respectively (Felle, 1994; Miller and Smith, 1996; Lorenzen et al., 2004), plant membrane potentials range from -150 to -220 mV (negative inside), and in most soils the concentration of NO3- and Cl- is typically in the low millimolar to micromolar 45 Chapter 3 range (Marschner, 2002), the uptake of nitrate (and of chloride) is only possible by a co-transporter system. Nitrate uptake in roots of Arabidopsis is mediated by the wellcharacterized transporter proteins NTR1 and NTR2. The absorbed nitrate can either be reduced by nitrate reductase, a cytosolic enzyme, or be transported to the shoot. In contrast to the transporters that mediate the uptake into the root, the transporter proteins that are involved in nitrate distribution in various tissues and in the nitrate accumulation in the vacuole are less well studied. Mutant characterization studies indicate that AtClCa (Geelen et al., 2000; De Angeli et al., 2006) and AtClCc (Harada et al., 2004) are involved in the regulation of nitrate levels in Arabidopsis. FechtBartenbach et al. (2007) showed that AtClCd and V-ATPase support growth in expanding cells and they suggest a more complex connections between ClC proteins and the proton gradient. Disruption of AtClCd results in hypersensitivity to concanamycin A, a specific inhibitor of V-type ATPase (Dettmer et al., 2006). De Angeli et al., (2006) reported that AtClCa functions as a 2 NO3-/1 H+ antiporter that is able to accumulate nitrate in vacuole. Lv et al., (2009), based on sequence comparison with ClCs characterized in other species, postulated that AtClCd, which belongs to the same subclass as AtClCa, may function as an anion/proton antiporter. In the present study, the effect of nitrate in the experimental solution on Cl-, H+ and NO3- fluxes in leaf tissue of wildtype and Atclcd mutants was monitored with the MIFE technique. The aim was to test the hypothesis that anion transporters located in the tonoplast are essential in cytoplasmic pH homeostasis. Exposure to different anions should not only lead to modifications in the fluxes of other anions, but also to changes in the proton fluxes across the plasma membrane. 46 NO3- and H+ fluxes in Atclcd mutants MATERIALS AND METHODS Plant material and growth conditions Arabidopsis thaliana (wild type ecotype Columbia and the AtClCd T-DNA insertional mutant) seeds were obtained from the Salk collection (http://signal.Salk.edu/tdna_ protocols.html). For the AtClCd insertional mutant line the SALK line 42895 was selected. Seeds were surface sterilized with gaseous chlorine, sown in pots containing an organic-rich soil (TULIP PROFI No.4; BOGRO B.V. Hardenberg, The Netherlands) and kept in the dark at 4oC for 3 days. The pots were then transferred to a growth chamber with a 16h/8h light/dark cycle and a temperature of 20±2oC for 20 days. Selection and isolation of the T-DNA insertion mutant of Atclcd The T-DNA insertion disrupting the AtClCd gene was identified in the database at the SALK Institute Genome Analysis Laboratory. Homozygous mutants lines were identified by screening for resistance to kanamycin and by a PCR-based screen with selected primers for the gene and left border primer according to Salk protocol (see Chapter 2). The plant line with the insertion in this gene is referred to as Atclcd. Reverse Transcript PCR analysis Total RNA was extracted from shoots and purified using the Qiagen RNeasy plant mini kit according to the manufacturer’s protocol. RNA was measured by nano drop machine and then first strand cDNAs was synthesized from total RNA (2μg) isolated using reverse transcriptase (Fermentas, USA) and oligo (dT) primer. Tubulin primers were included, for presence of equal amount of cDNA. For amplification, PCR was performed at an annealing temperature of 55oC, using 32 cycles. MIFE measurements Net fluxes of Cl-, NO3- and H+ were measured non-invasively using the MIFE (Micro Electrode Flux Estimation) technique essentially as described in Shabala et al., (1997), Newman (2001) and Lanfermeijer et al. (2008). Briefly, microelectrodes were pulled and then dried in an oven at 200oC overnight. To improve the stability of the liquid ion exchange cocktails (LIX) the electrodes were coated with a hydrophobic material (tributylchlorosilane 90796; Sigma-Aldrich, Milwaukee) for 10 min in the 47 Chapter 3 same oven under a steel cover. Then the cover was removed and the electrodes were left to dry at 200oC for another 20 min. The electrodes were back-filled with 0.5 M KCl in the case of Cl--specific electrodes, 15 mM NaCl + 40 mM KH2PO4 in the case of H+-specific electrodes and 0.5 M KNO3 + 0.1 M KCl in the case of NO3--specific electrodes. All the back-fill solutions were adjusted to pH 6 with NaOH. Immediately after back-filling, the electrode tips were front-filled either with a commercially available LIX, ionophore 24902 for Cl- (Cl- -specific electrodes were used after an overnight ‘maturation’ period) and 95297 for H+ (Fluka; Busch, Switzerland) or with a LIX consisting of 0.5% methyltridodecylammonium nitrate (MTDDA), 0.084% methyl-triphenylphosphonium bromide (MTPPB) and 99.4% n-phenyloctyl ether (NPOE) for the NO3-specific electrodes (Table 1). Specificitya Responseb (mV/decade) Ion-specific Electrode Electrode tip fill Backfill H+ Ionophore 95297 15 mM NaCl, H+/Li+=108 51 40 mM KH2 PO4 Cl- Ionophore 24902 0.5 M KCl Cl-/I-=10 48 NO3- 0.5% MTDDA NO3-c,0.084% MTPPBd and 99.4% NPOEe 0.5 M KNO3, 0.1 M KCl Cl-/I-=8 56 Table 1: Composition of the ion-specific electrodes and their characteristics as used in the MIFE.experiments. a: specificity ration with the ion which interferes the most with the studied ion. b:The response value is the change in the measured potential when the pIon (e.g. pH, pCl or pNO3) changes 1 unit.c: methyltridodecylammonium nitrate; d: methyl-triphenyl-phosphoni bromide; e: n-phenyloctyl ether The epidermis was removed from the abaxial side of the leaf. Leaf material was immobilized on a glass capillary using grease with the abaxial side exposed to the solution and was placed in a measuring chamber with a transparent bottom. The chamber was filled with 1 ml of the basic measuring solution (1 mM KCl, 0.5 mM CaCl2, pH 5.8 for H+ and Cl- measurements or 0.1 mM NH4NO3, 0.2 mM CaSO4, pH 5.8 for NO3- measurements), submerging the leaf material. The whole chamber was placed on a Nikon TMS inverted microscope. The ion-selective microelectrodes were mounted at an angle between 30o and 40o with the horizontal in a holder (MMT48 NO3- and H+ fluxes in Atclcd mutants 5Narishige) on a micromanipulator (PCT; Luigs and Neumann) that was driven by a computer-controlled motor (MO61-CE08; superior Electric). All electrodes were calibrated before and after use in a series of solutions with concentrations in the expected range of the ions in the experimental solutions. The medium in the chamber was continuously replaced using a flow-through system (with a flow rate of approximately 3 ml/min). A system of taps allowed changes of the medium from outside the Faraday cage, which enclosed the whole set-up. Net fluxes of Cl-, NO3and H+ were recorded in response to exposure of the leaf material to solutions of different solute composition (Table 2). Measurement Conditions applied NaCl CholinCl Mannitol KNO3 KCl H+ Fluxes + + + + + Cl- Fluxes + + + + NO3- Fluxes + + Table 2. Osmotic conditions tested on Arabidopsis wild type and mutant plants for the indicated flux measurements. “+” indicated monitored 49 Chapter 3 RESULTS Isolation of a homozygous knockout line and gene expression We obtained one T-DNA insertion line in the Colombia ecotype background from the Salk collection under number SALK-42895. The exact location of the T-DNA insertion for the locus At5g26240 was obtained from the TAIR database (http://www.arabidopsis.org). As shown in figure 1, the T-DNA insertion in Salk42895 was located in the fourth intron of the gene. The location of the T-DNA in the gene was confirmed by PCR according to the protocol of the SALK consortium. To study AtClCd gene expression, RT-PCR was performed using gene specific primers. Figure 1 shows the expression of AtClCd, using tubulin as an internal standard. The RT-PCR products confirmed that high expression levels of AtClCd are present in the shoot. RT-PCR also confirmed that in homozygous mutant plants the full transcript of AtClCd is absent (Figure 1). This suggests that the T-DNA insertion results in a null allele. Our results confirm an earlier study that showed high expression levels of AtClCd in root and shoot (Lv et al., 2009). Figure 1. The T-DNA insertion in the AtClCd gene a: A schematic representation of the position of the T-DNA insertion in AtClCd gene. b: Tubulin primer experiment showing presence of equal amount of cDNA. c: The absence of expression in AtClCd gene in its T-DNA insertion lines. The wildtype and the Atclcd genotype were analysed using the primers shown in table 1 of Chapter 1. The Tubulin transcript levels are shown as a loading control. KNO3–induced proton fluxes are different in wildtype and Atclcd mutant plants Based on the similarity of AtClCa and AtClCd we hypothesize that AtClCd is also located in the tonoplast, functions as a H+/NO3- antiporter and is involved in nitrate accumulation in the vacuole. Based on these characteristics we predicted that increasing the extracellular nitrate concentration would lead to distinct differences between the Atclcd mutants and wildtype plants: 1. Since in the mutant excess nitrate 50 NO3- and H+ fluxes in Atclcd mutants cannot be stored efficiently in the vacuole, the cytosolic pH will increase more in the mutants compared to wildtype. In wildtype plants the cytosolic pH will be kept lower due to the exchange of nitrate from the cytosol for protons from the vacuole. Furthermore, the reduction of nitrate in the cytosol will consume one proton per NO3reduced to nitrite and several more when reduced further to ammonia. 2. The influx of nitrate will affect the chloride influx in the mutants more than in wildtype plants as accumulation of nitrate in the cytoplasm will likely reduce further uptake of anions. 3. The increase in the nitrate influx is expected to be transient in both genotypes, but will be more pronounced in wildtype plants since the capacity to store nitrate is higher. Addition of nitrate (400 µM and 6 mM KNO3) resulted in an immediate increase in the influx of nitrate in the leaf tissue (Figure 2). The size of the transient increase of the nitrate influx did not differ significantly between wild type and AtClCd mutant plants. Increasing the nitrate concentration in the external medium resulted in a reduction of the proton influx in wildtype plants (Figure 3). In Atclcd mutant plants nitrate increased the proton influx even further. When DCCD was added to the medium the influx of protons was dramatically reduced, while in wildtype plants the influx remained at the same low level. Effect of external KNO3 on chloride flux In order to check the effects of increasing the external concentration of nitrate on chloride fluxes, we measured Cl- fluxes before and after nitrate treatment. AtClCa has been shown to be selective for both NO3- and Cl-. Furthermore, NO3- generally suppresses Cl- fluxes and accumulation (Bar et al., 1997; Kafkafi et al., 1982; Adler and Wilcox, 1995) and decreases the Cl- influx, in particular the flux into the vacuole (Britto et al., 2004). As shown in figure 4 250 μM KNO3 indeed decreased the chloride influx and induced an efflux. In contrast, in Atclcd mutant plants, addition of KNO3 only has a transient effect on chloride flux and concentration, as after approximately 1.5 minute the flux returns to pre-addition values. 51 Chapter 3 Figure 2. Typical changes in nitrate fluxes from wildtype Arabidopsis thaliana (panels A and B) and the Atclcd genotype (panels C and D) leaf tissue induced by 6 mM (panels A and C) or 400 μM of KNO3 (panels B and D). The vertical line indicates the moment when the basal salt medium was slowly replaced by BSM with the supplement. When the flux becomes more positive, this means either an increase of the influx or a reduction of the efflux. Typical experiments of at least three experiments are shown. Figure 3. The effect of DCCD on nitrate induced proton fluxes from wildtype Arabidopsis thaliana and the Atclcd genotype leaf . The vertical lines indicate the moments when the medium was slowly replaced by the next medium as indicated. The concentations used were 50 mM KNO3 and 20 µM DCCD. Typical experiments of at least three experiments are shown. 52 NO3- and H+ fluxes in Atclcd mutants DISCUSSION Relation between NO3- and H+ fluxes in Atclcd mutant plants The physiological characterization of Arabidopsis mutants suggested the involvement of AtClCa (Geelen et al., 2000; De Angeli et al., 2006) and AtClCc (Harada et al., 2004) in the regulation of nitrate levels in plants. The bacterial ClC-ec1 protein (Accardi and Miller, 2004) and the human ClC4 and ClC5 proteins (Picollo and Push, 2005; Scheel et al., 2005) that are located in the membranes of intracellular vesicles, have been shown to function as proton/chloride exchangers, rather than passive chloride channels. In plant cells AtClCa functions as a 2 NO3-/1 H+ antiporter facilitating the accumulation of nitrate in the vacuole (De Angeli et al., 2006), with a selectivity sequence of NO3- = I- > Cl-. AtClCd has been shown to co-localize in the trans-Golgi network with VHA-a1, a subunit of the proton transporting V-Type ATPase (Fecht-Bartenbach et al., 2007). In plant cells, the plasma membrane H+-pumping ATPase is the primary active transport system and responsible for generating the membrane potential (Assman and Haubrick, 1996). Transport of a cation in the opposite direction or an anion in the same direction is required prevent extreme hyper-polarization of the membrane and allow the build up a steep proton gradient. Therefore different factors like activation of anion channels or changes in pH of the medium may lead to changes the membrane potential and the cytosolic pH. Also plasma membrane anion channels play a central role in the regulation of the cytosolic pH of plant cells (Johannes et al., 1998). The results of our experiments show that application of KNO3 leads to an H+ efflux (seen as a reduction of the influx). This efflux is, as is evident from its sensitivity to the ATPase inhibitor DCCD, carried by the plasma membrane H+-ATPase. This NO3-induced H+ efflux confirms reports by Garnet et al. (2003) on eucalypt and Segonzac et al. (2007) on Arabidopsis. In mutant plants the addition of KNO3 has much less of an impact on the H+ fluxes, demonstrating that the presence of an H+/anion antiporter is essential for the nitrate-induced effects on the plasma membrane proton pump. Interactions between uptake of Cl- and NO3- ions in Atclcd mutant plants Under natural condition, the presence of nitrate in the soil can reduce the toxic effect of excess Cl- (Bar et al.,1997). Nitrate can reduce the influx Cl- in plant cells 53 Chapter 3 and Cl- accumulation in plant tissue (Glass and Siddiqi, 1985; Adler and Wilcox, 1995). In our experiments the addition of NO3- led to an increase in the Cl- efflux (decreased Cl- influx) and to a higher external Cl- concentration when wildtype plants were studied. In the Atclcd mutant plants addition of nitrate resulted in a short, transient change in the chloride flux, but not in a sustained efflux (Figure 4). These results are consistent with a function for AtClCd as an H+/anion antiporter that can transport both nitrate and chloride across the tonoplast. Figure 4. Typical changes in chloride fluxes from wildtype Arabidopsis thaliana and the Atclcd genotype leaf tissue induced by 250 μM KNO3. The vertical line indicates the moment when the basal salt medium was slowly replaced by BSM with the supplement. Typical experiments of at least three experiments are shown. Although the selectivity of the bacterial and the Arabidopsis ClC transporters is clearly different, (in Arabidopsis NO3-, I- and Br- > Cl- (De Angeli et al., 2006), in bacteria Cl- > Br-, NO3- and SO4- (Accardi and Miller, 2004)), it is clear that in both NO3- and Cl- could enter the cells via the ClC transporters. Furthermore, addition of NO3- decreases the Cl- influx into the vacuole (Britto et al., 2004). These and our data suggest that in plant cells the accumulation of chloride and nitrate in the vacuole is based on competition for transporter activity and that the transporter that mediates this transport might be the AtClCd protein. 