Download Estrogen receptor β gene polymorphisms and susceptibility to

Gynecological Endocrinology, January 2010; 26(1): 4–9
ESTROGEN
Estrogen receptor b gene polymorphisms and susceptibility to uterine
fibroids
CLAUDIA FISCHER, INGOLF JUHASZ-BOESS, CLAUS LATTRICH,
OLAF ORTMANN, & OLIVER TREECK
Department of Obstetrics and Gynecology, University of Regensburg, 93053 Regensburg, Germany
Gynecol Endocrinol Downloaded from informahealthcare.com by HINARI
For personal use only.
(Received 6 April 2009; accepted 22 June 2009)
Abstract
Uterine fibroids are the most common benign tumors of the female genital tract. Steroid hormones, especially estradiol and
progesterone, play an important role in the pathobiology of this frequent disease. Recent studies suggested that both
expression levels and polymorphisms of estrogen receptor (ER) a and b might affect development of uterine fibroids. In this
study, we tested whether single nucleotide polymorphisms (SNPs) in the promoter of estrogen receptor b gene (ESR2) are
associated with susceptibility to uterine fibroids. For this purpose, we compared the frequency of three SNPs in the promoter
region of ESR2 gene (rs2987983, rs3020450 and rs3020449) in 101 women with uterine fibroids and 102 healthy women
serving as controls by means of allele-specific tetra-primer polymerase chain reaction (PCR). Regarding allele frequency,
allele positivity, genotype and haplotype frequencies of these SNPs we did not observe any significant difference between
healthy women and women with uterine fibroids. In conclusion, our data clearly suggest that the tested SNPs in the promotor
region of human ESR2 gene are not associated with the development of uterine fibroids.
Keywords: Single nucleotide polymorphisms, estrogen receptor b, uterine fibroids
Introduction
Uterine fibroids, also known as uterine leiomyomas,
are among the most frequently diagnosed benign
diseases of the uterus. With an incidence of at least
20–25% of women during reproductive period,
uterine fibroids are the primary indication for
hysterectomy [1–4]. Thus, uterine fibroids are a
very common gynecological disease and also a great
socio-economic burden [5].
Ovarian steroids, specifically estradiol and progesterone, have been reported to play a role both in the
development and growth of the uterine fibroids. They
are rare during the pre-pubertal years and generally
regress after menopause or after ovariectomy. Gonadotropin-releasing hormone agonist therapy can also
induce regression of uterine fibroids [4–6].
The effects of estradiol and other estrogens are
mostly mediated via ligand-dependent transcription
factors, the estrogen receptors (ERs). After
the discovery of ERa in 1986, which is coded by
ESR1 gene, many studies were conducted on the
significance of ERa-mediated estrogen effects on
uterine leiomyomas. There are many reports indicating a significantly higher concentration of ERa in
leiomyomas when compared with autologous myometrial tissue [7–11]. In 1996, the second estrogen
receptor, ERb, was identified which is coded by the
ESR2 gene. Like ERa, ERb also was reported to be
expressed at higher levels in leiomyomas when
compared with matched myometrium [12]. There
are studies suggesting that ERa is the dominant
estrogen receptor in leiomyomas of premenopausal
women, whereas in fibroids of postmenopausal
women the ERb/ERa ratio is significantly increased
[10,13]. Given that ERb is known to exert antiproliferative and apoptotic effects in different tissues
[14,15] and leiomyomas markedly regress in the
postmenopause, it is tempting to speculate that ERb
might play an important role in the pathobiology of
uterine leiomyomas.
Single nucleotide polymorphisms (SNPs) are the
most frequent sequence variations in the human
genome. Polymorphisms located in exon regions may
Correspondence: Oliver Treeck, PhD, Klinik für Frauenheilkunde und Geburtshilfe, Universität Regensburg, Landshuter Str. 65, 93053 Regensburg,
Germany. Tel: 0049-941-7827520. Fax: 0049-941-7827515. E-mail: [email protected]
ISSN 0951-3590 print/ISSN 1473-0766 online ª 2010 Informa UK Ltd.