54 NO3- and H+ fluxes in Atclcd mutants ACKNOWLEDGEMENTS We thank Marten Staal for excellent technical assistance with the MIFE technique. This work was partially funded by a grant from the Ministry of Science, Research and Technology of Islamic Republic of Iran. 55 56 Chapter 4 Anion Channels and Root Elongation in Arabidopsis thaliana Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1 1 Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands 2 Department of Agronomy and Plant breeding, Sari Agricultural Sciences and Natural Resources University, Iran 57 Chapter 4 ABSTRACT Anion transporting proteins belonging to the chloride channel (ClC) family are involved in anion homeostasis in a variety of organisms. Progress in the understanding of their biological functions is limited by the small number of genes identified so far. Seven chloride channel members could be identified in the Arabidopsis genome, amongst which AtClCa, AtClCb, and AtClCd are more closely related to each other than to the other plant ClCs in same subclass. Chloride channels from Arabidopsis have been shown to participate in nitrate accumulation and storage. In this study, the physiological role of AtClCa, AtClCb and AtClCd proteins was investigated. Disruption of the AtClCa, AtClCb and AtClCd gene by a T-DNA insertion did not yield a phenotype that was different from wildtype under normal conditions, however, when the pH of the medium was slightly less acidic (raised from 5.8 to 6.2) the length of the primary root of plants with a disrupted AtClCa and AtClCd gene was reduced compared to wildtype and the plant with a disrupted AtClCb gene. The proton fluxes and pH were measured along the surface of the root at different positions, from root cap, through the transition zone, and up to the fast elongation zone, and at different pH’s of the medium. A high proton influx was found in the apical part of the transition zone. Lower influxes or even small effluxes were found at the basal part of the elongation zone. At pH 6.2 the influx of protons in the apical part of the transition zone in the Atclca and Atclcd mutants was significantly lower than in wildtype and the Atclcb mutant. Measurement of the distance between root tip and first epidermal cell with visible root hair bulge indicate that the mutants that are affected in the H+ flux, the Atclca and Atclcd mutants, also have a reduced cell expansion. A model for the interaction between endomembrane anion/H+ antiporters, plasma membrane proton fluxes and cell expansion is discussed. 58 Anion channels and root elongation INTRODUCTION Root development is determined by cell division, differentiation and expansion. Each of these processes is under the control of an intrinsic developmental program and of external biotic and abiotic factors (Lynch, 1995). A wealth of information is available on the cellular organization, the differentiation and genetic background of developmental processes in the root of Arabidopsis, the model system of choice for plants (Dolan et al. 1993; Schiefelbein et al., 1997; Scheres et al., 2002; Park et al., 2008). Several groups have explored the mechanisms of cell expansion in the elongation zone, the zone of maximal cell growth rate (Befey et al., 1993; Hauser et al., 1995; Verbelen et al., 2001; Swarup et al., 2007; Cnodder et al., 2006). Cell elongation in roots is sensitive to various endogenous and exogenous factors such as pH (Rayle and Cleland, 1970), ethylene (Le et al., 2001), auxin (Fujita and Syono, 1996), calcium (Kiegle et al., 2000) and aluminium (Sivaguru et al., 2000). The primary cell wall of plants consists of long cellulose microfibrils embedded in a crosslinked matrix of polysacharides, largely pectin and glycans (Carpita and Gibeaut, 1993), and a small quantity of structural proteins (Showalter, 1993). The acid growth theory states that protons are the primary wall-loosening factor, causing the cleavage of load-bearing bonds in the cell (Rayle and Cleland, 1970; Royle and Cleland, 1992). Turgor will then cause a cell with a loosened cell wall to expand. In maize, the spatial profile of growth along the roots has been shown to coincide with the spatial profile of root-surface acidification (Fan and Neuman, 2004; Peters and Felle, 1999; Pilet et al., 1983). A more recent version of the acid-growth theory states that a low apoplastic pH (<5) activates expansins, cell wall-assiociated proteins that break the hydrogen bonds between the cellulose chains and the cross-linking glycans (Mc Queen-Mason et al., 1992; Cosgrove, 2000). The apoplastic pH is determined by the H+-efflux through the plasma membrane H+-ATPase and the H+-influx through the H+-coupled anion symporters (Taner and Caspari, 1996). Anion fluxes through anion channels may contribute to the maintenance and regulation of proton gradients across the different membrane compartments in plant cell. Based on transport studies and structurefunction relationships the AtClCa and AtClCd proteins are very likely to function as anion/proton antiporters (De Angeli et al., 2007; Lv et al., 2009). In combination AtClCd and V-ATPase can support expansion growth of cells. This last result suggests more complex connections between ClC proteins and proton gradients (Angeli et al., 2006; Jennifer et al., 2007 and Scheel et al., 2005). As shown by GUS 59 Chapter 4 staining, the elongation and maturation zone of the root show high expression levels of AtClCa and AtClCd (Lv et al., 2009). Although there are enough indications that ClC proteins are essential in cell expansion in certain tissues and cell types, the functional relation between AtClC proteins and proton gradient development in expanding root cells is still unclear. In this study, we tried to elucidate the relationship between ClC transporter proteins and the proton flux in root cell elongation, by quantifying the fluxes along the root in wildtype and the Atclca, Atclcb and Atclcd mutants at different external pH’s. 60 Anion channels and root elongation MATERIALS AND METHODS Plant materials and culture conditions The seeds of Arabidopsis thaliana (ecotype Columbia) were obtained from the SALK collection (AtClCb: SALK27349; AtClCd: SALK42895) and from the WiscDsLox T-DNA collection (AtClCa: WiscDsLox477-480I4). Seeds were surface sterilized with gaseous chlorine and sown in 90 mm petridishes containing with halfstrength Murashige and Skoog media (Duchefa, Haarlem, The Netherlands) with 0.8% w/v micro agar (Duchefa, Haarlem, The Netherlands). The dishes were sealed with surgical tape and incubated in the dark at 4 0C for 3 days. Subsequently they were transferred to a growth chamber (set at a 16h/8h light/dark cycle, 20 ± 20C temperature at 72% relative humidity) and placed on edge, 5 degrees off the vertical, such that the roots were growing down along the surface of the agar without penetrating it. About 4-6 days and 14 days old plants were used for MIFE and primary root measurement, respectively. Ion flux experiments Net fluxes of protons were measured non-invasively using vibrating H+-selective microelectrodes with the MIFE (microelectrode ion flux estimation) technique (Shabala et al., 1997 ; Newman, 2001; Vreeburg et al., 2005; Lanfermeijer et al., 2008). Micropipettes (diameter 50 μm) were pulled from borosilicate glass. The electrodes were silanized with tributylchlorosilane (Fluka 90974) and subsequently back-filled with 15 mM NaCl and 40 mM KH2PO4 and front filled with Hydrogen Ionophore II, Cocktail A (Fluka 95297). Only the electrodes with a response between 50 and 59 mV per pH unit and with a correlation coefficient between 0.999 and 1.000 (pH rang 5.1-7.8) were used. The electrodes were calibrated before and after use. Roots of five days old Arabidopsis seedlings were mounted on glass capillary tubes with medical adhesive and placed in a measuring chamber with a transparent bottom, which was filled with BMS solution (1 mM KCl, 0.5 mM CaCl2, pH 5.8 for H+ and Cl- measurements). The whole chamber was placed on the stage of a Nikon TMS inverted microscope. The H+-microelectrode was mounted at an angle between 300 and 400 with the horizontal in a holder (MMT-5; Narishige) on a micromanipulator (PCT; Luigs and Neuman) driven by a computer-controlled motor (MO61-CE08). The electrode was 61 Chapter 4 positioned manually at a distance of 10 μm from the root. During the subsequent measurement, the distance between the electrode and the surface of the root was switched between 10 μm and 50 μm at a frequency of 0.1 Hz. The chemical activity of H+ in solution at these two positions was recorded and from these data the H+-flux and the pH could be calculated. The absolute pH value could differ (± 0.1-1 pH units) between different MIFE experiments, but the overall pattern of the pH along the root stayed the same. The first measuring point was positioned at a root tip and the subsequent sampling points along the root were 75 μm apart. At each measuring point the ion flux was recorded for 2 min. The last sampling point was chosen at the beginning of the root hair zone. Screening for T-DNA insertion mutants Homozygous mutants lines were identified by resistance to kanamycin and by a PCR-based screen with the left border primer (LB) according to the Salk protocol and the respective primers (has been described in chapter 2) Expression analysis in roots Total RNA were isolated from roots using a Nucleospin RNA plant kit (Macherey-Nagel). RNA was measured by the nanodrop machine. Total RNA (3μg) were used as template for first-strand cDNA synthesis using 200U of RevertAid HMinus M-MuLV reverse transcriptase (Fermentas, www.fermentas.com) and an Oligo (dT) primer. As a control for equal amounts of cDNA tubulin primers were included (Figure 1). PCR was performed at an annealing temperature of 55 oC and 32 cycles were used for AtClCa and AtClCd and 35 cycles were used for for AtClCb. Primers are given in table1 chapter 2. Figure 1. The absence of expression of the AtClCa, AtClCb and AtClCd genes in their respective T-DNA insertion lines. The four genotypes were analysed using the primers shown in table 1 of chapter 2. upper panel: the Tubulin transcript levels of the four genotypes are shown as a loading control. MW: lane with the molecular marker, the size of the essential bands is shown on the left. lower panels: expression levels of the AtClCa (left panel), AtClCb, (middle panel) and AtClCd (right panel) in wildtype and the respective T-DNA insertion lines. 62 Anion channels and root elongation Cell imaging in primary root Images were taken with a Nikon Coolpix 990 digital camera, which was mounted on an inverted optical microscope (CX41, Olympus, Tokyo, Japan) equipped with objectives of 20× and 40× magnification. After 7 and 14 days of growth on the vertical-placed plate the distance between the root tip and the first epidermal cell with visible root hair bulge (DFEH) and the root length were measured. At least 10 Arabidopsis wildtype and mutant plants were measured for every condition in each experiment and each experiment was repeated 3 times. 63 Chapter 4 RESULTS Isolation of homozygous knockout lines From the seven members of the ClC transporter protein family in Arabidopsis thaliana tree genes (AtClCa, b and d) that are phylogenetically more closely related to each other than to any of the other members were selected. Plant ClC proteins are grouped into two distinct subclasses with significant divergence (Lv et al., 2009). In subclass 1 AtClCa andAtClCb are the most closely related, while AtClCd although in another branch of the same subclass, is also rather similar. Of the other proteins in this family, AtClCc and AtClCg, also belong to subclass 1, while AtClCe and atClCf, belong to subclass 2 and are more distantly related. Homozygous T-DNA insertion lines in the Columbia ecotype were selected from Salk and the WiscDsLox T-DNA collections. Reverse transcript PCR analysis of gene expression As shown in figure 1, RT-PCR confirmed high expression levels of AtClCa, AtClCb and AtClCd in root tissue of wild type plants. This result is in agreement with an earlier study (Lv et al. 2009) with showed high expression in the root of AtClCa and AtClCd and moderate expression of AtClCb. In the homozygous mutant plants transcripts of the respective disrupted genes could not be detected (Figure 1). Primary root growth of Atclca and Atclcd inhibition at high pH Since anion transporters are involved in osmo-regulation and in cell expansion, we measured the primary root length of wildtype and mutant plants growing on agar plates and exposed to different external pH’s (5.8 till 6.8, buffered with 20 mM Mes). All genotypes showed the longest root when grown on media with a pH of 5.8, while no differences could be observed between the genotypes (Figure 2). When the pH of the medium was raised root growth decreased (Figure 2), however, compared to the wildtype, root growth in Atclca and Atclcd was more reduced. Atclcb was not distinguishable from wildtype at all pH values. In all 8-days-old plants exposed to the highest pH (6.8) the roots of the seedlings had hardly grown at all and the leaves were yellowing. 64 Anion channels and root elongation Reduced proton flux on the growth zones of root Atclca and Atclcd To detemine if the clear difference in root length between wildtype plants and Atclca and Atclcd mutants at less acidic pH’s, could be correlated to differences in cell wall acidification, the proton fluxes at the surface of the roots of 8-days-old plants were measured in wildtype and mutant plants in media with different pH’s. The pH and H+ flux profile along the root was recorded at 75 μm intervals. The last sampling point was Figure 2. The effect of the pH of the growth medium on primary root length of wildtype Arabidopsis and the three single mutant lines. a: Phenotypes of roots of the wildtype and the three single mutants grown at different pH-values. The distance between two short lines on the reference is 1 mm. b: Quantification of primary root length of wildtype and the three single mutants grown at different pH-values. Datapoints are the average of 4 experiments and the error bars indicate the standard deviation. chosen at the onset of the root hair zone. At pH 5.8 the largest influxes were recorded at a distance of 225 to 250 μm from the root tip, which is the border between the meristematic zone (MZ) and the transition zone (TZ) (Figure 3). In the transition zone the influx decreases steeply and remains relatively stable throughout the elongation zone. At pH 5.8 no differences between wildtype and mutants can be observed (Figures 3 and 4). 65 Chapter 4 At higher pH’s (in figures 3 and 4 the results for pH 6.2 are shown) the largest net H+ influx is shifted slightly basipetally to 300 μm from the root tip in wildtype and Atclcb. However, more significant was the almost complete disappearance of the H+ influx in the Atclca and Atclcd mutants. 66 Anion channels and root elongation Figure 3. The proton flux profile along the roots of wildtype and the three single mutants. Upper panel: proton fluxes measured at pH 5.8, lower panel: proton fluxes measured at pH 6.2. Indicated are the three zones of the growing roottip: the meristematic zone (MZ), the transition zone (TZ) and the elongation zone (EZ). Datapoints are the average of 4 experiments and the error bars indicate the standard deviation Difference DFEH between wildtype and Atclc mutant plants The acid growth theory predicts cell wall loosening and rapid cell elongation at low pH. In order to check the relation between different pH’s and cell elongation in the primary root, we measured the distance between root tip and the first epidermal cell with visible root hair bulge (DFEH). In 8-day-old plants grown at pH 5.8 DFEH was 1355 ± 15 μm (Figures 4 and 5). At pH 6.2 DFEH was decrease in all plants, but significantly more so in the Atclca and Atclcd mutants. 67 Chapter 4 DISCUSSION Expansion of cells is only possible when the yield threshold of the cell wall is low enough and the turgor, the pressure the cell exerts on the cell wall, high enough. For both of these parameters a close interaction between transporter proteins is necessary. The apoplastic pH of root cells will reflect the pH of the medium, but is also determined by the H+-efflux mediated by the plasma membrane H+-ATPases and the H+-influx through the H+-coupled anion symporters (Tanner and Caspari, 1996). The plasmamembrane proton pumping ATPase activity is also one of the main regulators of the cytoplasmic pH stat. An increase in cytoplasmic pH will necessarily result in down-regulation of the H+-ATPase activity. Any transport process, also across endomembranes, that affects the cytoplasmic pH is likely to affect the net proton fluxes at the cell surface. Hence, the presence or absence of an anion/H+ antiporter will have such an effect. Figure 4. Comparison of the peak values of the proton-flux (upper panel) and the DFEH (lower panel) at two pH values. Upper panel: peak values are the fluxes measured around 250 μM from the roottip as shown in Figure 3. Lower panel: DFEH: the distance between root tip and first epidermal cell with visible root hair bulge. Datapoints are the average of 6 experiments and the error bars indicate the standard deviation. For the second requirement for cell expansion, the generation of sufficient turgor, the same anion/H+ antiporter will also have a key role. Accumulation of solutes that have to provide the low osmotic potential to attract water to enter the cell will have to be balanced in all cellular compartments. Therefore, the vacuole, being the largest compartment has to be stocked with a mixture of small organic molecules and nearly 68 Anion channels and root elongation equal amounts of cations and anions. Under most conditions the accumulation factor between cytoplasm and vacuole found for anions can thermodynamically not be explained by simple diffusion down the electrical potential (positive inside the vacuole). The accumulation of anions is often so high that secondary active transport, mediated by anion/H+ antiporters is essential. Also plasma membrane anion channels play a central role in cytosolic pH regulation of plant cells (Johannes et al., 1998). The link between ClC anion transporters and H+-pumping has been confirmed for the mammalian ClC3, ClC5 and ClC7 transporters (Jentsch et al., 2002). The prokaryotic ClC anion channel was shown to mediate a stoichiometrically fixed 2 anions/proton antiport activity (reviewed in Miller, 2006). In plants, the same function has been proposed for AtClCa and AtClCd (De Angeli et al., 2006 and De Angeli et al., 2007). After confirmation that the Atclca, -b and -d mutants we had selected for this study were homozygous, and indeed lacked a full transcript (Figure 1) we used them to elucidate the role of endomembrane H+/anion antiporters in Arabidopsis root elongation. Proton fluxes and root cell elongation Changing the pH from 5.8 tot 6.2 reveals three differences between Atclca and Atclcd on the one hand and wildtype and Atclcb on the other. In Atclca and Atclcd increasing the pH leads to 1) a more drastic decrease in H+ influx, 2) a stronger inhibition of primary root growth and 3) to a shortening of the root expansion zone. From these results we conclude that the AtClCa and AtClCd transporter proteins are involved in primary root expansion growth. This conclusion is based on the following considerations: 1) For the different genotypes exposed to a higher pH, the length of the primary root correlates with the distance between root tip and first epidermal cell with visible root hair bulge (DFEH) and this indicates that specifically cell expansion is reduced in the Atclca and Atclcb mutant plants. The length of the first epidermal cell with a visible root hair bulge (LEH) was previously defined as a parameter to study root development and the control of elongation on cell level (Le et al., 2001). This parameter is less useful when cell size measurements are more difficult to perform, which for instance is the case when the root tips are swollen and have accumulated pigments, and the epidermal cell walls are obscured. Measuring the DFEH is easier since it only involves the recognition of the first root hair bulge and the root tip. Since the epidermal cell exhibiting the first root hair marks the end of the 69 Chapter 4 fast elongation zone and the onet of the differentiation zone in Arabidopsis root (De Cnodder et al., 2006) the DFEH should therefore give a fairly accurate reflection of the expansion rate in the distal part of the primary root. This implies that in Atclca and Atclcb mutants the expansion rate is reduced compared with wildtype and Atclcb (Figures 4 and 5). Figure 5. Phenotypes of the roots of the Arabidopsis wildtype and the three single mutants when grown on media with different pH-values. The first epidermal cell with a visible root hair bulge is indicated by a arrow. This cell is used to measure the DFEH (distance between root tip and first Epidermal cell with visible root hair bulge). The bar in the upper left photo indicates 0.5 millimeter. 2) The zone of highest expression of the ClC genes, that show a reduced elongation rate when mutated, coincides with the elongation zone. By using GUS staining in the root Lv et al (2009) showed that AtClCa and AtClCd have the highest expression in the elongation and maturation zone, but that they are absent in the division zone. 3) A function of AtClCd in cell expansion in root growth has been proposed earlier. Atclcd mutants plant exhibit a reduction in root growth when compared to wildtype at elevated pH’s of the medium, which is also attributed to low cell expansion rates (Fecht-Bartenbach et al. 2007). The AtClCd protein is essential for normal cell expansion of hypocotyls cells in which the V-type ATPase is inhibited or only partly functional (Fecht-Bartenbach et al., 2007). The result that the mutants with a more strongly reduced H+ influx, are the most severely inhibited in root growth, is not immediately consistent with the accepted acid growth theory for expansion growth. Normally, reduction of H+ influx would result in 70 Anion channels and root elongation a lowering of the apoplastic pH and, consequently, it would be expected that the expansion growth is stimulated in this situation. In the literature the indications that lowering the pH induces cell elongation are many (Taguchi et al., 1999; Vanderhoef and Dute, 1981; Rayle and Cleland 1992). For instance, part of elongation zone growth is regulated by acid growth phenomena associated with cellular control over the cell wall pH (Edwards and Scott, 1974; Buntemeyer et al., 1998; Peters and felle, 1999). Under normal conditions the surface pH along Arabidopsis roots, is highest in the transition zone, and lowest in the adjacent fast elongation zone (De Cnodder et al., 2006). Our results thus do not fit with this general model. We find that faster elongation correlates with higher influx, not with higher efflux. We hypothesize that for maintaining root growth at higher pH, functional AtClCa and AtClCd proteins are necessary to drive the accumulation of anions in intracellular compartments, specifically the vacuole and/or acidic vesicles, and to generate sufficient turgor. This hypothesis would fit with our results: 1) the increased proton efflux in wildtype is possibly the result of sustained anion/H+ co-transporter activity in the plasma membrane and 2) the reduced root length phenotype of the mutants is only obvious at higher pH values. At these higher pH’s cell wall elasticity is lower and elongation will only be possible by higher turgor values. 71 Chapter 4 ACKNOWLEDGEMENTS We would like to thank Ger Telkamp for his help in culturing the plants and Marten Staal for his expert support with the MIFE measurements. This work was supported in part by a grant from the Ministry of Science, Research and Technology of the Islamic Republic of Iran. 72 Chapter 5 The role of AtClCa and AtClCd in heavy metal tolerance in Arabidopsis thaliana Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1 1 Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands 2 Department of Agronomy and Plant Breeding, Sari Agricultural Sciences and Natural Resources University, Iran 73 Chapter 5 ABSTRACT In higher plant cells, anion channels play a role in acclimation of plant cells to abiotic and biotic environmental stresses, in the control of metabolism and in the maintenance of electrochemical gradient. A number of studies have demonstrated that anion channels are present in various cell types of plants. Seven genes encoding chloride channel (ClC) proteins have been identified in the Arabidopsis genome. To assess the function of ClCs in Arabidopsis, we obtained three single mutant plants (Atclca, Atclcb, and Atclcd) with an T-DNA in the respective genes and we made the three double and the triple mutant plants. One of the aims of our study was to elucidate the role of anion channels in heavy metal (i.e. cadmium) resistance and specifically their involvement in the alleviation of cadmium effects by calcium. The primary root growth and the morphology of cells between the meristematic and elongation zone, were significantly affected by exposure to 60 μM Cd+2 in all genotypes. Adding Ca2+ to Cd2+-exposed plants, restored primary root growth and the normal shape of cells, except in the double mutant Atclcad and the triple mutant Atclcabd. We propose that both AtClCa and AtClCd proteins play a role in the detoxification of cadmium by allowing efficient sequestration of the metal in the vacuole or in acidic intracellular vesicles. Plants that lack both transporter proteins, therefore have decreased cadmium resistance. The role of AtClCa and AtClCd in heavy metal tolerance INTRODUCTION Heavy metals are elements that have an atomic weight between approximately 63200 Daltons. Over 50 elements have been classified as heavy metals, 17 of which are very toxic and relatively accessible. They are naturally occurring minerals that are found throughout our natural environment. Contamination of soil with heavy metal is a serious worldwide problem both for human health and agriculture (Gairola et al., 1992; Mazess and Barden, 1991 and Ryan et al., 1982). Metal toxicity interferes with cellular activity by several mechanisms: displacement of essential cations, induction of oxidative stress, and direct interaction with proteins. Cadmium is a toxic heavy metal that enters the environment, and also the food chain, through industrial processes and phosphate fertilizers (Pinto et al., 2004). In plants, cadmium is taken up easily by the roots of many plants species, where it can be loaded into the xylem and transported to the leaves. Cadmium has a 2-20 times higher toxicity than most of the other heavy metals (Jagodin et al., 1995). Cadmium toxicity is associated with growth inhibition and imbalances in many macro and micronutrient levels. Cadmium toxicity symptoms are more apparent in the root than the shoot, as the accumulation of Cd2+ in the root is significantly higher than in the shoot (Breckle, 1991). In plants a low concentration (5-10 μM) of Cd2+ reduces chlorophyll content and the photosynthetic yield in Brassica napus (Baryla et al., 2001; Larsson et al., 1998), displaces Ca2+ in the photosystem II (Faller et al., 2005), is negatively affecting in respiration (Greger and Ogren, 1991; Reese and Roberts, 1985) and inhibits water transport (Barcelo and Poschenrieder, 1990). Cadmium inhibits almost all enzymes of the Calvin cycle in pigeon pea and wheat plants (Sheoran et al., 1990; Malik et al., 1992). Cadmium also induces the generation of reactive oxygen species (ROS), resulting in the unspecific oxidation of proteins and membrane lipids and DNA damage (Dean et al., 1993; Ames et al., 1993), inhibits germination (Sarath et al., 2007) and suppresses root cell elongation (Stohs and Bagchi, 1995; Schutzendubel et al., 2001). Uptake studies suggest that transport of Cd2+ into the cytoplasm and vacuole might depend on both active and passive transport systems (Costa and Morel, 1993; Costa and Morel, 1994; Hall, 2002; Hart et al., 1998; Salt and Wagner, 1993). Changes in the cytoplasmic calcium concentration are used by the cell as an almost universal second messenger system for many signals. Disturbance of calcium 75 Chapter 5 homeostasis and displacement of calcium have been suggested as possible mechanisms of Cd2+, Zn2+, Cu2+, or Al3+ toxicity (Kinraide et al., 2004). For instance, the vacuolar Ca+2/H+ antiporter CAX2 in Arabidopsis is able to transport Ca2+, Cd2+ and Mn2+ (Hirschi et al., 2000). Cadmium competes with Ca2+ at both the Ca2+channel (Nelson, 1986) and at intracellular Ca2+ binding proteins (Rivetta et al., 1997). Exposure to cadmium resulted in a decrease of the calcium content in different plant species (Gussarson et al., 1996; Sandalio et al., 2001). This competition between calcium and cadmium seems to work both ways: increasing the external calcium concentration alleviates the effects of cadmium, an effect that is assumed to result from the competition for transporters between the two ions (Suzuki, 2005). Anion channels are well documented in various tissues, cell types and membranes of animals, protists and plants and current evidence supports a central role in cell signaling, osmo-regulation, nutrient uptake and metal tolerance (Barbier-Brygoo et al., 2000). Seven ClC genes have been identified in the Arabidopsis genome. Subcellular localization is still largely putative, but AtClCa-b-c and g are assumed to function in the tonoplast , AtClCd and AtClCf are localized to the Golgi membrane and AtClCe is assumed to be targeted to the tylakoide membrane (De Angeli et al. 2007; Marmagne et al., 2007; Lv et al., 2009). Recently, the localization in the tonoplast of AtClCa and its role as a NO3-/H+ antiporter was demonstrated (De Angeli et al., 2006). The aim of this study was to determine the link between Cd2+ toxicity on the one hand and Ca2+ and ClC transporter-related heavy metal resistance on the other hand. We show that Cd2+ at concentrations of 60 to 90 μM causes serious damage in the primary roots of all genotypes. Ca2+ was able to alleviated Cd2+ reduction of root growth in most genotypes, except in plants that were defective in both the AtClCa and AtClCd transporter. The role of AtClCa and AtClCd in heavy metal tolerance MATERIALS AND METHODS Plant material and culture conditions Plant material and standard culturing conditions used are the similar to those described in Chapter 2. To determine Cd2+ toxicity, the role of Ca2+ and pH in this, plants were transferred to new plates with the same solid medium but supplemented with the appropriate concentrations of CdCl2, ZnCl2, PbCl2, BaCl2, MgCl2 or CaCl2. Also the pH of the Tris/Mes-buffered medium was adjused when needed. Screening for T-DNA insertion mutants Selection for single, double and triple mutants has been described in Chapter 2. Cell imaging in primary root Imaging was performed using a Nikon Coolpix 990 digital camera mounted on an inverted optical microscope (CX41, Olympus, Tokyo, Japan) equipped with objectives of 20× and 40× magnification. After 15 days of growth (after sowing) on the vertically placed agar plate the primary root length and the distance between root tip and first epidermal cell with visible root hair bulge (DFEH) were measured using the microscope. For every experiment the average of the root length of at least 8 plants was calculated and every experiment was repeated twice. 77 Chapter 5 RESULTS Reverse transcription PCR analyses RT-PCR for Atclc single, double and triple mutant plants was carried out with gene specific primers as described in chapter 2 and the bands were compared with the tubulin product. RT-PCR confirmed the expression of AtClCa , AtClCb and AtClCd in root tissue. In all mutant genotypes the absence of transcripts confirmed that the TDNA insertions all resulted in null alleles (Figure 1). Figure 1. The absence of expression of the AtClCa, AtClCb and AtClCd genes in the double and triple mutant lines. The five genotypes were analysed using the primers shown in table 1 of chapter 2. The Tubulin transcript levels of the five genotypes are shown as a loading control. Cd2+, Pb2+ and Zn2+ inhibits primary root growth in Atclc mutant plants Exposure of 7 days old seedling to 90 μM Cd2+ resulted after 8 days of further growth in strongly reduced primary roots (Figure 2a). Exposure to 90 μM ZnCl2 (Figure 3) or lower CdCl2 (Figure 2a) concentrations only weakly inhibited primary and lateral root growth. In all treatments, root growth was not significantly different between single, double and triple mutant and wildtype plants. The role of AtClCa and AtClCd in heavy metal tolerance Figure 2. The inhibition of growth of the primary roots of the wildtype Arabidopsis and the 7 mutant genotypes by Cd2+ and the alleviation of the inhibition by Ca2+. a: Concentration dependence of Cd2+ inhibition in absence and the presence of 30 mM CaCl2. b: Ca2+ concentration dependence of the alleviation of the inhibition of root growth by 90 μM Cd2+. Datapoints are the average of 3 experiments and the error bars indicate the standard deviation. Alleviation of cadmium toxicity by Ca2+ is different between wildtype and Atclcad double mutants Based on the results of Suzuki (2005), that increased external Ca2+ reduces the effects of Cd2+ we tested the effect of 30 mM CaCl2 in plants exposed to toxic levels of cadmium. The application of CaCl2 to Cd2+-stressed plants, restored the growth of the primary root in all genotypes, except in two. In the Atclcad double mutant and in the triple mutant Atclcabd the primary and lateral root was significantly shorter than in the other genotypes (Figure 2a). The effect of calcium is dose-dependent and with 90 μM Cd2+ the Km for calcium is about 1 mM (Figure 2b). The restoration of root growth in plants exposed to cadmium seems to be a calcium-specific effect. Addition of BaCl2, cholinchloride or MgCl2 did not show any positive effect on the root growth of plants that were treated with 90 μM CdCl2 (Figure 4). . Figure 3. Inhibition of root growth by Zinc and the absence of allevetation by Ca2+ in the wildtype Arabidopsis and the 4 multiple mutant genotypes. Datapoints are the average of 3 experiments and the error bars indicate the standard Deviation 79 Chapter 5 In animal cells a relation between Zn2+-toxicity and anion channel function had been demonstrated (Duffield et al., 2005 ). To test whether a similar relation exists in plants, we studied the effects of Ca2+ on Zn2+-treated wildtype and Atclc mutant plants. Figure 3 shows that, in contrast to Cd2+-treated plants, calcium does not change the effect of zinc on root growth, nor does the genotype of the plant influence the extent of the inhibition. Figure 4. Influence of different cations on the inhibition of root growth in the wildtype Arabidopsis and the 4 multiple mutant genotypes by Cd2+. The used concentrations of CaCl2, BaCl2 CholineCl and MgCl2 are 30 mM. Datapoints are the average of 3 experiments and the error bars indicate the standard deviation. Effects of Cd2+ on root morphology In plants exposed to cadmium the morphology and color of the root tip changes and the shape of the cells in the elongation zone is distorted (Suzuki, 2005). In our experiments, exposure to 90 μM Cd2+ also leads to deformation of the root tip and a change in morphology of the cells along the root rip. In cadmium-treated roots the diameter of the root tip is decreased and the color of the cells much darker (Figure 5). At lower concentrations of Cd2+ (30-60 μM) the diameter of the primary root also decreased and initiation of lateral root growth was still higher, but the shape and color of the cells in the root tip were not different from the controls. The experiment shown in figure 5 confirms that a high concentration of Cd2+ causes serious damage to the cells at the border between the elongation and meristematic zone. The role of AtClCa and AtClCd in heavy metal tolerance Figure 5. Phenotypes of the roots of the Arabidopsis wildtype and the four multiple mutants when grown on media with Cd2+ or Cd2+ and Ca2+. The bar in the upper left photo indicates 0.5 millimeter. These effects of cadmium poisoning can also be alleviated by increasing the external calcium concentration (Figure 5, right panels). In all genotypes the morphology of calcium-treated roots is not significantly different from the controls. For comparison we also exposed the plants to a high concentration of lead. 700 μM Pb2+ does induce changes in the diameter and color of root, but does not affect the shape of the cells in the tip of the primary root cells in same way as 90 μM Cd2+ does (data not shown). Relation between Cd2+, Ca2+ and pH condition in primary root growth In Chapter 4 we showed that root growth in the Atclca and Atclcb mutants is more sensitive to pH than in the wildtype plants. Since it is the combination of these same mutated genes in which Ca2+ has a reduced capability to alleviate cadmium-toxicity we tested the effect of pH on cadmium toxicity in the different genotypes (Figures 6 and 7). 