DOI: 10.3109/09513590903159573
Gynecol Endocrinol Downloaded from informahealthcare.com by HINARI
For personal use only.
ESR2 SNPs and uterine fibroids
5
alter protein function, whereas SNPs in the gene
promoter can modify gene expression levels [16–22].
Thus, SNPs may lead to altered expression of growth
controlling genes, thereby promoting tumor initiation
and proliferation [17,21]. Polymorphisms in genes
involved in estrogen biosynthesis, metabolism and
signal transduction have been suggested to play a role
in the pathogenesis of uterine fibroids [23–27]. In the
last years, a multitude of SNPs both in ESR1 and
ESR2 gene have been identified and different
genotype–phenotype association studies have been
published examining the significance of randomly
chosen SNPs for steroid hormone metabolism and in
different hormone-dependent diseases [21,28–32].
Polymorphisms in ESR1 gene were reported to
influence the susceptibility to uterine fibroids. In a
study on an Asian population, a significant association
between ESR1-dinucleotide repeats with increased
risk of uterine fibroids was revealed [33]. Furthermore, Hsieh et al. described a significant correlation
between two SNPs in ESR1 (rs9340799 and
rs2234693) and the risk of developing uterine fibroids
in Taiwanese women [26]. However, the same
polymorphisms were not correlated to a higher risk
of developing uterine fibroids in Italian Caucasian
women [27].
Given that ERb seems to play a role in development
of uterine leiomyomas, we performed a phenotype–
genotype association study on three ESR2 SNPs.
There are no non-synonymous SNPs in the coding
region of ESR2 gene, thus we decided to choose three
SNPs in the regulatory 50 -region of this gene, which
could be able to affect the expression level of ERb
(Figure 1). In this study, we analyzed allele and
haplotype frequencies of these SNPs in 102 healthy
women and 101 women with uterine fibroids by
means of allele-specific tetra-primer PCR.
Methods
Patients
Blood samples from 101 Caucasian women with
uterine fibroids and 102 Caucasian women serving as
controls were collected. The average age of women
with uterine fibroids was 50.0 + 10.2 years at the
time of blood withdrawal. For healthy women, the
available data revealed an average age of 53.1 + 13.0
years at the time of blood withdrawal. Uterine fibroid
case participants were recruited in the Department of
Obstetrics and Gynecology, University of Regensburg, Caritas Hospital St. Josef, Regensburg,
Germany. Control subjects were randomly selected
from the same geographic origin as the cases, the
Oberpfalz area of Regensburg, Bavaria, Germany.
The study was approved by the Ethical Committee of
the University of Regensburg and informed consent
was obtained from the patients.
Figure 1. The SNPs analyzed in this study (SNP rs3020449, SNP
rs3020450 and SNP rs2987983) are located in the 50 -region of
estrogen receptor b gene (ESR2), namely in the promoter region of
untranslated (utr) exon 0N.
6
C. Fischer et al.
Gynecol Endocrinol Downloaded from informahealthcare.com by HINARI
For personal use only.
SNP analysis
Three SNPs in the 0N promoter region of ESR2
gene were selected using the internet sites www.
genecards.org and www.ncbi.nlm.nih.gov/SNP. SNP
rs2987983 (C/T) is located at position 63833406 of
chromosome 14, rs3020450 (A/G) is located at
position 63838055 of chromosome 14 and SNP
rs3020449 (A/G) (formerly rs8004842) is located at
position 63843145 of chromosome 14 (Figure 1).