81 Chapter 5 Figure 6. The pH dependence of Cd2+ inhibition of root growth and the pH dependence of Ca2+ alleviation of this inhibition in wildtype Arabidopsis and the four multiple mutants. a: pH of the growth medium was 5.8 b: pH of the growth medium was 6.2. The length of the reference in the pictures in 2.5 cm. At pH 5.8 we obtained a result comparable with the data presented in figure 2. At the higher pH the mutations in both AtClCa and AtClCd genes resulted in a stronger pHinduced reduction of root growth. Curiously, at pH 6.2 the addition of 30 mM CaCl2 resulted in a complete reversal of the effect of Cd2+. At pH 6.2 no statistically significant difference was found between control, the addition of only Ca2+ and the The role of AtClCa and AtClCd in heavy metal tolerance addition of both Ca2+ and Cd2+. The difference between the genotypes was present also in the control situation, indicating that at pH 6.2 the effect of pH on root growth of the genotypes is dominating the response. Figure 7. The pH dependence of Cd2+ inhibition of root growth and the pH dependence of Ca2+ alleviation of this inhibition in wildtype Arabidopsis and the four multiple mutants. Plants were grown in the presence of either 90 μM CdCl2, 30 mM CaCl2 or the combination of both salts. a: pH of the growth medium was 5.8 b: pH of the growth medium was 6.2 83 Chapter 5 DISCUSSION In order to understand the relationship between heavy metals and anion transporters in plant cells, we made single, double and triple anion channel mutants in Arabidopsis thaliana (Figure 1). With these genotypes we show, firstly, specific effects of cadmium on primary root growth and development, that cannot be mimicked by the other heavy metals tested (zinc and lead). Secondly, the effects of cadmium can be reversed by increasing the external calcium concentration. Thirdly, we show that this effect of calcium depends on the presence of AtClCa or AtClCd. The effect of cadmium on roots is different from the effect of other heavy metals In plants exposed to cadmium the accumulation in the roots will be higher than in the shoot and therefore phytotoxic effects will be more apparent in the root (Breckle, 1991). Although all three heavy metals tested resulted in inhibition of root growth, the mode of action of cadmium differs from that of zinc and lead. The effects of lead do resemble those of cadmium, as both result in a narrow root tip and a darkening of the cells. However, cell deformation of the cells in the root tip that are characteristic for exposure to sub-lethal concentrations of cadmium, were not observed after exposure to lead. In Arabidopsis root that cell death first appeared in around meristematic and then in elongation zone of root, where influx of Cd2+ caused cell death and inhibited primary root growth (Suzuki, 2005). While no differences between the genotypes, concerning heavy metal sensitivity, were observed, a difference was observed when the capability of Ca2+ to alleviate the Cd2+ reduction of root growth was studied. Ca2+ was unable to alleviate the Cd2+ effects in the mutant plants lacking functional AtClCa and AtClCd. The reduction of root growth induced by Zn2+ is equal in all genotypes and is insensitive to calcium. We interpret this effect of calcium as an increased sensitivity of the genotypes Atclcad and Atclcabd for Cd2+. Plant cells have developed a variety of mechanisms to protect cells from heavy metals. One of them is the accumulation of soluble phenolic compounds in the cells, resulting in protection of tissues against oxidative stress. (Yamamoto et al., 1998; Schutzendubel et al., 2001; Suzuki, 2005), which is visible as the dark discoloration in Cd2+ or Cu2+ exposed root tips. Another is exclusion and/or sequestration. The role of AtClCa and AtClCd in heavy metal tolerance In effects of calcium on cadmium toxicity: differential effect of Ca2+on Atclcad double mutants Cadmium mainly enters the root in the first few 1-1.5 mm behind the root tip and the influx is significantly less, further up the root (Pineros et al., 1998; Arduini et al., 1996). This is also the normal pattern of uptake for plant nutrients and several studies indicate that it is likely that Cd2+ enters the plant, in a competitive way, through the same transporters that are involved in nutrient uptake. Exposure to cadmium can result in a decrease in the content of Ca, Zn, Cu, Mn and Fe in pea leaves (RodriguezSerrano et al., 2009). Cadmium uptake could be competitively inhibited by other cations and by Ca2+-channel blockers (Blazka and Shaikh, 1992; Clemens, 2006). Active and passive transport systems have been reported for Cd2+ in roots of several plant species (Cataldo et al., 1981; Godbold, 1991; Gosta and Morel, 1993 and 1994; Hart et al., 1998). Non-essential heavy metals might be transported via nutrient transporters or channels that are not completely selective (Clemens et al., 1998). It has been observed that cadmium not only competes with calcium for calcium transporters, but also for intracellular Ca2+-binding proteins (Rivetta et al., 1997) and at plasma membrane (Kinraide, 1998). Alleviation by calcium of Cd2+ toxicity by reducing the Cd2+ uptake and accumulation, have been reported in radish (Rivetta et al. 1997), tobacco (Choi et al., 2001), rice roots (Kim et al., 2002) and Arabidopsis seedlings (Suzuki, 2005). Also, in Arabidopsis thaliana AtHMA1 functions as a Ca2+/ heavy metal pump (Moreno et al. 2008). Analysis of the interaction between calcium and cadmium in wildtype and all mutant plants the extent of the effect of Ca2+ on Cd2+toxicity is related the concentrations of Cd2+ and Ca2+. Our results confirm this conclusion: 30 mM Ca2+ almost completely compensated the toxic effect of 30 and 60 μM Cd2+ (except for AtClCad and AtClCabd in 60 μM Cd2+). But at 90 μM Cd2+ the alleviation by 30 mM Ca2+ was not complete. Furthermore, in 90 μM Cd2+, 0.5 – 1 mM of Ca2+ reduces toxicity by 1/3 to 2/3 and 2.5-30 mM Ca2+ reduces the effect of cadmium by more than 2/3 (Figure 2b). Our results showed that, of the different cations tested (BaCl2, MgCl2 , CaCl2 and cholinchloride), only addition of CaCl2 alleviated cadmium-induced root growth inhibition. This rules out that the antagonism between cadmium and calcium depends on the occupation of extracellular binding sites, as for such a mechanism one would expect also a positive effect of the other divalent cations. 85 Chapter 5 The most intriguing result in our study is the differential effect of calcium on the cadmium toxicity in the Atclca and Atclcd mutants. Increasing the calcium concentration in the double mutant AtClCad and triple mutant AtClCabd treated with Cd2+, alleviated root growth significantly less than in other mutants and wildtype plants (Figure 2). Several reports have made a connection between anion transporters and heavy metal translocation. Heavy metals are transported across cell membranes by a number of complex mechanisms. In animals metal transport into cells is sensitive to the anion channel blocker DIDS (Simons, 1986; Lou et al., 1991). For animal cells it has been proposed that heavy metals can cross the membranes via the anion channel in the form of anionic complexes with carbonate, bicarbonate, hydroxyl, or chloride ions (Foulkes, 2000). Several previous investigations have demonstrated the important role of Ca2+ for root elongation, even in the absence of metal toxicity (Demidchik et al., 2002; Hanson, 1984; Kinraide, 1998). In plant guard cells (Schroeder and Hagiwara, 1989; Hedrich et al., 1990; Allen et al.,1999; Blatt, 1999 and Leonhardt et al., 2004) and in Arabiopsis thaliana suspension cells (Trouverie et al., 2008) anion channels are Ca2+sensitive and activated by transient increases of [Ca2+]. In Arabidopsis thaliana hypocotyl protoplasts, activation of anion channels is directly dependent to the calcium concentration at the cytosolic site of the plasma membrane (Lewis et al., 1997). Furthermore, reactive oxygen species (ROS), such as H2O2, are involved in signaling pathways through the activation of plasma membrane calcium channels (Pei et al., 2000; Murata et al., 2001, Kwak et al., 2003; Trouverie et al., 2008). One could hypothesize that activation of the anion current would result from the activation of calcium channels. Therefore, a simple explanation for the activation of anion channels by oxidative stress and calcium application would rely on the ability of heavy metalinduced increased ROS concentrations to promote Ca2+ influx. However, the even simpler hypothesis that cadmium toxicity is prevented by external calcium through competition for transporters and thus reduction of the intracellular [Cd2+], is a good possibility. However, in both explanations the mechanistic role of AtClCa and AtClCd is not obvious. Here we present a model for the role of these anion transporter proteins in cadmium-tolerance (Figure 8). AtClCa and AtClCd are located on endomembranes, have H+/anion antiporter activity and have the highest expression levels in the The role of AtClCa and AtClCd in heavy metal tolerance expansion and transition zone of the root (Lv et al., 2009). In yeast, mutants of gef1, an anion transporter located in the trans-Golgi vesicles, fail to properly regulate pH and are more sensitive to heavy metals. Heterologous expression of AtClCa, AtClCc or AtClCd could at least partly complement gef1, and restore heavy metal resistance (Gaxiola et al. 1998). Figure 8. Model for the role of ClC transporter proteins in the sequesteration of cadmium in intracellular compartments (e.g. the vacuole). A: Protons are actively pmped into the vacuole, resulting in a pH gradient and a tonoplast potential (positive inside), the activity of the ClC anion/proton antiporters proteins reduces the tonoplast potential and increases the concentration of anions in the tonoplast. This facilitates the the accumulation of positively charged Cd2+ in the vacuole. B: When the ClC anion/proton antiporters are either inactive or absent this leads to an excess of positive charges and an acidic pH in the vacuole. This situation reduces sequesteration of the Cd2+ in the vacuole. We propose that in Arabidopsis thaliana AtClCa and AtClCd have a similar function as a H+- and electrical shunt for the V-type ATPase and the heavy metal transporter, respectively. Functional AtClCa and AtClCd proteins facilitate a high accumulation of heavy metal in either the vacuole and/or acidic vesicles. The observation that only the double mutant is more sensitive implies that AtClCa and AtClCd have overlapping functionality. One possibility is that both are present in the membrane of the same compartment and thus are truly redundant. Another option is that they are localized in different compartments, but that heavy metal sequestration occurs in both compartments, viz. the acidic trans-Golgi vesicles and the vacuole. In this model the differential effect of Ca2+ on cadmium toxicity is based on two distinct mechanisms of heavy metal resistance: exclusion, which is aided by addition of calcium, and sequestration, which is facilitated by active AtClCa or AtClCd. Neither gives full protection when exposed to 90 μM Cd2+, but in combination they can restore full root growth and development. 87 Chapter 5 ACKNOWLEDGEMENTS This work was supported in part by a grant from the Ministry of Science, Research and Technology of the Islamic Republic of Iran. Chapter 6 General discussion and conclusions Hossein Moradi1,2, Theo Elzenga1 and Frank Lanfermeijer1 1 Department of Plant Biology, University of Groningen, 9750 AA Haren, The Netherlands 2 Department of Agronomy and Plant Breeding, Sari Agricultural Sciences and Natural Resources University, Iran 89 Chapter 6 Functional redundancy In the introduction we stated that we want to explore the position of the ClC proteins in the complex network of membrane transport and solute fluxes. This study shows that this is a complicated task. First of all, the most important problem seems to be the absence of obvious phenotypes for single mutants. It requires creativity of the scientist to generate conditions that evoke phenotypes. However, even the breeding of double and triple mutants is no easy road to success (Chapter 2). Appearently, the ClC channels exhibit high functional redundancy. We started from the rational that the ClC proteins have a clear function in either Cl- or NO3- homeostasis (Chapter 2 and 3). However, the absence of clear phenotypes when, for instance, seeds were germinated in the presence of high concentrations of these anions might indicate that their role in the homeostasis of those ions is limited. Plants apparently have developed other transporter systems for these functions. Our results more clearly indicate that ClC proteins play an important role in energizing the membrane and pH homeostasis. Energizing the membrane and pH homeostasis depend protons fluxes and currents carried by other ions. For generating a large [H+] gradient, necessary for a high capacity of secondary active transport of solutes, the electrical potential difference across the membrane has to be kept low. The electrical component of the proton pumping ATPase activity therefore has to be short-circuited. This shorting of the proton pump could be accomplished by any kind of current. It does not matter if it’s carried by Cl- or NO3- or even K+ (but then in the opposite direction). Although the ClC proteins can have distinct functions, for instance being either a Cl- or an NO3- transporter, their electro-physiological characteristics can still make them redundant as both can act as an electrical shunt in the generation of the proton-motive force (Chapter 4 and 5). The situation is probably even more complex as a shunt function can also be performed by a system not related to the ClC proteins, for instance, by a K+ channel. Hence, this suggests that in order to study the role of ClC proteins in energizing the membrane, the experiments should be highly defined and controlled. Composition of experimental media should be simple and the potential of alternative currents to occur should be limited. All electrophysiological tools should be used and, if possible, ClC-mediated fluxes should be studied in plants were alternative currents can be excluded. The second role of ClC proteins for which we found indications, is in the accumulation in osmotically active solutes. Osmotically active solutes can be any General discussion and conclusion soluble ion or compound. A cell can accumulate other solutes if one of the normally used solutes (Cl- or NO3-) is not available or can not be used (for instance in the absence of AtClC proteins). Hence, in this case complementation of the function can also be expected outside the group of ClC proteins: for example by malate or sugar transporters. A nice example of this type of redundancy is shown in Chapter 5. In this chapter it is shown that Ca2+ can not alleviate Cd2+-induced reduction of root growth if AtClCa and AtClCd are both absent. The currently favored model for explaining our observation is, that Cd2+ toxicity is countered in two ways: 1) Ca2+ protects the plant by competing with Cd2+ for essential sites in enzymes and transporters and 2) Cd2+ is sequestered in internal compartments (vacuole), rendering them harmless. We propose that in the latter mechanism ClC proteins play a role as shunts by allowing generation of a PMF across intracellular membranes and the transport of Cd2+ across these membranes (Chapter 5). In Chapter 1 (Table 1) it is suggested that AtClCa is a H+/NO3- and AtClCd is a H+/Cl- antiporter. The fact that you need to remove both transporters demonstrates that both proteins can be used as a shunt and complement each other. If one of the two ClC proteins is missing, either the Cl- or the NO3- ions can still be used to compensate the movement of positive charges (H+) by the primary proton pumps. Thus, only in the case where both ClC proteins are removed, there are apparently no transporters (or their charged substrates) present that can take over the function as shunt. It would be interesting to study the effect of Ca2+ on Cd2+ toxicity when the various genotypes are grown either on low Cl- or low NO3- media. Root growth as studied in Chapters 2, 3 and 4 showed also that the main functions of the ClC proteins are electrical circuits, which allow the generation of a PMF to drive the uptake of osmotically active solutes or stimulate the capacity to acidify the apoplast and thus facilitate cell expansion. Intracellular localization of the ClC proteins Although we do not need the exact localization of the ClC proteins in the model proposed in Chapter 5. It remains an important issue for understanding the roles of these proteins. And, as proposed above, if ClC proteins can functionally be replaced by proteins that are not related to them, localization can become an important issue. As suggested by the articles of Moore and Murphy (2009) and Millar et al. (2009) localization studies are difficult and need a careful approach. Presently only the paper 91 Chapter 6 of De Angeli et al. (2006) seem to meet some of the proper standards. In that study localization experiments on AtClCa are convincingly combined with physiological measurements aimed at elucidating the function (patch clamp measurements). Final conclusions The study of ClC proteins is a complicated one. They seem to play a role in different processes (osmo-regulation, detoxification, cell expansion, and maybe more). Roles that are so important in plant cells, that several protein systems exists which can fulfill these roles next to the ClC proteins. Functional studies on these proteins require, next to creativity of the researcher, very specific conditions in the experiments (for instance Ca2+ alleviation of Cd2+ effects) to observe phenotypes. Several important issues remain to be studied: the role of the two CBS domains and the role of ATP binding in the functioning of ClC proteins as shunts and osmoregulators. Also important for plants is the strictness of the duality of ClC proteins as specific Cl- or specific NO3- transporters and the strictness of the duality as channels or H+-cotransporters. The study of the ClC protein family will remain a challenge for researchers in the coming years and, very likely, will yield unforeseen and surprising results. References 93 References Accardi, A. and Miller, C. (2004) Secondary active transport mediated by a prokaryotic homologue of ClC Cl- channels. Nature., 427, 803-807. Accardi, A., Kolmakova-Partensky, L., Williams, C. and Miller, C. (2004) Ionic currents mediated by a prokaryotic homologue of ClC Cl- channels. Journal Gen. Physiology., 123, 109-119. Adler, P.R. and Wilcox, C.E (1995) Ammonium increases the net rate of sodium influx and parttioning to the leaf of muskmelon. Journal of Plant Nutrition. 18, 1951-1962 Allaway, W.G. (1973) Accumulation of malat in guard cells of Vicia faba during stomatal opening. Planta., 110, 63-70. Allen, G.J, Kutchisu, K, Chu, S.P, Murata, Y. and Schroeder, J.I. (1999) Arabidopsis abi1 and abi-2 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises in guard cells. Plant Cell, 11, 1785-1798. Ames, B, Shigenaga, M. and Hagen, T. (1993) Oxidants, antioxidants, and the degenerative diseases of ageing. Proceedings of the National Academy of Sciences, USA. 90, 7915-7922. Amtmann, A. and Sanders, D. (1999) Mechanisms of Na uptake by plant cells. Advances in Botanical Research., 29, 75-112. Arduini, I, Godbold, D.L. and Onnis, A. (1996) Influence of copper on root growth and morphology of pinus pinea L. and Pinus Pinaster Ait. Seedling. Tree physiology, 15, 411415. Aronson, P.S. (1985) Kinetics properties of the plasma membrane Na+/H+ exchanger. Annu. Rev. Physiol. 47, 545-560. Askerlund P, Sommarin M. (1996) Calcium efflux transporters in higher plants. In: Smallwood M, Knox JP, Bowles DJ, editors. Membranes: Specialized Functions in Plants. Oxford: BIOS Scientific Publishers., 281–299. Assmann,S.M. and Haubrick, L.L. (1996) Transport proteins of the plant plasma membrane. Curr Opin Cell Biol., 8, 458-467. Axelsen, K.B. and Palmgren, M.G. (1998) Evolution of substrate specificities in the P-type ATPases superfamily. J Mol Evol.,46,84–101. Bar, Y. Apelbaum, A. Kafkafi, U. and Goren, R. (1997) Relationship between chloride and nitrate and its effect on growth and mineral composition of avocado and citrus plants. Journal of Plant Nutrition. 20, 715-731. Bar, Y. Apelbaum, A. Kafkafi, U. and Goren, R. (1997) Relationship between chloride and nitrate and its effect on growth and mineral composition of avocado and citrus plants. Journal of Plant Nutrition. 20, 715-731. Barbier-Brygoo, H, Vinauger, M, Colcombet, J, Ephritikhine, G, Frachisse, J. and Maurel, C. (2000) Anion channels in higher plants: functional characterization, molecular structure and physiological role. Biochim. Biophys. Acta, 1465, 199-218. Barcelo, C.and Poschenrieder. (1990) Plant water relations as affected by heavy metal stress: a review. J. Plant Nutr, 13, 1-37. Baryla, A., Carrier, P., Franck, F., Coulomb, C., Sahut, C. and Havaux, M. (2002) Leaf chlorosis in oilseed rape plants (Brassica napus) grown on cadmium-polluted soil: causes and consequences for photosynthesis and growth. Planta, 212, 696-709. Beffagna, N., Romai, G., Meraviglia, G. and Pallini, S. (1997) Effects of abscisic acid and cytoplasmic pH on potassium and chloride efflux in Arabidopsis thaliana seedligs. Plant Cell Physiol., 38, 503-510. Benfey, N.B., Linstead, P.J., Roberts, K., Schiefelbein, J.W., Hauser, M.T. and Aeschbacher, R.A. (1993) Root development in Arabidopsis: four mutants with dramatically altered root morphogenesis. Development. 119, 57-70 Bergsdorf, E.Y., Zdebik, A.A and Jentsch., T.J (2009). Residues important for nitrate/proton coupling in plant and mammalian CLC transporters. J. Biol. Chem. 284, 11184-11193 Besson-Bard, A., Gravot, A., Richaud P., Auroy, P., Duc, C., Gaymard, F., Taconnat, L., Renou, J.P., Pugin, A. and Wandehenne, D. (2009) Nitric oxide contributes to cadmium toxicity in Arabidopsis by promoting cadmium accumulation in roots and by up-regulating genes related to iron uptake. Plant Physiology, 149, 1302-1315. References Blatt, M.R. (1999) Reassessing roles for Ca2+ in guard cell signalling. J. Exp. Bot, 50, 989999. Blazka, M.E. and Shaikh, Z.A. (1991) Differences in cadmium and mercury uptake by hepatocytes: role of calcium channel. Toxicol Appl Pharmacol, 110, 355-363. Blazka, M.E. and Shaikh, Z.A. (1992) Cadmium and mercury accumulation in rat hepatocytes. Toxicol Appl Pharmacol, 113, 118-125. Blumwald, E., Aharon, G.S. and Apse, M.P. (2000) Sodium transport in plant cell. Biochim. Biophys. Acta., 1465, 140-151. Bowling, D.J.F. (1976) Malate-switch hypothesis to explain the action of stomata. Nature., 262, 393-394. Brandt, P.C.and Vanaman, T.C. (1998) Calmodulin and ion flux regulation. In: Van Eldik L, Watterson DM, editors. Calmodulin and Signal Transduction. San Diego: Academic Press., 397–471. Breckle, S. (1991) Growth under stress. Heavy metals. In: Plant Poots: The Hidden Half, Eds.Y. Waisel, A. Eshel and U. Kafkafi, M. Dekker, Inc, New York, 351–373. Britto, D.T. Ruth, T.J. Lapi, S. and Kronzucker, H.J. (2004) Cellular and whole- plant chloride dynamics in barley: insights into chloride-nitrogen interaction and salinity responses. Planta. 218, 615-622. Buntemeyer, K., Luthen, H. and Bottger, M. (1998) Auxin-induced changes in cell wall extensibility of maize roots. Planta., 204, 515-519. Carpita, N. and Gibeaut, D.M. (1993) structural model of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth. The Plant Journal. 3, 1-30. Cataldo, D.A., Garland, T.R. and Wildung, R.E. (1981) Cadmium uptake kinetics in intact soybean plants. Plant Physiology and Biochemistry, 73, 844-848. Chang, G., Spencer, R.H Lee, A.T ., Barclay, M.T. and Douglas C. Rees, D.C. (1998) Structure of the MscL Homolog from Mycobacterium tuberculosis: A Gated Mechanosensitive Ion Channel. Science., 282, 2220 – 2226. Chanson, A. and Taiz, L. (1985) Evidence for an ATP-dependent proton pump on the Golgi of corn coleoptiles. Plant physiology., 78, 232-240. Cho, M.H. and Spalding, E.P. (1996) An anion channel in Arabidopsis hypocotyls activated by blue light. Proceedings of the National Academy of Sciences., 93, 8134-8138. Choi, Y.E., Harada, E., Wada, M., Tsuboi, H., Morita, Y., Kusano, T. and Sano, H. (2001) Detoxification of cadmium in tobacco plant: formation and active excretion of crystals containing cadmium and calcium through trichomes. Planta, 213, 45-50. Clemens, S. (2006) Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants. Biochimie, 88, 1707-1719. Clemens, S., Antosiewicz, D.M., Ward, J.M., Schachtman, D.P. and Schroeder, J.I. (1998) The plant cDNA LCT1 mediates the uptake of calcium and cadmium in yeast. Proc. Natl. Acad. Sci USA, 95, 12043-12048. Cocombet, J., Lelievre, F, Thomine, S.and Barbier-Brygoo, H. (2005) Distinct pH regulation of slow and rapid anion channels at the plasma membrane of Arabidopsis thaliana hypocotyls cells. J. Exp. Bot ., 56, 1897-1903. Cohen, J. and Schulten, K. (2004) Mechanism of anionic conduction across ClC. Biophysical Journal., 86, 836-845. Colcombet, J., Lellevre, F., Thomine, S. and Barbier-Brygoo, H. (2005) Distinct pH regulation of slow and rapid anion channels at the plasma membrane of Arabidopsis thaliana hypocotyl cells. Journal of Experimental Botany., 56, 1897-1903. Cosgrove, D.J. (1997) Relaxation in a high-stress environment: the molecular bases of extensible cell walls and cell enlargement. Plant Cell. 9, 1031-1041. Cosgrove, D.J. (1999) Enzymes and other agents that enhance cell wall extensibility. Ann. Rev. Plant Mol. Biol. 50, 391-417. Cosgrove, D.J. (2000) Loosening of plant cell walls by expansins. Nature. 407, 321-326. 95 References Cosson,P., Curtis,I., Pouyssegur,J., Griffiths,G. and Davoust,J.(1989) Low cytoplasmic pH inhibits endocytosis and transport from the trans-Golgi network to the cell surface. Journal Cell Biology.,108,377-387. Costa, G. and Morel, J.L. (1993) Cadmium uptake by Lupinus albus (L.): cadmium excretion, a possible mechanism of cadmium tolerance. J. Plant Nutr, 16, 1921-1929. Costa, G. and Morel, J.L. (1994) Efficiency of H+ ATPase activity on cadmium uptake by four cultivars of lettuce. J. Plant Physiology, 17, 627-637. De Angeli, A. Monachello,D. Ephritikhine, G. Frachisse, J.M. Thomine,S. Gambale, F. and Barbier-Brygoo, H. (2006) The nitrate/proton antiporter AtCLCa mediates nitrate accumulation in plant vacuoles. Nature. 442, 939-942. De Angeli, A., Thomine, S., Frachisse, J.M., Ephritikhine, G., Gambale, F. and BarbierBrygoo, H. (2007) Anion channels and transporters in plant cell membranes. FEBS Letters, 581, 2367-2374. De Cnodder, T., Verbelen, J.P. and Vissenberg, K. (2006) The control of cell size and rate of elongation in the Arabidopsis root. Plant Cell Monogr. 5, 249-269. De Michelis, M.I. and Spanswick, R.M. (1986) H+-pumping driven by the vanadatesensitive ATPase in membrane vesicles from corn roots. Plant Physiology. 81, 542-547. Dean, R.T., Gieseg, S. and Davies, M. (1993) Reactive species and their accumulation on radical-damaged proteins. Trends in Biological Sciences, 18, 437-441. Deanne-Drummond, C.E. (1986) A comparison of regulatory effects of chloride on nitrate uptake and nitrate on chloride uptake into Pisum sativum seedling. Physiologia Plantarum., 66, 115-121. Demidchik, V., Bowen, H.C., Maathuis, F.J.M., Shabala, S.N., Tester, M.A., White P.J. and Davies J.M.Arabidopsis thaliana root non-selective cation channels mediate calcium uptake and are involved in growth. The Plant Journal, 32, 799-808 Dettmer, J. Hong-Hermesdorf, A. Stierhof, Y.D. and Schumacher, K. (2006) Vacuolar H+ -ATPase activity is required for endocytic and secretory trafficking in Arabidopsis. The Plant Cell. 18, 715-730. Dettmer, J., Schubert, D., Calvo-Weimar, O., Stierhof, Y.D., Schmidt, R. and Schumacher, K. (2005) Essential role of the V-ATPase in male gametophyte development. Plant Journal., 41, 117-124. Dietrich, P. and Hedrich, R. (1998) Anions permeate and gate GCACl, a voltage-dependent guard cell anion channel. The Plant Journal., 15, 479-487. Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts, K. and Scheres, B. (1993) Cellular organization of the Arabidopsis thaliana root. Development, 119, 71-84. Donald, P. Briskin and Margaret, C. Cawienowski. (1996) Role of the plasma Membrane H+-ATPase in K+ transport'. Plant Physiol. 111 , 1199-1207. Downton, W.J.S. (1977) Influence of rootstocks on the accumulation of chloride, sodium and potassium in grapevines. Australian Journal of Agricultural Research. 28, 879-889. Doyle, D.A., Cabral, J. M., Pfuetzer, R.A., Kuo, A., Gulbis, J.M., Cohen, S.L., Chait, B.T. and Mackinnon, R. (1998) The structure of the potassium channel: molecular basis of K+ conduction and selectivity. Science., 280, 69-77. Dube, F., Dufresne, L., Coutu, L. and Clotteau, G. (1991) protein phosphorylation during activation of surf clam oocytes. Dev Biol., 146, 473-482. Duffield,M.D., Rychkov, G.Y., Bretag, A.H. and Roberts, M.L. (2005) Zinc inhibits human ClC-1 muscle chloride channel by interacting with its common gating mechanism. J Physiol, 568,5–12 Dutzler, R., Campbell, E. B. & MacKinnon, R. (2003). Gating the selectivity filter in ClC chloride channels. Science., 300, 108-12. Dutzler, R., Compbell, E.B., Cadene, M., Chait, B.T. and Mackinnon,R. (2002) X-ray structure of a ClC chloride channel at 3.0 A reveals the molecular basis of anion selectivity. Nature., 415, 287-294. References Edminds, B.T., Murray, J. and Condeelis, J. (1995) pH regulation of the F-actin binding properties of Dictyostelium elogation factor 1. Journal Cell Biology., 270, 15222-15230. Edwards, K.L. and Scott, T.K. (1974) Rapid growth responses of corn root segments: Effect of pH on elongation. Planta., 119, 27-37. Elzenga, J.T.M., Prins, H.B.A. and Van Volkenburgh, E. (1995) Light induced membrane potential changes of epidermal and mesophyll cells in growing leaves of pisum sativum arg. Planta., 197,127-134. Elzenga, J.T.M. and Van Volkenburgh, E. (1997) Characterization of a light-controlled anion channel in the plasma membrane of mesophyll cells of Pea. Plant Physiology., 113, 1419-1426. Evans, D.E. (1994) Calmodulin-stimulated calcium pumping ATPases located at higher plant intracellular membranes: a significant divergence from other eukaryotes Physiol Plant.,90,420–426. Evans, D.E. and Williams, L.E. (1998) P-type calcium ATPases in higher plants: biochemical, molecular and functional properties. Biochim Biophys Acta..,1376,1–25. Fahlke, C., Yu, H.T., Beck, C.L., Rhodes, T.H. and Georege, A.L. (1997) Pore-forming segments in voltage-gated chloride channels. Nature., 390, 529-532. Faller, P., Kienzler, K. and Krieger-Liszkay, A.( 2005) Mechanism of Cd toxicity: Cd inhibits photoactivation of photosystem II by competitive binding to the essential Ca site. Biochim, Biophys. Acta, 1706, 158-164. Fan, L.and Neumann, P.M. (2004) The spatially variable inhibition by water deficit of maize root growth correlates with altered profiles of proton flux and cell wall pH. Plant Physiology, 135, 2291-2300. Fasano, J.M., Swanson, S.J., Blancaflor, E.B., Dowd, P.E., Kao, T.H. and Gilroy, S. (2001) Changes in root cap pH are required for the gravity response of the Arabidopsis root. The Plant Cell., 13, 907-921. Faundez, V. and Hartzell, H.C. (2004) Intracellular chloride channels: determinants of function in the endosomal pathway. Science STKE.,. 2004, 1-7. Fecht-Bartenbach, J.V.D. Bogner, M. Krebs, M. Stierhof, Y.D. Schumacher, K. and Ludewig,U. (2007) Function of the anion transporter AtCLC-d in the trans-Golgi network. The Plant Journal. 50, 466-474 Feijo, J.A., Sainhas, J., Hackett, G.R., Kunkel, J.G. and Hepler, P.K. (1999) Growing pollen tubes possess a constitutive alkaline band in the clear zone and a growth-dependent acidic tip. Journal Cell Biology., 144, 483-496. Felle, H. (1994). The H+-/Cl - symporter in root hair cells of Sinapis alba. Plant Physiol., 106, 1131-1136 Felle, H., Boss, W.F. and Morré, D.J (1989) pH as a second messenger in plants. Second messengers in plant growth and development. Alan R. Liss, New York.145-166. Felle, H.H. (1994) The H+/Cl- symporter in root-hair cells of Sinapsis alba. Plant Physiology., 106, 1131-1136. Flower, T.J. and Yeo, A.R. (1995) Breeding for salinity resistance in crop plants. Aus.J. Plant Physiology., 22, 875-884. Folta, K.M. and Spalding, E.P. (2001) Unexpected roles for cryptochrome 2 and phototropin revealed by high-resolution analysis of blue light-mediated hypocotyl growth inhibition. Plant Journal., 26, 471-478. Foulkes, E.C. (2000) Transport of toxic heavy metals across cell membranes. Society for Experimental Biology and Medicine, 234-240. Frachisse, J.M., Colcombet, J., Guern, J. and Barbier-Brygoo, H. (2000) Characterization of a nitrate-permeable channel able to mediate sustained anion efflux in hypocotyl cells from Arabidopsis thaliana. The Plant Journal., 21, 361-371. Fujita, H.and Syono, K. (1996) Genetic analysis of the effects of polar auxin transport inhibitors on root growth in Arabidopsis thaliana. Plant Cell Physiology. 37, 1094-1101. Fujita, N., Mori, H., Yura,T. and Ishihama,A. (1994) Systematic sequencing of the Escherichia coli genome: analysis of the 2.4-4.1 min (110, 917-193, 643 bp) region. Nucleic Acids Res., 22, 1637-1639. 