Genomic DNA was isolated from 100 ml EDTAblood after addition of 300 ml lysis buffer (1% v/v
TritonX, 0.32 M sucrose, 0.01 M Tris (pH 7.5) and
5 mM MgCl2) and twofold centrifugation (13,000g)
for 30 s. Pellet was resuspended in 50 ml PCR buffer
(GoTaq buffer, Promega, Madison, USA) containing 0.5% Tween 20 and 10 mAnson units proteinase
K (Merck, Darmstadt, Germany) followed by incubation at 508C overnight and finally heat inactivation of the enzyme for 10 min at 958C. The genomic
DNA-containing lysate was subjected to a tetraprimer ARMS PCR approach [34] allowing allelespecific amplification using the PCR primers listed in
Table I (synthesized at Metabion, Martinsried,
Germany). For this purpose, to 100 ng of genomic
DNA, 2 ml of 56 GoTaq buffer, 0.2 ml of dNTP Mix
(10 mM) (Fermentas, St. Leon-Rot, Germany),
0.2 ml of each PCR primer (10 mM) and 0.5 units
GoTaq polymerase (Promega, Madison, USA) was
added and PCR reaction was carried out using a T1
thermocycler (Biometra, Germany). PCR program
was 10 min 948C followed by 38 PCR cycles of 948C
(30 s), 568C (30 s) and 728C (60 s), followed by a
final extension for 5 min step at 728C. PCR products
were analyzed by 1.5% agarose gelelectrophoresis.
Statistical analysis
Deviation from the Hardy–Weinberg equilibrium
was estimated by the Fisher’s exact test and the w2
test and all values were subjected to one-way
ANOVA to achieve homogeneity of variance. Statistical tests for association (C.I.: 95% confidence
interval) and for significance were carried out using
SPSS for Windows 8.0 (SPSS, Chicago, IL).
p 5 0.01 was considered statistically significant.
Results
Allele frequency
First, we studied the allele frequency of the three
ESR2 polymorphisms in 101 women with uterine
fibroids and 102 healthy controls (Table II). Regarding SNP rs2987983, there was no significant
difference in the frequencies of the C- and T-allele
between both groups (p ¼ 0.439). This was also true
for SNP rs3020450, no significant difference of the
G- and A-allele frequencies between women with
uterine fibroids and healthy women was observed
(p ¼ 0.974). No significant difference in the frequency of the A- and G-allele of SNP rs3020449
between both groups was found either (p ¼ 0.830).
Genotype frequency
Next, we compared the genotype frequencies of
women with uterine fibroids and healthy controls
(Table II). With regard to SNP rs2987983, we found
no significant difference between women with uterine
fibroids and healthy controls after comparison of
genotype frequencies (TT versus TC: p ¼ 0.408, CC
versus TC: p ¼ 0.983 and CC versus TT: p ¼ 0.598).
Genotype frequencies of SNP rs3020450 also did not
differ between both groups (GG versus GA: p ¼ 0.939,
AA versus GA: p ¼ 0.959 and GG versus AA:
p ¼ 1.000). Regarding SNP rs3020449, the small
differences in the genotype frequencies of patients
with leiomyoma and healthy controls were not
significant either (AA versus GA: p ¼ 0.599, GG versus
GA: p ¼ 0.421 and AA versus GG: p ¼ 0.732).
Allele positivity
Next, we performed a phenotype–genotype association study comparing the allele positivity of three
Table I. PCR primers used for genotype analysis of ESR2 gene.
Polymorphism
rs2987983
rs3020449
rs3020450
Primer
IP1
IP2
OP1
OP2
IP1
IP2
OP1
OP2
IP1
IP2
OP1
OP2
Sequence
TCACAATTCAGGTAGAATTGGAATAATAAC
CCTGGTTTAATGCAGAGTGGAGATGA
ATTGTAGGATATTTTGGAGACAGGCAG
TTATTATACAAGGAAACCTCACTGCAGG
GCATTGTCCTTTTTACATATTGTTAGGGTA
AATTCTCAAGGAAATTTTAGCAAAGCC
TAGATTTTGTCAAACACTTTTGGTGGAT
CCAAATGATTAAGGAGAAATAACAGCAG
TAGTTTCCTTGTGTTCTCTGTTCTCTACG
GGGAGAAGAGAGCCCAGGATTTCGAT
CAACTAGGAAGTGTTTGTGCTGAAAACC
GTCTCTTCTGAATTACACAGGTGCATGG
ESR2 SNPs and uterine fibroids
Table II. Tests for phenotype–genotype association*,{.