97 References Fukuda, A., Nakamura, A., Tagiri, A., Tanaka, H., Miyao, A., Hirochika, H. and Tanaka, Y. (2004) Function, intracellular localization and the impotance in salt tolerance of a vacuolar Na+/H+ antiporter from rice. Plant Cell Physiology., 45, 146-159. Gairola, C.G., Wagner, G.J. and Diana, J.N.(1992) Tobacco, Cd and health. J Smoking Rel.Dis,3, 3-6. Garnett, T.P. Shabala, S.N. Smethurst, P.J. and Newman, I.A. (2003) Kinetics of ammonium and nitrate uptake by eucalypt root and associated proton fluxes measured using ion selective microelectrodes. Functional Plant Biology. 30, 1165-1176. Gaxiola R.A., Yuan, D.S., Klausner, R.D. and Fink, G.R. (1998) The yeast CLC chloride channel functions in cation homeostasis. Proc. Natl. Acad. Sci. USA Geelen, D. Lurin, C. Bouchez, D. Frachisse, J.M. Leliever, F. Courtial, B. BarbierBrygoo, H. Guern, J. and Maurel, C. (2000) Disruption of putative anion channel gene AtCLC-a in Arabidopsis suggests a role in the regulation of nitrate content. The Plant Journal. 21, 259-269. Geisler, M., Axelsen, K., Harper, J.F. and Palmgren, M.G. (2000) Molecular aspects of higher plant P-type Ca2+-ATPases. Biochim Biophys Acta.,1465,52–78. Gilliham, M. and Tester, M. (2005) The regulation of anion loading to the maize root xylem. Plant Physiology., 137, 819-828. Godbold, D.L. (1991) Cadmium uptake in Norway spruce. Tree physiology, 9, 349-357. Graves, A.R., Curran, P.K., Smith, C.L. and Mindell, J.A. (2008) TheCl-/H+ antiporter ClC-7 is the primary chloride permeation pathway in lysosomes. Nature., 453, 788-792. Green, J.R., Brown, N.H., DiDomenico, B.J., Kaplan,J. and Eide, D.J. (1993) The GEFl gene of Asccharomyces cerevisiae encode an integral membrane protein: mutation in which have effects on respiration and iron-limited growth. Molecular Genetic., 241, 542-553. Greger, M. and Bertell, G. (1992) Effect of Ca2+ and Cd2+ on the carbohydrate metabolism in sugar beet (beta vulgaris). J. Exp. Bot, 43, 167-173. Greger, M. and Ogren, E. (1991) Direct and indirect effects of Cd on the photosynthesis and CO2-assimilation in sugar beet (Beta Vulgaris), Physio. Pant, 83, 129-135. Gue,F.Q., Young,J. and Crawford, N.M.(2003) The nitrate transporter AtNRT1.1 (CHL1) functions in stomatal opening and contributes to drought susceptibility in Arabidopsis. Plant Cell., 15,107-117. Guern, J. (1991) Regulation of intracellular pH in plant cells. International Review of Cytology., 127, 111-173. Guern, J., Mathieu, Y., Thomine, S., Jouanneau, J.P. and Beloeil, J.C. (1992) Plant cells counteract cytoplasmic pH changes but likely use these pH changes as secondary messenges in signal perception. Curr Top Plant Biochem Physiology., 11, 249-269. Guo, F.Q., Young, J. and Crawford, N.M. (2003) The nitrate transporter AtNRT1.1 (CHL1) functions in stomatal opening and contributes to drought susceptibility in Arabidopsis. Plant Cell., 15, 107-117. Gussarson, M., Asp, H., Adalsteinsson, S. and Jensen, P. (1996) Enhancement of Cd effects on growth and nutrient composition of birch (Betula pendula) by buthionine sulphoxinine. J. Exp Bot, 47, 211-215. Hafke,J.B., Hafke,Y., Smith, J.A., Luttge,U. and Thiel,G. (2003) Vacuuolar malate uptake is mediated by an anion selective inward rectifier. Plant Journal., 35,116-128. Hall, J.L. (2002) Cellular mechanisms for heavy metal detoxification and tolerance. J. Exp. Bot, 366, 1-11. Hanson, J.B. (1984) The function of calcium in plant nutrition. Advances in Plant nutrition, 1, 149-208. Harada,H. Kuromori, T. Hirayama, T. Shinozaki. and K. Leigh, R.A. (2004) Quantitative trait loci analysis of nitrate storage in Arabidopsis leading to an investigation of the contribution of the anion channel gene, AtCLC-c, to variation in nitrate levels. Journal of Experimental Botany. 55, 2005-2014. Hart, J.J., Welch, R.M., Norvell, W.A., Sullivan, L.A. and Kochian, L.V. (1998) Characterization of cadmium binding, uptake, and translocation in intact seedlings of bread and durum wheat cultivars. Plant Physiology, 116, 1413-1420. References Hasegawa, P.M., Bressean, R.A., Zhu, J.K. and Bohnert, H.J. (2000) Plant cellular and molecular response to high salinity. Annu. Rev. Plant Physiol. Plant Mol. Biol., 51, 463499. Hauser, M.T., Morikami, A. and Benfey, P.N. (1995) Conditional root expansion mutants of Arabidopsis. Development. 121, 1237-1252 Hechenberger, M. Schwappach, B. Fischer, W.N. Frommer, W.B. Jentsch, T.J. and Steinmeyer, K. (1996) A family of putative chloride channels from Arabidopsis and functional complementation of a yeast strain with a CLC gene disruption. Journal of Biological Chemistry. 271, 33632-33638. Hedrich, R. and Kurkdjian, A. (1988) Characterization of an anion-perme-able channel from sugar beet vacuoles: effect of inhibitors. EMBO Journal., 7, 3661-3666. Hedrich, R., Busch, H. and Raschke, K. (1990) Ca2+ and nucleotide dependent regulation of voltage dependent anion channels in the plasma membrane of gurd cells. EMBO J, 9, 38893892. Higgins, C.F. (1995) The ABC of channel regulation, Cell., 82, 693-696. Hille, B. (1992) Ionic channels of Excitable Membranes, 2nd Ed. Sinauer Associates, Sunderland, MA. Hirsichi, K.D., Korenkov, V.D., Wilganowski, N.L. and Wagner, G.J. (2000) Expression of Arabidopsis CAX2 in tobacco. Altered metal accumulation and increased manganese tolerance. Plant Physiology, 124, 125-133. Hoekenga, O.A., Maron, L.G., Pineros, M.A., Cancado, G.M., Shaff, J., Kobayashi, Y., Ryan, P.R., Dong, B., Delhaize, E., Sasaki, T., Matsumoto, H., Yamamoto, Y., Koyama, H. and Kochian, L.V. (2006) AtALMT1, which encodes a malate transporter, is identified as one of several critical genes for aluminum tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA., 103, 9738-9750. Hurth, A., Suh, S., Kretzscmar, T., Geis, T., Bregante, M., Gambale, F., Martinoia, E. and Neuhaus, E. (2005) Impaired pH homeostasis in Arabidopsis lacking the vacuolar dicarboxylate transporter and analysis of carboxylic acid transport across the tonoplast. Plant physiology., 137, 901-910. Jagodin, B., Govorina, V., Vinogradova, S., Zamaraev, A. and Chapovskaja G. (1995) Cadmium and lead accumulation in some agricultural crops, grown in podzolic soils. Izvestija TSHA, 2, 85–99 (in Russ.). Jentsch, T.J. Poet. M. Fuhrmann, J.C. and Zdebik, A.A. (2005) Physiological function of CLC Cl-channels gleaned from human genetic disease and mouse models. Annu. Rev. Physiology. 67, 779-807. Jentsch, T.J. Stein. V. Weinreich, F. and Zdebik, A.A. (2002) Molecular structure and physiological function of chloride channels. Physiol. Rev. 82, 503-568. Jentsch, T.J.(1996) Chloride channels: a molecular perspective, Curr.Opin. Neurobiolo., 6, 303-310. Jentsch, T.J., Friedrich, T., Schriever, A. and Yamada, H. (1999) The ClC chloride channel family. Journal physiology., 437, 783-795. Jentsch, T.J., Gunter, W., Pusch, M. and Schwappach, B. (1995) Properties of voltagegated chloride channels of the ClC gene family. Journal Physiology., 482, 198-258. Jentsch, T.J., Maritzen, T. and Zdebik, A.A. (2005) Chloride channel diseases resulting from impaired transepithelial transport or vesicular function. The Journal of Clinical investigation. Rev., 115, 2039-2046. Jentsch, T.J., Stein, V., Weinreich, F, and Zdebik, A.A. (2002) Molecular structre and physiological function of chloride channel. Plant Physiology, 82, 503-568. Jentsch, T.J., Steinmeyer, K.and Schwarz, G. (1990) Primary structure of Torpedo marmorata chloride channel isolated expression cloning in Xenopus oocytes. Nature., 348, 510-514. Johannes, E., Crofts, A. and Sanders, D. (1998) Control of Cl- efflux in Chara coralline by cytosolic pH, free Ca2+, and phosphorylation indicates a role of plasma membrane anion channels in cytosolic pH regulation. Plant Physiology., 118, 173-181. 99 References Kafkafi, U. Valoras, N. and Letey, J (1982) Chloride interaction with nitrate and phosphoate nutrition in tomato (Lycopersicon esculentum L). Journal of Plant Nutrition. 5, 1369-1385. Keller, B.U., Hedrich, R. and Raschke, k. (1989) Voltage-dependent anion channels in the plasma membrane of guard cells. Nature., 341, 450-453. Kiegle, E., Gilliham, M., Haseloff, J. and Tester, M. (2000) Hyperpolarisation-activated calcium currents found only in cells from the elongation zone of Arabidopsis thaliana roots. Plant Journal., 21, 225-229. Kim, Y., Yang, Y.Y. and Lee, Y. (2002) Pb and Cd uptake in rice roots. Physiology Plant, 116, 368-372. Kinraide, T.B. (1998) Three mechanisms for the calcium alleviation of mineral toxicities. Plant Physiology, 118, 513-520. Kinraide, T.B., Perler, J.F. and Parker, D.R. (2004) Relative effectiveness of calcium and magnesium in the alleviation of rhizotoxicity in wheat induced by copper, zinc, aluminium, sodium, and low pH. Plant and Soil, 259, 201-208. Klimyuk,V.I,. Carroll, B.J,. Thomas, C.M, and Jones, J.D. (1993) Alkali treatment for rapid preparation of plant material for reliable PCR analysis. The Plant Journal., 3, 493494. Köhler,B. and Raschke,K. (2000) The delivery of Salts to the Xylem. Three Types of Anion Conductance in the Plasmalemma of the Xylem Parenchyma of Roots of Barley. Plant Physiol., 122, 243-254. Köhler,B., Wegner, L.H., Osipov. and V., Raschke, K. (2002) Loading of nitrate into the xylem: apoplastic nitrate controls the voltage dependence of X-QUAC, the main anion conductance in xylem-parenchyma cells of barley root. Plant Journal., 30, 133-142. Kwak, J.M., Mori, I.C., Pei, Z.M., Leonhardt, N., Torres, M.A., Dangl, J.L., Bloom, R.E., Bodde, S., Jones, J.D. and Schroeder, J.I. (2003) NADPH oxidase AtrbohD and Atrbohf genes function in ROS-dependent ABA signalling in Arabidopsis. EMBO J. 22, 2623-2633. Lanfermeijer, F.C. , Staal, M., Malinowski, R., Stratmann, J.W., Elzenga, J.T.M. (2008) Micro-Electrode Flux Estimation Confirms that the Solanum pimpinellifolium cu3 Mutant Still Responds to Systemin. Plant Physiol., 146, 129-139. Larsson, E.H., Bornman, J.F. and Asp, H. (1998) Influence of UV-B radiation and Cd on chlorophyll fluorescence, growth and nutrient content in Brassica napus. J. Exp. Bot. 323, 1031-1039. Le, J., Vandenbussche, F., Van Der Straeten, D. and Verbelen, J.P. (2001) In the early response of Arabidopsis root to ethylene, cell elongation is up and down regulated and uncoupled from differentiation. Plant Physiology. 125, 519-522. Leonhardt, N., Kwak, J.M., Robert, N., Waner, D., Leonhardt, G. and Schroeder, J.I. (2004) Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. Plant Cell, 16, 596615. Leonhardt, N., Vavasseure, C. and Forestier, C. (1999) ATP binding cassette modulators control abscisic acid regulated slow anion channels in guard cells. Plant Cell., 11, 11411152. Lewis, B.D., Karlin-Neumann, G., Davis, R.W. and Spalding, E.P. (1997) Ca2+ -activated anion channels and membrane depolarizations induced by blue light and cold in Arabidopsis seedlings. Plant Physiology, 114, 1327-1334. Li, J., Yang, H., Peer, W.A., Richter, G., Blakeslee, J., Bandyopadhyay, A., Titapiwantakun, B., Undurraga, S., Khodakovskaya, M., Richards, E.L., Krizek, B., Murphy, A.S., Gilroy, S. and Gaxiola, R. (2005) Arabidopsis H+-Ppase AVP1 regulates auxin-mediated organ development. Science., 310, 121-125. Lisal, J and Maduke, M (2008) The ClC-0 chloride channel is a 'broken' Cl-/H+ antiporter. Nat Struct Mol Biol, . 15, 805-810. Lorenzen, I. Aberle, T. and Plieth, C. (2004) Salt stress-induced chloride flux: a study using transgenic Arabidopsis expressing a fluorescent anion prob. Plant Journal. 38, 539-544. References Lou, M., Garay, R. and Alda, J.O. (1991) Cadmium uptake through the anion exchanger in human red blood cells. J. Physiology, 443, 123-136. Lu, Y.P., Li, S.Z.and Rea, P.A. (1997) AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene. Proc. Natl. Acad. Sci. USA., 94, 8243-8248. Luan, S. (2008) The CBL-CIPK network in plant calcium signalling. Trends in Plant Science, 14, 37-42. Lurine, C. Geelen, D. Barbier-Brygoo, H. Guern, J. and Maurel, C. (1996) Cloning and functional expression of plant voltage-dependent chloride channel. The Plant Cell. 8, 701711. Lv, Q.D. Tang,R.J. Liu, H. Gao, X.S. Li, Y.Z. Zheng, H.Q. and Zhang, H.X. (2009) Cloning and molecular analyses of the Arabidopsis thaliana chloride channel gene family. Plant Science. 176, 650-661. Lynch, J. (1995) Root architecture and plant productivity. Plant physiology 109, 7-13 Maathuis, F.J. and Sanders, D. (1994) Mechanism of high-affinity potassium uptake in roots of Arabidopsis thaliana.Cell Biology., 91, 9272-9276. Maclennan, H., Beevers, H. and Harley, J.L. (1963) Compartmentation of acid in plant tissues. Biochem. Journal., 89, 316-327. Malayev, A. and Nelson, D.J. (1995) Extracellular pH modulates the Ca+2 current activated by depletion of intracellular Ca+2 stores in human macrophages. Journal Membrane Biology., 146, 101-111. Malik, D., Sheoran, I. and Singh, R. (1992) Carbon metabolism in leaves of cadmium treated wheat seedling. Plant Physiology. Biochem, 30, 223-229. Marigo, G., Bouyssou, H.and Belkoura, M. (1985) Vacuolar efflux of malat and its influence on nitrate accumulation in Catharanthus roseus cell. Plant Science., 29, 193-213. Marmagne, A., Vinauger-Douard, M., Monachello, D., De Longevialle, A.F., Charon, C., Allot, M., Rappaport, F., Wollman, F.A., Barbier-Brygoo, H. and Ephritikhine, G. (2007) Two members of the Arabidopsis CLC (chloride channel) family, AtCLCe and AtCLCf, are associated with thylakoid and Golgi membranes, respectively. Journal of Experimental Botany, 14, 1-9. Mazess, R. and Barden, H. (1991) Bone density in premenopausal women; effect of age, dietary intake, physical activity, smoking and birth control pills. Am.J. Clin. Nutr, 53, 132142. McQueen-Mason, S., Durachko, D.M. and Cosgrove, D.J. (1992) Two endogenous proteins that induce cell wall extension in plants. Plant Cell. 4, 1425-1433. Meyer, S., Savaresi, S., Forster, I.G. and Dutzler, R. (2007) Nucleotide recognition by the cytoplasmic domain of the human chloride transporter ClC-5. Nat. Struct. Mol. Biol., 14, 60-67. Meyer, S., Savaresi, S., Forster, I.G. and Dutzler, R. (2007) Nucleotide recognition by the cytoplasmic domain of the human chloride transporter ClC-5. Nat. Struct. Mol. Biol., 14, 60-67. Miller, A.J.and Smith,S.J. (1996) Nitrate transport and compartmentation in cereal root cells. Journal of Expriental Botany. 47, 843-845. Miller, C. (2006) ClC chloride channels viewed through a transporter lens. Nature., 440, 484488. Mindell, J.A. (2008) The chloride channel’s appendix. Nature Structural & Molecular Biology 15, 781-783. Mitsuda, N., Enami, k., Nakata, M., Takeyasu, K. and Sato, M.H. (2001) Novel type Arabidopsis thaliana H+-PPase is localized to the Golgi apparatus. FEBS Lett., 488, 29-35. Moreno, I., Norambuena, L., Maturana, D., Toro, M., Vergara, C., Orellana, A., ZuritaSilva, A. and Ordenes, V.R. (2008) AtHMA1 is a thapsigargin sensitive Ca2+/ heavy metal pump. American Society for Biochemistry and Molecular Biology, 1-21. Murata, Y., Pei, Z.M., Mori, I.C. and Schroeder, J.I. (2001) Abscisic acid activation of plasma membrane Ca2+ channels in guard cells requires cytosolic NAD(P)H and is 101 References differentially disrupted upstream and downstream of reactive oxygen species production in abi1-1 and abi2-1 protein phosphates 2C mutants. Plant Cell, 13, 2513-2523. Nelson, M.T. (1986) Interactions of divalent cations with single calcium channels from rat brain synaptasomes. J. Gen. Physiol, 87, 201-222. Newman, I. A. (2001) Ion transport in roots: measurement of fluxes using ion-selective microelectrodes to characterise transporter function. Plant, Cell & Nguitragool, W and Miller, C. (2006) Uncoupling of a ClC Cl−/H+ exchange transporter by polyatomic anions. Journal of Molecular Biology, 362, 682-690 Nuhse, T.S., Peck, S.C., Hirt, H. and Boller, T. (2000) Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana MAPK 6. Journal of Biological Chemistry., 275, 7521-7526. Nurnberger, T., Nennstiel, D., Jabs, T., Sacks, W.R., Hahlbrock, K. and Scheel, D. (1994) High affinity binding of fungal oligopeptide elicitor to parsley plasma membranes triggers multiple defense resposes. Cell., 78, 449-460. O’Neill, R.A. and Scott, T.K. (1983) Proton flux and elongation in primary roots of barley (Hordeum vulgar L.). Plant Physiology., 73, 199-201. O’Neill,R.A. and Scott,T.K. (1983) Proton flux and elongation in primary roots of barley (Hordeum vulgar L.). Plant Physiology., 73, 199-201. Orlowski, J. and Grinstein, S. (1997) Na+/H+ exchangers of mammalian cells. J. Biol. Chem., 272, 22373-22376. Østergaard, L.and Yanofsky, M.F. (2004) Establishing gene function by mutagenesis in Arabidopsis thaliana. The Plant Journal., 39, 682-696. Pandey, S., Zhang, W. and Assmann, S.M. (2007) Roles of ion channels and transporters in guard cell signal transduction .FEBS Letters., 581, 2325-2336. Park, S., Rancour, D.M. and Bednare, S.Y (2008) In planta analysis of the cell cycledependent localization of AtCDC48A and Its critical roles in cell division, expansion, and differentiation. Plant Physiology 148, 246-258. Patrick, J.W. and Offler, C.E. (2001) Compartmentation of transport and transfer events in doveloping seeds. J. Exp. Bot., 52, 551-564. Pei, Z.M., Kuchitsu, K., Ward, J.M., Schwarz, M. and Schroeder, J.I. (1997) Differential abscisic acid regulation of guard cell anion channels in Arabidopsis wild-type and abi1 and abi2 mutants. Plant Cell., 9, 409-423. . Perlin, D.S. Kasamo, K. Brookers, R.J. and Slayman, C.W. (1984) Electrogenic H+ translocation by the plasma membrane ATPase of Neurospora. Journal of Biological Chemistry. 259, 7884-7892. Peters, W.S. and Felle, H.H. (1999) The correlation of profiles of surface pH and elongation growth in maize roots. Plant Physiology., 121, 905-912. Picollo, A. and Pusch, M. (2005) Chloride/proton antiporter activity of mammalian ClC proteins ClC-4 and ClC-5. Nature., 436, 420-423. Pilet, P.E., Versel, J.M. and Mayor, G. (1983) Growth distribution and surface pH patterns along the maize roots. Planta. 158, 398-402. Pineros, M.A., Shaff, J.E. and Kochian, L.V. (1998) Development, characterization, and application of a cadmium-selective microelectrode for the measurement of cadmium fluxes in roots of Thlaspi species and wheat. Plant physiology. 116, 1393-1401. Pinto, A.P., Mota, A.M., De Varennes, A. and Pinto, F.C. (2004) Influence of organic matter on the uptake of Cd, Zinc, copper and iron by sorghum plant. Sci Tot Environ, 326, 239-274. Plan, P.J., Gelli, A. and Blumwald, E. (1994) Vacuolar chloride regulation of an anionselective tonoplast channel. The Journal of Membrane Biology., 140, 1-12. Purdy, M.D., Wiener, M.C. (2000) Expression, purificatio, and initial structural characterization of YadQ, a bacterial homolog of mammalian ClC chloride channel proteins. FEBS Lett., 466, 26-28. Pusch, M. Ludewig, U. Rehfeldt, A. and Jentsch, T.J. (1995) Gating of the voltagedependent chloride channel ClC-0 by the permeant anion. Nature. 327, 527-531 References Putnam, R. (1998) Intracellular pH regulation. In N Sperelakis, ed, Cell physiology Source Book. Academic Press, San Diego, 293-305. Qi, Z., Kishigami, A., Nakagawa, Y., Iida, H. and Sokabe, M. (2004) A mechanosensitive anion channel in Arabidopsis thaliana mesophyll cells. Plant Cell Physiology., 45, 17041708. Rayle, D. and Cleland, R.E. (1970) Enhancement of wall loosening and elongation by acid solution. Plant Physiology. 46, 250-253. Rayle, D. and Cleland, R.E. (1992) The acid growth theory of auxin-induced cell elongation is alive and well. Plant physiology. 99, 1271-1274. Rea, P.A., Li, Z.S., Lu, Y.P, Drozdowicz, Y.M. and Martinoia, E. (1998) From vacuole GS-X pumps to multispecific ABC transporters. Annu. Rev. Plant Physiology. Plant Mol. Biol., 49, 727-760. Rivetta, A., Negrini, N. and Cocucci, M. (1997) Involvement of Ca2+ -calmodulin in Cd2+ toxicity during the early phases of radish (Raphanus sativus L.) seed germination. Plant Cell Environ, 20, 600-608. Rodriguez-Serrano, M., Romerro-Puertas, M.C., Pazmino, D.M., Testillano, P.S., Risueno, M.C., Del-Rio, L.A. and Sandalio, L.M. (2009) Cellular response of pea plants to cadmium toxicity: cross-talk between reactive oxygen species, nitric oxide and calcium. Plant Physiology Preview, 108, 1-37. Romero, J.M., Maronon, T. and Murillo. (1994) Long term responses of Melilotus segatalis to salinity. П Nutrient absorption and utilization. Plant Cell Environment., 17, 1249-1255. Romero-Aranda, R., Moya, J.L., Tadeo, F.R., Legaz, F., Primo-Millo, E, and Talon, M.(1998) Physiological and anatomical disturbances induced by chloride salt in sensitive and tolerant citrus: beneficial and detrimental effects of cations. Plant Cell and Environment, 21, 1243-1253. Rubio, F., Gassmann, W. and Schroeder JI. (1995) Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science.270,1660–1663. Ryan, J.A., Pahren, H.R, and Lucas, J.B. (1982) Controlling cadmium in the human food chain: a review and rationale based on health effects. Environ. Res, 28, 251-302. Salinas, T., Duchene, A.M., Delage, L., Nilsson, S., Glaser, E., Zaepfel, M. and Marechal-Drouard, L. (2006) The voltage-dependent anion channel, a major component of the tRNA import machinery in plant mitochondria. Plant Biology., 103, 18362-18367. Salt, D.E. and Wagner, G.J. (1993) Cadmium transport across tonoplast of vesicles from oat root. Evidence for a Cd2+/ H+ antiport activity, J. Biol. Chem, 17, 12297-12302. Sanchez-Fernandez, R., Aldiles-Diaz, W., Van Montagu, M., Inze, D. and May, M.J. (1998) Cloning and expression analyses of AtMRP4, a novel MRP-like gene from Arabidopsis thaliana. Mol. Gen. Genet., 258, 655-662. Sandalio, L.M., Dalurzo, H.C., Gomez, M., Romero-Puertas, M.C. and Del-Rio, L.A. (2001) Cd-induced changes in the growth and oxidative metabolism of pea plants. J. Exp. Bot, 52, 2115-2126. Sanders, D., Brownlee, C. and Harper JF. Communicating with calcium. (1999) Plant Cell.;11:691–706. Sarafian, V., Kim, Y., Poole, R.J. and Rea, P.A. (1992) Molecular cloning and sequence of cDNA encoding the pyrophosphate-energized vacuolar membrane proton pump of Arabidopsis thaliana. Proc Natl Acad Sci U S A., 89, 1775-1779. Sarath, G., Hou, G., Baird, L.M. and Mitchell, R.B. (2007) Reactive oxygen species, ABA and nitric oxide interactions on the germination of warm season C4-grasses. Planta, 226, 697-708. Sauer, M.R. (1968) Effects of vine rootstock on chloride concentration in Sultana scions. Vitis., 7, 223-226. Scheel, C., Zdebik, A.A., Lourdel, S. and Jentsch, T.J. (2005) Voltage-dependent electrogenic chloride/proton exchange by endosomal CLC proteins. Nature. 436, 424-427. 103 References Scherese, B., Benfey P. and Dolan L. (2002) Root development. The Arabidopsis book. 118. Schiefelbein, J.W., Masucci, J.D., Wang, H. (1997) Building a root: the control of patterning and morphogenesis during root development. Plant Cell. 9, 1089-1098. Schmidt, C. and Schroeder,J.I. (1994) Anion selectivity of slow anion channels in the plasma membrane of guard cells. Plant Physiology., 106, 383-391. Schmidt-Rose, T.and Jentsch, T.J. (1997) Transmembrane topology of a ClC chloride channel. Proc Natl Acad Sci USA., 94, 7633-7638. Schroeder, J.I. (1995) Anion channels as central mechanisms for signal transduction in guard-cells and putative functions in roots for plant-soil interactions. Plant Moecular Biology., 28, 353-361. Schroeder, J.I. and Hagiwara, S. (1989) Cytosolic calcium regulates ion channels in the plasma membrane of Vicia faba gurd cells. Nature, 338, 427-430. Schroeder, J.I. and Keller, B.U. (1992) Two types of anion channel currents in guard cells with distinct voltage regulation. Proceedings of the National Academy of Sciences., 89, 5025-5029. Schutzendubel, A., Schwanz, P., Teichmann, T., Gross, K., Langenfeld-Heyser, R., Godbold, D.L.and Polle, A. (2001) Cadmium-induced changes in antioxidative systems, hydrogen peroxide content, and differentiation in Scots pine roots. Plant Physiology, 127, 887-898. Scott,A.C. and Allen,N.S. (1999) Changes in Cytosolic pH within Arabidopsis root Columella cells play a key role in the early signaling pathway for root gravitropism. Plant Physiology.,121,1291-1298. Segonzac, C. Boyer, J.C. Ipotesi, E. Szponarski, W. Tillard, P. Touraine, B. Sommerer, N. Rossignol, M. and Gibrat, R. (2007) Nitrate efflux at the root plasma membrane: identification of an Arabidopsis excretion transporter. The Plant Cell. 19, 3760-3777. Serrano, R., Mulet, J.M., Rios, G., de Marquez, J.A., Larrinoa, I., Leube, M.P., Mendizabal, I., Pascual-Ahuir, A., Proft, M., Ros, R. and Montesinos, C. (1999) Aglimpse of the mechanisms of ion homeostasis during salt stress. J. Exp. Bot., 50, 10231036. Shabala , S, Shabala, L. and Van Volkenburgh, E.(2003) Effect of calcium on root development and root ion fluxes in salinised barley seedlings. Funct Plant Biol., 30, 507514. Shabala, L., Cuin, T.A. and Newman, I.A.(2005) Salinity-induced ion flux patterns from the excised roots of Arabidopsis sos mutants.Planta., 222, 1041-1050. Shabala, S.N. and Lew, R.R. (2002) Turgor Regulation in Osmotically Stressed Arabidopsis Epidermal Root Cells. Direct Support for the Role of Inorganic Ion Uptake as Revealed by Concurrent Flux and Cell Turgor Measurements. Plant Physiol, 129, 290-299. Shabala, S.N. and Newman I.A. (1997) Proton and calcium flux oscillations in the elongation region correlate with root nutation. Physiol Plant. 100, 917-926 Sheoran, I., Singal, H. and Singh, R. (1990) Effect of cadmium and nickel on photosynthesis and the enzymes of the photosynthetic carbon reduction cycle in pigeon pea (Cajanus cajan L.). Photosynthesis Research, 23, 345-351. Showalter, A.M. (1993) Structure and function of plant cell wall proteins. Plant Cell. 5, 9-23. Sidler, M., Hassa, P., Hassan, S., Ringli, C. and Dudler, R. (1998) Involvement of an ABC transporter in a developmental pathway regulating hypocotyls cell elongation in the light. Plant Cell. 10, 1632-1636. Simons, T.J.B. (1986) The role of anion transport in the passive movement of lead across the human red blood cell membrane. J. Physiology, 378, 287-312. Sivaguru, M., Fujiwara, T., Samaj, J., Baluska, F., Yang, Z., Osawa, H., Maeda, T., Mori,T., Volkmann, D. and Matsumoto,H. (2000) Aluminium-induced 1-3-β-D-glcan inhibits cell to cell trafficking of molecules through plasmodesmata. A new mechanism of aluminium toxicity in plants. Plant Physiology. 124, 991-1005. Spalding, E.P. (2000) Ion channels and the transduction of light signals. Plant, Cell, Environment., 23, 665-674. References Staal, M., Elzenga, J.T.M., Van Elk, A.G., Prins, H.B.A. & Van Volkenburgh, E. (1994) Red and blue light-stimulated proton efflux by epidermal leaf cells of the argenteum mutant of Pisum sativum. J. Exp. Bot. 45: 1213-1218. Stein, W.D. (1990) Channel, carriers and pumps, An introduction to membrane transport. Academic press, San Diego Storey, R., Schachtman,D.P. and Thomas, M.R. (2003) Root structure and cellular chloride, sodium and potassium distribution in salinized grapevines. Plant, Cell & Environment., 26, 789-800. Stosh, S.J. and Bagchi, D. (1995) Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med, 18, 321-336. Strompen, G., Dettmer, J., Stierhof, Y.D., Schumacher, K., Jurgens, G. and Mayer, U. (2004) Arabidopsis vacuolar H+ -ATPase subunit E isoform 1 is required for Golgi organization and vacuole function in embryogenesis. The Plant Journal., 41, 125-132. Su, G.H., Magen, H., Tarchitzky, J. and Kafkafi, U. (2000) Advances in chloride nutrition of plants. Advances in Agronomy., 68, 97-150. Suh, S.J., Wang, Y.F., Frelet, A., Leonhardt, N., Klein, M., Forestier, C., MuellerRoeber,B., Cho, M.H., Martinoia, E. and Schroeder,J.I. (2007) The ATP Binding Cassette Transporter AtMRP5 Modulates Anion and Calcium Channel Activities in Arabidopsis Guard Cells. Cell death and differentiation.,. 282, 1916-1924. Suru, S.M. (2008) Onion and garlic extracts lessen cadmium-induced nephrotoxicity in rats. Biometals, 21, 623-633. Suzuki, N. (2005) Alleviation by Calcium of Cd-induced root growth inhibition in Arabidopsis seedling. Plant Biotechnolo, 22, 19-25. Swanson, S.J. and Jones, R.L. (1996) Gibberellic acid induces vacuolar acidification in barley aleuron. Plant Cell., 8, 2211-2221. Swarup, R., Paula Perry, P., Hagenbeek, D., Der Straeten, D.V., Beemster, G.T.S., Sandberg, G., Bhalerao, R., Ljung, K. and Malcolm J. Bennett, M.J. (2007) Ethylene upregulates auxin biosynthesis in Arabidopsis seedlings to enhance inhibition of root cell elongation. The Plant Cell 19, 2186-2196. Sze, H., Li, X. and Palmgren, M.G. (1999) Energization of plant cell membranes by H+ pumping ATPases: regulation and biosynthesis. The Plant Cell., 11, 677-689. Tanner, W. and Caspari. (1996) Membrane transport carriers. Annu Rev. Plant physiology: Plant Mol. Bio. 47, 595-627. Tapper,H. and Sundler,R. (1995) Protein-Kinase-C and intracellular pH regulate zymosaninduced lysosomal-enzyme secretion in macrophages. Journal Leukocyte Biology., 58,485494. Termat, A, and Munns, R. (1986) Use of concentrated macronutrient solutions to separate osmotic from NaCl- specific effects on plant growth. Australian Journal of Plant Physiology., 13, 509-522. Thomine, S., Zimmermann, S., Guern, J. and Barbier-Brygoo, H. (1995) ATP-dependent regulation of an anion channel at the plasma membrane of protoplasts from epidermal cells of Arabidopsis hypocotyls. Plant Cell., 7, 2091-2100. Tommasini, R., Vogt, E., Fromenteau, M., Hortensteiner, S., Matile, P., Amrhin, N. and Martinoia, E. (1998) An ABC-transporter of Arabidopsis thaliana has both glutathioneconjugate and chlorophyll catabolite transport activity. Plant J. 13, 773-780. Tretyn, A., Wagner, G. and Felle, H. (1991) signal transduction in Sinapis alba root hairs: auxin as external messenger. Journal of Plant Physiology., 139, 187-193. Trewavas, A. (1999) Le calcium, c'est la vie: calcium makes waves. Plant Physiol.,120,1–6. Trouverie, J., Vidal, G., Zhang, Z., Sirichandra, C., Madiona, K., Amir Zahia, Prioul, J.L., Jeannette, E., Rona, J.P. and Brault, M. (2008) Anion channel activation and proton pumping inhibition involved in the plasma membrane depolarization induced by ABA in Arabidopsis thaliana suspension cell are both ROS dependent. Plant Cell Physiology. 49, 1495-1507. 105 References Vahisalu, T., Kollist, H., Wang, Y.F., Nishimura,N., Chan, W.Y., Valerio,G., Lamminmäki,A., Brosché,M., Moldau,H., Desikan,R., SchroederJ.I & Kangasjärvi,J. (2008) SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling. Nature. 452, 487-491. Van der Leij, M., Smith, S.J.and Miller, A.J. (1998) Remobilisation of vacuolar stored nitrate in barley root cells. Planta., 205, 64-72. Vara, F. and Serrano, R. (1982) Partial purification and properties of the protontranslocating ATPase of plant plasma membranes. Journal of Biological Chemistry. 257, 12826-12830. Verbelen, J.P., Vissenberg, K., Kerstens, S. and Le, J. (2001) Cell expansion in the epidermis: microtubules, cellulose orientation and wall loosening enzymes. J.of Plant Physiology., 158, 537-543. Vreeburg, R.A.M., Benschop, J.J., Peeters, A.J., Colmer, T.D., Ammerlaan, A.H., Staal, M., Elzenga,J.T.M., Staals, R.H.J., Darley, C.P., McQueen-Mason SJ. and Voesenek, L.A. (2005) Ethylene regulates fast apoplastic acidification and expansin A transcription during submergence-induced petiole elongation in Rumex palustris. Plant J. 43, 597–610. Wagner, L.H. and Raschke. (1994) Ion channels in the xylem parenchyma of barley roots. A procedure to isolste protoplasts from this tissue and a patch clamp exploration of salt passages into xylem vessels. Plant Physiology., 105, 799-813. Ward, J.M., Pei, Z.M., Schroeder, J.I. (1995) Roles of ion channels in initiation of signal transduction in higher plants. Plant Cell., 7, 833-844. Wellhauser, L., Kuo, H.H., Stratford, F.L., Ramjeesingh, M., Huan, L.J., Luong, W., Li, C., Deber, C.M. and Bear, C.E. (2006) Nucleotides bind to the C-terminus of ClC-5. Biochem. J. 398, 289-294. Wellhauser, L., Kuo, H.H., Stratford, F.L., Ramjeesingh, M., Huan, L.J., Luong, W., Li, C., Deber, C.M. and Bear, C.E. (2006) Nucleotides bind to the C-terminus of ClC-5. Biochem. J. 398, 289-294. White, P.J. and Broadley, M.R. (2001) Chloride in soil and plants. Annuals of Botany., 967988. Woll, K.H., Leibowitz, M.K., Neumcke, B. and Hill, B. (1987) A high-conductance anion channel in adult amphibian skeletal muscle. European Journal of Physiology, 410, 632640. Yamamoto, Y., Hachia, A., Hamada, H. and Matsumoto, H. (1998) Phenylpropanoids as a protectant of aluminium toxicity in cultured tobacco cells. Plant Cell Physiology, 39, 950957. Yin, J., Kuang, Z., Mahankali, U. and Beck, T.L. (2004) Ion transit pathways and gating in ClC chloride channels. Proteins: Structure, Function, and Bioinformatics., 57, 414-421. Zeiger, E., Bloom, AJ. and Hepler PK (1978) Ion transport in stomatal guard cells. A chemiosmotic hypothesis. What's new. Plant Physiol., 9, 29-32. Zepeda-Jazo, I., Shabala, S., Chen, Z. and Pottosin, I.I. (2008) Na+-K+ transport in roots under salt stress. Plant Signal Behav. 