SNP
Allele
frequency
Allele
positivity
0.850 1.177 0.879 1.282 0.774 1.292 1.217
rs3020449
A
G
A
G
AA
GG
AG
Controls 0.564 0.436 0.775 0.647 0.353 0.225 0.422
Cases
0.574 0.426 0.812 0.663 0.337 0.188 0.475
P
0.830 0.830 0.511 0.807 0.732 0.732 0.442
OR
1.044 0.958 1.256 1.075 1.143 0.875 1.243
rs3020450
A
G
A
G
AA
GG
AG
Controls 0.343 0.657 0.559 0.873 0.127 0.441 0.431
Cases
0.342 0.658 0.554 0.871 0.129 0.446 0.426
p
0.974 0.974 0.950 0.979 1.000 1.000 0.935
Gynecol Endocrinol Downloaded from informahealthcare.com by HINARI
For personal use only.
OR
haplotypes did not exhibit significant differences
between the case and the control group either.
Genotype frequency
rs2987983
T
C
T
C
TT
CC
CT
Controls 0.681 0.319 0.902 0.539 0.460 0.098 0.441
Cases
0.645 0.355 0.890 0.600 0.400 0.110 0.490
P
0.439 0.439 0.781 0.383 0.598 0.598 0.487
OR
7
0.993 1.007 0.982 0.989 1.000 1.000 0.977
*After tests for deviation from Hardy–Weinberg equilibrium were
conducted, allele frequencies were determined for calculation of
specific odds rations (OR). OR of heterozygous genotype (CT for
SNP rs2987983 and AG for SNPs rs3020449 and rs3020450) was
calculated vs. homozygous genotypes (CC þ TT for SNP
rs2987983 and AA þ GG for SNPs rs3020449 and rs3020450).
{
Controls: n ¼ 102; Cases: n ¼ 100 for SNP rs2987983 and n ¼ 101
for SNPs rs3020449 and rs3020450.
ESR2 promoter SNPs between 101 women with
uterine fibroids and our control group of 102 healthy
women (Table II). Neither C-allele nor T-allele
positivity of SNP rs2987983 did differ significantly
between patients with uterine fibroids and healthy
women (C: p ¼ 0.383; T: p ¼ 0.781). This was also
true for the frequencies both of A-allele and G-allele
positivity of rs3020450 in healthy women compared
to women with uterine fibroids (A: p ¼ 0.950; G:
p ¼ 0.979). With regard to allele positivity of SNP
rs3020449, we did observe no significant difference
between both groups either (G: p ¼ 0.807; A:
p ¼ 0.511).
Haplotype analysis
Next, we conducted a haplotype-phenotype association study for the three ESR2 promoter SNPs. The
most frequently observed haplotype in 102 healthy
women and 100 women with uterine fibroids was the
heterozygous (HT) haplotype HT-HT-HT of SNPs
rs2987983, rs3020449 and rs3020450. This haplotype was carried by 36.0% of women with uterine
fibroids and by 30.4% of healthy women. Thus, we
could not observe any significant difference between
the frequencies of this haplotype in the two groups.
The ESR2 haplotype T-A-G of SNPs rs2987983,
rs3020449 and rs3020450 was observed in 32.0% of
women with uterine fibroids and in 28.4% of our
control group, a difference which also was not
significant. Analysis of the other observed infrequent
Discussion
Uterine fibroids are the most common benign
tumors of the female genital tract. Although the
significance of estrogens in pathobiology of uterine
fibroids is clear as they grow during the reproductive
years and regress after menopause, the specific role of
ERs in the etiology of this disease remains unclear.
In the last years, several polymorphisms have been
identified in the ESR1 gene [23,28,33,35–37], but
there are only conflicting reports regarding their
association to susceptibility to uterine fibroids.
Although Hsieh et al. observed an association between
two SNPs in ESR1 gene (rs9340799 and rs2234693)
and the risk of developing uterine fibroids in
Taiwanese women, Massart et al. could not confirm
these findings in Italian Caucasian women [26,27].
There was also no significant difference in the allele
frequencies of polymorphisms rs1784705 (ESR1 exon
1) and rs9322331 (ESR1 intron 1) in women with
uterine fibroids and healthy controls in ethnically
heterogeneous women in Brasilia [37].
There is, however, no study examining the
association of ESR2 gene polymorphisms with
susceptibility to uterine fibroids. Since discovery of
this gene and its product ERb in 1996 several groups
have characterized its unique expression profile and
recent studies of our group and others suggested that
this receptor can act as an antagonist of ERa, thereby
exerting antiproliferative and apoptotic effects in
different tissues [14,15]. In previous studies, randomly chosen ESR2 polymorphisms were demonstrated to be weakly associated with anorexia nervosa,
bulimia, ovulatory dysfunction and bone mineral
density [38–40].
Given that in ESR2 gene no non-synonymous
exon SNP exists which would lead to an altered
amino acid sequence of ERb protein, in this study we
decided to specifically focus on the second type of
polymorphisms with potential functional significance, SNPs in the promoter of ESR2 gene. The
promoter region of ESR2 gene is only beginning to
be characterized, and thus it is possible that SNPs
localized in this region are able to affect binding of
enhancer or repressor proteins regulating ESR2 gene
transcription. Altered ERb protein levels could then
modulate estrogen effects on uterine fibroids development. SNPs in the promoter regions of various
genes previously have been associated to the risk for
several diseases [18,41,42]. In a recent study of our
group including 318 breast cancer patients and such
as many controls, we demonstrated that women with
breast cancer more frequently carried the CC
genotype of ESR2 promoter SNP rs2987983 (OR
1.826, p ¼ 0.013), suggesting that this genotype is a
Gynecol Endocrinol Downloaded from informahealthcare.com by HINARI
For personal use only.
8
C. Fischer et al.
weak risk factor for breast cancer development
(unpublished results). Further studies described the
same polymorphism as a risk factor for prostate
cancer development and hypospadias [43,44].
However, the data of this study clearly suggest that
neither single nucleotide polymorphism rs2987983
nor the other ESR2 SNPs tested are risk factors for
development of uterine leiomyomas. However, as we
do not know whether the polymorphisms analyzed in
this study really affect transcription level of ESR2
gene, our data do not support, but also does not rule
out the possibility that ERb is an important factor in
etiology of uterine leiomyomas.
This is the first study comparing the frequencies of
three SNPs located in the promoter region of ESR2
gene in healthy women and women with uterine
fibroids. Our data suggest that there is no association between the genotypes of SNPs rs2987983,
rs3020450 and rs3020449 and susceptibility to
uterine fibroids.
Acknowledgements
We thank Helena Houlihan, Angelika Vollmer and
Gerhard Piendl for excellent technical assistance.
References
1. Flake GP, Andersen J, Dixon D. Etiology and pathogenesis of
uterine leiomyomas: a review. Environ Health Perspect
2003;111:1037–1054.
2. Schwartz SM. Epidemiology of uterine leiomyomata. Clin
Obstet Gynecol 2001;44:316–326.
3. Stewart EA. Uterine fibroids. Lancet 2001;357:293–298.
4. Walker CL, Stewart EA. Uterine fibroids: the elephant in the
room. Science 2005;308:1589–1592.
5. Lethaby A, Vollenhoven B. Fibroids (uterine myomatosis,
leiomyomas). Clin Evid 2005:2264–2282.
6. Maruo T, Ohara N, Wang J, Matsuo H. Sex steroidal
regulation of uterine leiomyoma growth and apoptosis. Hum
Reprod Update 2004;10:207–220.
7. Bakas P, Liapis A, Vlahopoulos S, Giner M, Logotheti S,
Creatsas G, Meligova AK, Alexis MN, Zoumpourlis V.
Estrogen receptor a and b in uterine fibroids: a basis for altered
estrogen responsiveness. Fertil Steril 2008;90:1878–1885.
8. Benassayag C, Leroy MJ, Rigourd V, Robert B, Honore JC,
Mignot TM, Vacher-Lavenu MC, Chapron C, Ferre F.