3., 401–403. Zhang, W.H., Walker, N.A., Patrick, J.W. and Tyerman, S.D. (2004) Pulsing Cl- channels in coat cells of developing bean seeds linked to hypo-osmotic turgor regulation. J. Exp. Bot., 55, 993-1001. Zhu, J.K. (2002)Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biology., 53, 247-273. Zhu, J.K., Liu, J. and Xiong, L. (1998) Genetic analysis of salt tolerance in Arabidopsis thaliana: evidence of a critical role for potassium nutrition. Plant Cell., 10, 1181-1191. Zimmermann, S., Ehrhardt, T., Plesch, G. and Muller-Rober, B. (1999) Ion channels in plant signaling. Cell Mol Sci., 55, 183-203. Zimmermann, S., Frachisse, J.M., Thomine, S., Barbier-Brygoo, H. and Guern, J. (1998) Elicitor induced chloride influx and anion channels in tobacco cell suspensions. Plant Physiology and Biochemistry., 36, 665-674. SUMMARY In higher plants anion channels, present in various tissues and cell types, play importants roles in signaling pathways leading to the adaptation of plant cells to abiotic and biotic stresses, in the control of metabolism, and in the maintenance of the electrochemical gradients across membranes. One of the an protein families with anion channel function, is the Chloride Channel (ClC) family. First characterized in Torpedo marmorata, these proteins appear now to be ubiquitously present. Seven ClC genes are identified in the Arabidopsis genome. The main aim of this research was to physiologically characterize Arabidopis thaliana ClC proteins and to acquire knowledge on the position of ClC proteins in the complex network of membrane transport and solute fluxes. We used a reverse genetics approach with T-DNA knockout mutants of three of the 7 ClC-genes that are present in the genome of Arabidopsis thaliana: AtClCa, AtClCb and AtClCd. In chapter 1 we review the current state of the art on ClC transport proteins and relate the knowledge obtained from bacterial and non-plant systems with the Arabidopsis ClC proteins. Predictions and remarks, concerning function and localization of plant ClC transporters, are made. In chapter 2 the protocol of obtaining the three double mutants and the single triple mutant that can be made with the three single knock-out mutants, is described. The seven mutants are preliminary characterized by testing the effect of the mutation on seed germination, vegetative growth and ion fluxes in root and leaf tissue as measured by the Micro-Electrode Ion Flux Estimation (MIFE). In chapter 3 the MIFE technique was expanded with a flow-through system which allowed a controlled and gentle exchange of the measuring solution during an experiment. Ion fluxes from Atclcd mutant plants, which lack the AtClCd protein, were compared with those from wildtype plants. The results of these experiments indicate that AtClCd functions as an anion/H+ antiporter and might be involved in the accumulation of both Cl- and NO3- in the vacuole. In chapter 4 a root growth phenotype is described for mutant plants in which either AtClCa or AtClCd are knock-out by a T-DNA insertion. At pH 6.2 root growth in those mutant plants is impaired, compared with wildtype and the Atclcb mutant 107 plants. We measured the proton fluxes along the root from root tip till the first root hairs at different pH values. Additionally root growth was characterized and quantified. A model for the interaction between endomembrane anion/H+ antiporters, plasma membrane proton fluxes and cell expansion is discussed. In chapter 5 we study the effect of heavy metal treatments on the 7 mutant plants (single, double and triple mutants). No differences were observed between the root of the mutants and wildtype for cadmium, zinc and lead. Cadmium toxicity could be alleviated by increasing the external calcium concentration. This effect of high external calcium is not observed in the plants lacking both AtClCa and AtClCd. The double mutant Atclcad and the triple mutant Atclcabd therefore seem to be more sensitive to cadmium toxicity. Based on these results a role of AtClCa and AtClCd in cadmium detoxification is suggested and a mechanism is proposed. In chapter 6 all our result are placed in the context of the earlier published functions and localization of ClC transporter proteins. It is suggested that the main role of the ClC proteins is to function as electrical short circuits, which plays an important role in energizing the membranes. A role in NO3- and Cl- homeostasis seems of minor importance. Another important issue is the intracellular localization of these proteins. Knowledge on the whereabouts of these proteins in the cell has important implications on their functions. Although the results, published in the present literature are in agreement with the ideas of the function of the ClC proteins, care must still be taken with the interpretation of the fluorescence data on the localization of the ClC proteins. The published data seems to lack important controls. SAMENVATTING Anion-kanalen komen voor in praktisch alle cel- en weefseltypen van hogere planten. Zij hebben verschillende, belangrijke functies: in signalerings-routes die leiden tot aanpassing aan abiotische of biotische stress factoren, in het metabolisme en in het handhaven van elektrochemische gradiënten over membranen. Eén van de eiwitfamilies met een anion-kanaalfunctie is de Chloride Channel (ClC) familie. Het eerste lid van deze familie werd gevonden in het elektrische orgaan van de Gemarmerde Sidderrog (Torpedo marmorata), maar blijkt nu alom vertegenwoordigd in dieren, planten en bacterien. In het genoom van de Zandraket (Arabidopsis thaliana) zijn zeven ClC genen geïdentificeerd. Het doel van dit onderzoek was om de ClC eiwitten in Arabidopsis fysiologisch te karakteriseren en om kennis te vergaren omtrent de positie van ClC eiwitten in het complexe netwerk van membraantransport en ionstromen. We hebben een ‘reverse genetics’ benadering gebruikt met T-DNA knock-out mutanten van drie van de zeven ClC genen die aanwezig zijn in het genoom van Arabidopsis: AtClCa, AtClCb en AtClCd. In hoofdstuk 1 bespreken we de huidige stand van zaken omtrent de ClC transporteiwitten en wordt de kennis vergaard uit bacteriële en niet-plant systemen gerelateerd aan de ClC eiwitten in Arabidopsis. De mogelijke functies en de lokalisatie van de ClC transporteiwitten in planten worden behandeld. In hoofdstuk 2 wordt het protocol waarmee de drie dubbel-mutanten en de ene drie-dubbel mutant verkregen kunnen worden uit de drie enkele knock-out mutanten (AtClCa, AtClCb en AtClCd) beschreven. In een globale karakterisering werden de effecten van de mutaties in deze zeven mutanten getest op de ontkieming en vegetatieve groei. Verder werden de ionstromen in wortel- en bladweefsel bepaald middels de Micro-Electrode Ion Flux Estimation (MIFE) techniek. In hoofdstuk 3 werd de MIFE techniek uitgebreid met een zogeheten doorstroomsysteem waarmee de meetoplossing op een gecontroleerde en subtiele manier uitgewisseld kon worden tijdens het experiment. Ionenstromen van Atclcd mutanten, waarin het AtClCd eiwit ontbreekt, werden vergeleken met wildtype planten. De resultaten van deze experimenten geven aan dat AtClCd functioneert als een anion/H+ 109 antiporter en wellicht betrokken is bij de ophoping van zowel Cl- als NO3- in de vacuole van plantencellen. In hoofdstuk 4 wordt het fenotype van de wortel beschreven voor gemuteerde planten waarin zowel AtClCa of AtClCd middels een T-DNA insertie zijn uitgeschakeld. Bij een pH van 6.2 wordt wortelgroei bij deze mutanten geremd vergeleken met het wildtype en de AtClCb mutant. We hebben de protonenstroom langs de wortel, van het wortelmutsje tot de eerste wortelhaar, gemeten bij verschillende pH waarden. Uit kwantificatie van verschillende aspecten van de wortelgroei kan worden afgeleid dat de mutaties de strekkingsgroei van de cellen beinvloeden. Een model voor de interactie tussen endomembraan anion/H+ antiporters, protonenstroom over het plasmamembraan en celexpansie worden bediscussiëerd. In hoofdstuk 5 behandelt het effect van blootstelling aan zware metalen in de zeven mutanten (de enkele, dubbele en driedubbele mutanten). Er werden geen verschillen waargenomen tussen de wortelgroei van de mutanten en het wildtype behandeld met cadmium, zink en lood. Cadmium toxiciteit kon worden verminderd door de externe calcium concentratie te verhogen. Dit effect van een verhoogde externe calcium concentratie werd niet waargenomen in planten waarin zowel AtClCa als AtClCd ontbreken. De dubbele mutant Atclcad and the triple mutant Atclcabd lijken daardoor meer gevoelig te zijn voor cadmium. Gebaseerd op deze resultaten wordt een rol van AtClCa en AtClCd in de detoxificatie van cadmium gesuggereerd en een mechanisme wordt voorgesteld. In hoofdstuk 6 worden al onze bevindingen geplaatst in de context van eerder gepubliceerde functies en lokalisaties van de ClC transporteiwitten. Een belangrijke rol van de ClC eiwitten is het kortsluiten van de elektrische component van de protonenpomp in de tonoplast, waardoor deze de mogelijkheid krijgt om een sterk gradiënt op te bouwen in de protonen concentratie aan weerzijde van de tonoplast. Een rol in de NO3- en Cl- homeostase van de cel lijkt van minder groot belang. Kennis over de de intracellulaire lokalisatie van deze eiwitten in de cel heeft belangrijke implicaties voor hun functies. De ideeën die in dit proefschrift over de functies van de ClC eiwitten worden beschreven, zijn grotendeels in overeenstemming met de resultaten die al eerder gepubliceerd zijn. Echter, voor wat betreft de lokalisatie van deze eiwitten lijkt dat niet het geval. De studies waarin transporteiwitten worden geassocieerd aan een specifieke membraan in de cel zijn tot nu toe niet adequaat uitgevoerd. Definitieve conclusies zullen pas kunnen worden getrokken wanneer bij lokalisatie studies de controle of artefacten serieus plaatsvindt en wanneer ze worden gecombineerd met fysiologische metingen aan de betrokken membranen. 111 ﭼﮑﻴﺪﻩ در ﮔﻴﺎهﺎن ﻋﺎﻟﯽ ،ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮ در ﺑﺨﺸﻬﺎﯼ ﻣﺨﺘﻠﻒ ﮔﻴﺎهﺎن وﻏﺸﺎ هﺎﯼ ﻣﺨﺘﻠﻒ ﺳﻠﻮﻟﯽ دﻳﺪﻩ ﺷﺪﻩ اﺳﺖ .اﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎ ﺑﺎ اﻳﻔﺎ ﻧﻘﺶ در ﭼﺮﺧﻪ ﺳﻠﻮﻟﯽ از ﻃﺮﻳﻖ ﮐﻨﺘﺮل ﻣﺘﺎﺑﻮﻟﻴﺴﻢ ﺳﻠﻮﻟﯽ وﺣﻔﻆ ﺷﻴﺐ اﻟﮑﺘﺮوﺷﻴﻤﻴﺎﻳﯽ1اﻃﺮاف ﺳﻠﻮل ﺑﺎﻋﺚ ﺳﺎزﮔﺎرﯼ ﺳﻠﻮﻟﻬﺎﯼ ﮔﻴﺎهﯽ ﺑﻪ اﺳﺘﺮﺳﻬﺎﯼ زﻧﺪﻩ 2و ﻏﻴﺮزﻧﺪﻩ 3ﻣﯽ ﮔﺮدﻧﺪ .ﮐﻠﺮاﻳﺪ ﮐﺎﻧﺎﻟﻬﺎ 4ﻳﮑﯽ از ﻣﻬﻤﺘﺮﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ اﻳﻦ ﺧﺎﻧﻮادﻩ ﺑﻪ ﺷﻤﺎرﻣﯽ روﻧﺪ ﮐﻪ دراﻧﺘﻘﺎل ﺁﻧﻴﻮن ﺑﻪ ﺳﻠﻮل ﻧﻘﺶ دارﻧﺪ.اوﻟﻴﻦ ﻣﻄﺎﻟﻌﺎت در اﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎ ﺑﺮ روﯼ ﻧﻮﻋﯽ ﻣﺎهﯽ ) ﺗﺮﭘﺪﻣﺎرﻣﺮات (5اﻧﺠﺎم ﮔﺮدﻳﺪ وﺑﺪﻧﺒﺎل ﺁن در ﺟﺎﻧﻮران وﮔﻴﺎهﺎن ﺷﻨﺎﺳﺎﻳﯽ وﻣﻄﺎﻟﻌﻪ ﺷﺪ. هﺪف اﺻﻠﯽ دراﻳﻦ ﺗﺤﻘﻴﻘﺎت ،ﺑﺮرﺳﯽ وﻣﻄﺎﻟﻌﻪ ﻣﻮﻟﮑﻮﻟﯽ وﻓﻴﺰﻳﻮﻟﻮژﻳﮑﯽ ﺁﻧﻴﻮن ﮐﺎﻧﺎﻟﻬﺎ در ﮔﻴﺎﻩ ﻣﺪل ژﻧﺘﻴﮑﯽ ﺁراﺑﻴﺪﺑﺴﻴﺲ 6وﻧﻘﺶ ﺁﻧﻬﺎ درﺷﺒﮑﻪ اﻧﺘﻘﺎل ﻳﻮﻧﻬﺎ وﻣﻮاد دراﻃﺮاف ﺳﻠﻮل ﺗﻌﺮﻳﻒ ﮔﺮدﻳﺪ .دراﻳﻦ ﺗﺤﻘﻴﻘﺎت از روش ژﻧﺘﻴﮏ ﻣﻌﮑﻮس 7وﺑﺎ اﺳﺘﻔﺎدﻩ از اﻧﺘﻘﺎل دﯼ ان اﯼ ﺑﺎﮐﺘﺮﯼ 8ﺑﻪ 10 داﺧﻞ ژﻧﻮم ﮔﻴﺎﻩ ﻣﻴﺰﺑﺎن ،درﮔﻴﺎهﺎن ﺟﻬﺶ 9اﻳﺠﺎد ﮔﺮدﻳﺪ .ﺳﭙﺲ ﺑﺎ اﺳﺘﻔﺎدﻩ ازﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ ﮐﻪ ﻓﺎﻗﺪ ژﻧﻬﺎﯼ ﻣﻮردﻧﻈﺮﺑﻮدن ،ﻧﻘﺶ اﻳﻦ ژﻧﻬﺎ در ﭼﺮﺧﻪ ﺳﻠﻮﻟﯽ ﺑﺮرﺳﯽ ﺷﺪ. ﻓﺼﻞ اول -ﺑﺎ ﻣﺮورﯼ ﺑﺮ اﻧﻮاع ﺗﺮاﻧﺴﭙﻮرﺗﺮهﺎ درﻏﺸﺎئ ﺳﻠﻮﻟﯽ ،ﺳﺎﺧﺘﻤﺎن ﮐﺮﻳﺴﺘﺎﻟﯽ وﻣﻮﻟﮑﻮﻟﯽ ﺗﻮام ﺑﺎ ﮐﺎرﮐﺮد ﭘﺮوﺗﺌﻴﻨﻬﺎ ﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ در ﺑﺎﮐﺘﺮﻳﻬﺎ وﺟﺎﻧﻮران ﻣﻮرد ﻣﻄﺎﻟﻌﻪ و ﺑﺮرﺳﯽ ﻗﺮار ﮔﺮﻓﺖ .ﺑﺮاﺳﺎس اﻳﻦ ﻣﻄﺎﻟﻌﺎت ﺑﺮﺧﯽ از وﻇﺎﻳﻒ ،ﻣﺤﻞ ﻗﺮار ﮔﻴﺮﯼ اﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎ در ﮔﻴﺎهﺎن وﺗﻘﺴﻴﻢ ﺑﻨﺪﯼ ﮔﻴﺎهﺎن ﺑﺮاﺳﺎس ﺳﺎﺧﺘﻤﺎن ﻣﻮﻟﮑﻮﻟﯽ ﺁﻧﻬﺎ ﭘﻴﺶ ﺑﻴﻨﯽ 11ﮔﺮدﻳﺪ. ﻓﺼﻞ دوم -ﺟﻬﺖ ﺑﺮرﺳﯽ وﻇﺎﻳﻒ ﺑﺮﺧﯽ از ﺗﺮاﻧﺴﭙﻮرﺗﺮهﺎﯼ ﺁﻧﻴﻮﻧﯽ در ﮔﻴﺎهﺎن از ﻃﺮﻳﻖ ژﻧﺘﻴﮏ ﻣﻌﮑﻮس اﺑﺘﺪا ﮔﻴﺎهﺎن ﺳﻴﻨﮕﻞ ،12دﺑﻞ13و ﺗﺮﯼ ﭘﻞ 14ﻣﻴﻮﺗﻦ اﻳﺠﺎد ﮔﺮدﻳﺪ .ﺳﭙﺲ ﺁزﻣﺎﻳﺸﺎﺗﯽ در راﺑﻄﻪ ﺑﺎ اﺛﺮ ﻓﻘﺪان اﻳﻦ ژﻧﻬﺎ درﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ ﺑﺮ روﯼ ذﺧﻴﺮﻩ ﺁﻧﻴﻮﻧﻬﺎ درﮔﻴﺎهﺎن ،ﺟﻮاﻧﻪ زﻧﯽ ﺑﺬر ،ﻣﺮاﺣﻞ ﻣﺨﺘﻠﻒ رﺷﺪﯼ ﮔﻴﺎﻩ وﺟﺮﻳﺎن اﻧﺘﻘﺎل ﻳﻮﻧﻬﺎ دراﻃﺮاف ﺳﻠﻮﻟﻬﺎﯼ رﻳﺸﻪ وﺑﺮگ ﺑﺎ اﺳﺘﻔﺎدﻩ ازﺑﺮﺧﯽ اﻧﺪازﻩ ﮔﻴﺮﻳﻬﺎﯼ ﻣﻴﮑﺮواﻟﮑﺘﺮودﯼ ﻧﻈﻴﺮ دﺳﺘﮕﺎﻩ ﻣﺎﻳﻒ15ﻣﻮرد ﻣﻄﺎﻟﻌﻪ ﻗﺮار ﮔﺮﻓﺖ. ﻓﺼﻞ ﺳﻮم -ﺑﺎ اﻧﺠﺎم ﺁزﻣﺎﻳﺸﺎت اﻟﮑﺘﺮوﻓﻴﺰﻳﻮﻟﻮژﻳﮑﯽ ﺑﺮ روﯼ ﻳﮑﯽ ازژﻧﻬﺎﯼ ﻣﻬﻢ از ﺁﻧﻴﻮن ﮐﺎﻧﺎﻟﻬﺎ در ﺁراﺑﻴﺪﺑﺴﻴﺲ ،ﺑﻪ ﻧﺎم ﭘﺮوﺗﺌﻴﻦ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮ دﯼ16وﺑﺎ ﺗﻐﻴﻴﺮ و ﺗﺤﻮل در ﺳﻴﺘﻢ ﺛﺎﺑﺖ اﻧﺪازﻩ ﮔﻴﺮﯼ ﻳﻮﻧﻬﺎ دراﻃﺮاف ﺳﻠﻮل ﮔﻴﺎهﯽ ﺑﻪ ﺳﻴﺘﻢ درﺣﺎل ﮔﺮدش ﻣﺤﻠﻮل دراﻃﺮاف ﺳﻠﻮل، ﺑﺮﺧﯽ ازﮐﺎرﮐﺮدهﺎﯼ اﻳﻦ ﭘﺮوﺗﺌﻴﻦ درﺳﻠﻮل ﮔﻴﺎهﯽ ﻣﺸﺨﺺ ﮔﺮدﻳﺪ.ﺑﻪ ﻃﻮرﻳﮑﻪ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﮐﺎﻧﺎل دﯼ در ﮔﻴﺎﻩ ﺁراﺑﻴﺪﺑﺴﻴﺲ ﺑﻪ ﻋﻨﻮان ﻳﮏ ﺁﻧﺘﯽ ﭘﺮﺗﺮ 17ﺟﻬﺖ ﺗﺒﺎدل ﺁﻧﻴﻮن ﺑﺎ ﭘﺮوﺗﻮن ﻣﻌﺮﻓﯽ ﮔﺮدﻳﺪ ﮐﻪ در ذﺧﻴﺮﻩ ﻳﻮﻧﻬﺎﯼ ﮐﻠﺮاﻳﺪ وﻧﻴﺘﺮات در واﮐﻮﺋﻞ ﺳﻠﻮﻟﯽ ﻣﺸﺎرﮐﺖ ﻣﯽ ﮐﻨﺪ. ﻓﺼﻞ ﭼﻬﺎرم -ﺟﻬﺖ ﻣﻄﺎﻟﻌﻪ اﺛﺮ ﻣﺘﻘﺎﺑﻞ ﺁﻧﺘﯽ ﭘﺮﺗﺮهﺎ )ﺁﻧﻴﻮن /ﭘﺮوﺗﻮن ( درﻏﺸﺎهﺎﯼ داﺧﻠﯽ ﺳﻠﻮل وﭘﻤﭙﻬﺎﯼ ﭘﺮوﺗﻮﻧﯽ درﻏﺸﺎئ ﺳﻠﻮﻟﯽ ﺑﺎ اﻓﺰاﻳﺶ اﻧﺪازﻩ ﺳﻠﻮﻟﯽ ،ورود وﺧﺮوج ﭘﺮوﺗﻮﻧﻬﺎ ﺑﻪ ﺳﻠﻮل در ﻗﺴﻤﺘﻬﺎﯼ ﻣﺨﺘﻠﻒ رﻳﺸﻪ ﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ وﮔﻴﺎهﺎن ﺷﺎهﺪ18اﻧﺪازﻩ ﮔﻴﺮﯼ ﺷﺪ. ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ ازاﻳﻦ ﺁزﻣﺎﻳﺸﺎت ﻣﻨﺠﺮﺑﻪ اراﺋﻪ اﻟﮕﻮﯼ ﺟﺪﻳﺪﯼ درراﺑﻄﻪ ﺑﺎ اﺛﺮات ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ ﺑﺮﺗﻐﻴﻴﺮات ﺣﺠﻢ ﺳﻠﻮل ﮔﺮدﻳﺪ. ﻓﺼﻞ ﭘﻨﺠﻢ -ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻧﺘﺎﻳﺞ اﺧﻴﺮارﺗﺒﺎط ﺁﻧﻴﻮن ﮐﺎﻧﺎﻟﻬﺎ ﺑﺎ ﻓﻠﺰات ﺳﻨﮕﻴﻦ19در ﺟﺎﻧﻮران ،اﺛﺮ ﺑﺮﺧﯽ ﻓﻠﺰات ﺳﻨﮕﻴﻦ ﻧﻈﻴﺮ ﮐﺎدﻣﻴﻢ ،روﯼ وﺳﺮب ﺑﺮ روﯼ ﮔﻴﺎهﺎن ﻓﺎﻗﺪ ﺑﺮﺧﯽ از ژﻧﻬﺎ ﯼ ﺁﻧﻴﻮن ﮐﺎﻧﺎﻟﯽ ﻣﻮرد ارزﻳﺎﺑﯽ ﻗﺮار ﮔﺮﻓﺖ .ازﻣﻴﺎن ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ ازﺁن ،ﻣﻬﻤﺘﺮﻳﻦ ﻧﺘﺎﻳﺞ ﺷﺎﻣﻞ: اﺳ ﺘﻔﺎدﻩ از ﮐﻠ ﺴﻴﻢ ﺑ ﺴﺘﻪ ﺑ ﻪ ﻣﻴ ﺰان ﻏﻠﻈ ﺖ ﺁن ﺳ ﺒﺐ ﮐ ﺎهﺶ اﺛ ﺮات ﺳ ﻤﯽ ﺣﺎﺻ ﻞ از ﮐ ﺎدﻣﻴﻢ در ﺳﻠﻮل ﮔﻴﺎﻩ ﻣﯽ ﮔﺮدد ﺗﺎﺣﺪﯼ ﮐﻪ از ﮐﺎهﺶ رﺷﺪ رﻳﺸﻪ ﺟﻠﻮﮔﻴﺮﯼ وﻳﺎ ﺟﺒﺮان ﻣﯽ ﮐﻨﺪ. از ﻣﻴ ﺎن ژﻧﻬ ﺎﯼ ﻣﺨﺘﻠ ﻒ ﺁﻧﻴ ﻮن ﮐﺎﻧﺎﻟﻬ ﺎ ،ژﻧﻬ ﺎﯼ اﯼ 20ودﯼ ﻧ ﺴﺒﺖ ﺑ ﻪ دﻳﮕﺮژﻧﻬ ﺎ در ﭼﺮﺧ ﻪ اﺛﺮات ﮐﺎدﻣﻴﻢ ﺑﻴﺸﺘﺮﻳﻦ ﻧﻘﺶ را اﻳﻔﺎ ﻣﯽ ﮐﻨﻨﺪ .ﺑﻪ ﻃﻮرﻳﮑﻪ ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﺳ ﻤﻴﺖ زداﻳ ﯽ ﮐﻠ ﺴﻴﻢ ﺑﺮﺳ ﻤﻴﺖ ﮐ ﺎدﻣﻴﻤﯽ در ﮔﻴﺎه ﺎن ﺟﻬ ﺶ ﻳﺎﻓﺘ ﻪ دﺑ ﻞ ﻣﻴ ﻮﺗﻦ اﯼ دﯼ21و ﺗﺮﻳﭙ ﻞ ﻣﻴ ﻮﺗﻦ اﯼ ﺑ ﯽ دﯼ22ﻧﺴﺒﺖ ﺑﻪ دﻳﮕﺮ ﮔﻴﺎهﺎن ﺟﻬﺶ ﻳﺎﻓﺘﻪ وﮔﻴﺎهﺎن ﺷﺎهﺪ ،اﺧ ﺘﻼف ﻣﻌﻨ ﯽ دارﯼ ﻧ ﺸﺎن داد .ﺑﻨ ﺎﺑﺮا ﻳ ﻦ ﺑﺮﺧ ﯽ ازوﻇ ﺎﻳﻒ اﻳ ﻦ دو ژن در ﭼﺮﺧ ﻪ ﺳ ﻤﻴﺖ زداﻳ ﯽ ﮐ ﺎدﻣﻴﻢ در ﺳ ﻠﻮل ﮔﻴ ﺎهﯽ ﻣ ﺸﺨﺺ ﮔﺮدﻳﺪ. ﻓﺼﻞ ﺷﺸﻢ -ﺑﺎ ﺟﻤﻊ ﺑﻨﺪﯼ ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﻓﺼﻮل ﻗﺒﻠﯽ ،ﻧﺘﺎﻳﺞ ﻧﻬﺎﻳﯽ در راﺑﻄﻪ ﺑﺎ وﻇﺎﻳﻒ وﻣﺤﻞ ﻗﺮارﮔﻴﺮﯼ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ اراﺋﻪ ﮔﺮدﻳﺪ .ﺑﻪ ﻃﻮرﻳﮑﻪ ﭘﻴﺸﻨﻬﺎد ﮔﺮدﻳﺪ ﮐﻪ ﻧﻘﺶ اﻳﻦ ﭘﺮوﺗﺌﻴﻨﻬﺎ در اﻳﺠﺎد اﻧﺮژﯼ ﭘﺘﺎﻧﺴﻴﻞ ﻣﻮرد ﻧﻴﺎز در اﻃﺮاف ﺳﻠﻮل ﻧﺴﺒﺖ ﺑﻪ اﻧﺘﻘﺎل ﻳﻮﻧﻬﺎﯼ ﻧﻴﺘﺮات وﮐﻠﺮاﻳﺪ در ﺳﻠﻮل ﻣﻬﻤﺘﺮ اﺳﺖ .هﻤﭽﻨﻴﻦ اﻳﻦ ﭘﺮوﺗﺌﻴﻦ هﺎ در ﻏﺸﺎ هﺎﯼ داﺧﻠﯽ ﺳﻠﻮل درﻣﻘﺎﻳﺴﻪ ﺑﺎ ﻏﺸﺎئ ﭘﻼﺳﻤﺎﺋﺊ ﻧﻘﺶ ﻣﻮﺛﺮﺗﺮﯼ اﻳﻔﺎ ﻣﯽ ﮐﻨﻨﺪ. 1- Electrochemical gradients 2- Biotic stress 3- Abiotic stress )4- Chloride Channel(ClC 5- Torpedo marmorata 6- Arabidopsis thaliana 7- Reverse genetics 8- T-DNA 9- Mutation 10- Mutant 11- Predictions 12- Single mutant 13- Double mutant 14- Triple mutant )15- Micro-Electrode Ion Flux Estimation (MIFE 16- AtClCd 17- Anti porter 18- Wildtype 19-Heavy metal 20- AtClCa 21- Atclcad 22- Atclcabd 113 ACKNOWLEDGEMENTS First and above all, I praise God, the almighty for providing me this opportunity and granting me the capability to proceed successfully. This thesis appears in its current form due to the assistance and guidance of several people. I would therefore like to offer my sincere thanks to all of them. Theo Elzenga, my esteemed promoter, my cordial thanks for accepting me as a Ph.D student, your warm encouragement, thoughtful guidance, critical comments, and correction of the thesis. I want to express my deep thanks to my esteemed copromotor Frank Lanfermeijer for the trust, the insightful discussion, offering valuable advice, for your support during the whole period of the study, and especially for your patience and guidance during the writing process. I would like to thank the members of the reading committee, Prof. dr. Jacques Hille, Prof. dr.Bert van Duijn and Prof. dr. Sergey Shabala for their excellent advises and detailed review during the preparation of this thesis. I thank Ger, for his advices and his friendly assistance with various problems all the time, especially for his help with the paperwork, translation of many Dutch letters and his help outside the lab. Mohamed and Fatma, I greatly appreciate your excellent assistance and your spiritual supports for me and my family during my PhD study. I will never forget the time that we were together and discussed about religion and politics. Mohamed, I am pleased that you accepted to be my paranymf. Wouter, Thank you for translating the summary into Dutch and you accepting to be my paranymph. Marten, thanks for your excellent technical assistance in the Lab, particularly for MIFE technique, and your kindly answers to my general questions. I am grateful to the secretary Jannie, for assisting me in many different ways and handling the paperwork. Thanks also to all the members of plant physiology, Luit, Ineke , Marten, Cordula, Fatma, Jan Henk, Hamid , Wouter, Jacquline, Ika, Muhammad, Aleksandra, Desiree, Ana, Bep, and Freek, for providing a good atmosphere in our department and for useful discussions. My roommates, Jacquline and Ika, thank you very much for making the atmosphere of our room as friendly as possible. Jacques, Paul, Marcel, Bert, Reza, Ijaz, Eelco, Kamran, Sujeeth, and Jos, thank you for allowing me to use your facilities at the department of Molecular Biology and for useful suggestions. I also appreciate the financial support of the Iranian Ministry of Science, Research and Technology, during my Ph.D study, particularly Abdollahi and Nazemi as the scientific representatives of the Iranian government in the Schengen countries. Thanks to all my close friends and Iranian community of Ph.D student and their esteemed families, Abdollah bigi, Eslami, Najafi, Ramzani, Ryazi, Sohani and Shyrzadian for the joyful gatherings and all their supports. Els Prins, Although we have lived far from our relatives, but communication with you, provided emotional atmosphere for us. Hereby, I would like to thank you for everything. I cannot finish without thanking my family. . I warmly thank and appreciate my parents and my mother and father-in-law for their material and spiritual support in all aspects of my life. I also would like to thank my brothers, sister, and brothers and sisters-in-law, for they have provided assistance in numerous ways. I want to express my gratitude and deepest appreciation to my lovely sweet daughter, Narges, for her great patience and understandings and for being a nice Muslim girl. And finally, I know that you did not want to be named, a person that moved with me to the Netherlands and she lost her job because of it, My lovely wife, Dear Farveh, without your supports and encouragements, I could not have finished this work, it was you who kept the fundamental of our family, and I understand it was difficult for you, therefore, I can just say thanks for everything and may Allah give you all the best in return. Hossein Moradi September 2009, Groningen, the Nederlands 115 اﺳﺎﺗﻴﺪ راهﻨﻤﺎ : ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ﺗﺌﻮ اﻟﺰﻧﮕﺎ دﮐﺘﺮ ﻓﺮاﻧﮏ ﻻﻧﻔﺮﻣﺎﻳﺮ ﮐﻤﻴﺘﻪ داوران: ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ژاﮐﻮس هﻴﻠﻪ ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ﺳﺮﺟﯽ ﺷﺎﺑﺎﻻ ﭘﺮوﻓﺴﻮر دﮐﺘﺮ ﺑﺮت وان دوﺋﻦ ﭘﮋوهﺸﻬﺎﯼ ﻣﻨﺪرج در اﻳﻦ رﺳﺎﻟﻪ ﺑﺎ ﺣﻤﺎﻳﺖ ﻣﺎﻟﯽ وزارت ﻋﻠﻮم،ﺗﺤﻘﻴﻘﺎت و ﻓﻨﺎورﯼ ﺟﻤﻬﻮرﯼ اﺳﻼﻣﯽ اﻳﺮان در دﭘﺎرﺗﻤﺎن ﻓﻴﺰﻳﻮﻟﻮژﯼ ﮔﻴﺎهﯽ ودﭘﺎرﺗﻤﺎن زﻳﺴﺖ ﻣﻮﻟﮑﻮﻟﯽ ﮔﻴﺎهﯽ داﻧﺸﮕﺎﻩ ﮔﺮوﻧﻴﻨﮕﻦ هﻠﻨﺪ،اﻧﺠﺎم ﺷﺪﻩ اﺳﺖ. 117 داﻧﺸﮕﺎﻩ ﮔﺮوﻧﻴﻨﮕﻦ هﻠﻨﺪ داﻧﺸﮑﺪﻩ رﻳﺎﺿﻴﺎت وﻋﻠﻮم زﻳﺴﺘﯽ رﺳﺎﻟﻪ دﮐﺘﺮﯼ در ﻋﻠﻮم زﻳﺴﺘﯽ ﺗﺤﺖ ﻋﻨﻮان ﻣﻄﺎﻟﻌﻪ ﭘﺮوﺗﺌﻴﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮ ﺑﺮرﺳﯽ ﮐﺎرﮐﺮدهﺎﯼ ﻣﻴﻮﺗﻨﻬﺎﯼ ﺁﻧﻴﻮن ﺗﺮاﻧﺴﭙﻮرﺗﺮﯼ در ﺁراﺑﻴﺪﺑﺴﻴﺲ در ﺟﻠﺴﻪ دﻓﺎﻋﻴﻪ ﻣﻮرخ دوﺷﻨﺒﻪ 30ﺷﻬﺮﻳﻮر 1388 ﺳﺎﻋﺖ 11 ﺣﺴﻴﻦ ﻣﺮادﯼ 119