Estrogen receptors (ERa/ERb) in normal and pathological
growth of the human myometrium: pregnancy and leiomyoma. Am J Physiol 1999;276:E1112–E1118.
9. Brandon DD, Erickson TE, Keenan EJ, Strawn EY, Novy MJ,
Burry KA, Warner C, Clinton GM. Estrogen receptor gene
expression in human uterine leiomyomata. J Clin Endocrinol
Metab 1995;80:1876–1881.
10. Kovacs KA, Oszter A, Gocze PM, Kornyei JL, Szabo I.
Comparative analysis of cyclin D1 and oestrogen receptor (a
and b) levels in human leiomyoma and adjacent myometrium.
Mol Hum Reprod 2001;7:1085–1091.
11. Wang H, Wu X, Englund K, Masironi B, Eriksson H, Sahlin
L. Different expression of estrogen receptors a and b in human
myometrium and leiomyoma during the proliferative phase of
the menstrual cycle and after GnRHa treatment. Gynecol
Endocrinol 2001;15:443–452.
12. Li S, McLachlan JA. Estrogen-associated genes in uterine
leiomyoma. Ann NY Acad Sci 2001;948:112–120.
13. Strissel PL, Swiatek J, Oppelt P, Renner SP, Beckmann MW,
Strick R. Transcriptional analysis of steroid hormone receptors in smooth muscle uterine leiomyoma tumors of postmenopausal patients. J Steroid Biochem Mol Biol 2007;
107:42–47.
14. Treeck O, Juhasz-Boess I, Lattrich C, Horn F, Goerse R,
Ortmann O. Effects of exon-deleted estrogen receptor b
transcript variants on growth, apoptosis and gene expression
of human breast cancer cell lines. Breast Cancer Res Treat
2008;110:507–520.
15. Treeck O, Pfeiler G, Mitter D, Lattrich C, Piendl G, Ortmann
O. Estrogen receptor {b}1 exerts antitumoral effects on
SK-OV-3 ovarian cancer cells. J Endocrinol 2007;193:421–433.
16. Alvarez-Millan JJ, Bocos C, Ferrin V, Lucas AR, Ruibal A,
Schneider J. PAI-1 promoter polymorphism modulates
uPA-PAI complex accumulation by breast cancer cells.
Oncology 2002;62:286–290.
17. Bergman-Jungestrom M, Gentile M, Lundin AC, Wingren S.
Association between CYP17 gene polymorphism and risk of
breast cancer in young women. Int J Cancer 1999;84:350–
353.
18. Erfani N, Razmkhah M, Talei AR, Pezeshki AM, Doroudchi
M, Monabati A, Ghaderi A. Cytotoxic T lymphocyte antigen4 promoter variants in breast cancer. Cancer Genet Cytogenet
2006;165:114–120.
19. Guillemette C, Millikan RC, Newman B, Housman DE.
Genetic polymorphisms in uridine diphospho-glucuronosyltransferase 1A1 and association with breast cancer among
African Americans. Cancer Res 2000;60:950–956.
20. Harendza S, Lovett DH, Panzer U, Lukacs Z, Kuhnl P, Stahl
RA. Linked common polymorphisms in the gelatinase a
promoter are associated with diminished transcriptional
response to estrogen and genetic fitness. J Biol Chem 2003;
278:20490–20499.
21. Stevens A, Soden J, Brenchley PE, Ralph S, Ray DW.
Haplotype analysis of the polymorphic human vascular
endothelial growth factor gene promoter. Cancer Res 2003;
63:812–816.
22. Yang Q, Nakamura M, Nakamura Y, Yoshimura G, Suzuma
T, Umemura T, Tamaki T, Mori I, Sakurai T, Kakudo K.
Correlation of prostate-specific antigen promoter polymorphisms with clinicopathological characteristics in breast cancer.
Anticancer Res 2002;22:1825–1828.
23. Al-Hendy A, Salama SA. Ethnic distribution of estrogen
receptor-a polymorphism is associated with a higher prevalence of uterine leiomyomas in black Americans. Fertil Steril
2006;86:686–693.
24. Al-Hendy A, Salama SA. Catechol-O-methyltransferase polymorphism is associated with increased uterine leiomyoma risk
in different ethnic groups. J Soc Gynecol Investig 2006;13:
136–144.
25. Gooden KM, Schroeder JC, North KE, Gammon MD,
Hartmann KE, Taylor J, Baird DD. Val153Met polymorphism of catechol-O-methyltransferase and prevalence of uterine
leiomyomata. Reprod Sci 2007;14:117–120.
26. Hsieh YY, Wang YK, Chang CC, Lin CS. Estrogen receptor
a-351 XbaI*G and -397 PvuII*C-related genotypes and alleles
are associated with higher susceptibilities of endometriosis and
leiomyoma. Mol Human Reprod 2007;13:117–122.
27. Massart F, Becherini L, Gennari L, Facchini V, Genazzani
AR, Brandi ML. Genotype distribution of estrogen receptor-a
gene polymorphisms in Italian women with surgical uterine
leiomyomas. Fertil Steril 2001;75:567–570.
28. Gold B, Kalush F, Bergeron J, Scott K, Mitra N, Wilson K,
Ellis N, Huang H, Chen M, Lippert R, et al. Estrogen receptor
genotypes and haplotypes associated with breast cancer risk.
Cancer Res 2004;64:8891–8900.
Gynecol Endocrinol Downloaded from informahealthcare.com by HINARI
For personal use only.
ESR2 SNPs and uterine fibroids
29. Kitawaki J, Kado N, Ishihara H, Koshiba H, Kitaoka Y,
Honjo H. Endometriosis: the pathophysiology as an
estrogen-dependent disease. J Steroid Biochem Mol Biol
2002;83:149–155.
30. Schuit SC, de Jong FH, Stolk L, Koek WN, van Meurs JB,
Schoofs MW, Zillikens MC, Hofman A, van Leeuwen JP,
Pols HA, et al. Estrogen receptor a gene polymorphisms are
associated with estradiol levels in postmenopausal women.
Eur J Endocrinol 2005;153:327–334.
31. Tempfer CB, Schneeberger C, Huber JC. Applications of
polymorphisms and pharmacogenomics in obstetrics and
gynecology. Pharmacogenomics 2004;5:57–65.
32. Zofkova I, Zajickova K, Hill M. The estrogen receptor a gene
determines serum androstenedione levels in postmenopausal
women. Steroids 2002;67:815–819.
33. Hsieh YY, Chang CC, Tsai FJ, Tsai HD, Yeh LS, Lin CC,
Tsai CH. Estrogen receptor thymine-adenine dinucleotide
repeat polymorphism is associated with susceptibility to
leiomyoma. Fertil Steril 2003;79:96–99.
34. Ye S, Dhillon S, Ke X, Collins AR, Day IN. An efficient
procedure for genotyping single nucleotide polymorphisms.
Nucleic Acids Res 2001;29:E88.
35. Iwamoto I, Fujino T, Douchi T, Nagata Y. Association of
estrogen receptor a and b3-adrenergic receptor polymorphisms
with endometrial cancer. Obstet Gynecol 2003;102:506–511.
36. Malamitsi-Puchner A, Tziotis J, Evangelopoulos D, Fountas
L, Vlachos G, Creatsas G, Sekeris CE, Moutsatsou P. Gene
analysis of the N-terminal region of the estrogen receptor a in
preeclampsia. Steroids 2001;66:695–700.
37. Villanova FE, Andrade PM, Otsuka AY, Gomes MT, Leal ES,
Castro RA, Girao MJ, Nishimura E, Baracat EC, Silva ID.
38.
39.
40.
41.
42.
43.
44.
9
Estrogen receptor a polymorphism and susceptibility to uterine
leiomyoma. Steroids 2006;71:960–965.
Ogawa S, Hosoi T, Shiraki M, Orimo H, Emi M, Muramatsu
M, Ouchi Y, Inoue S. Association of estrogen receptor b gene
polymorphism with bone mineral density. Biochem Biophys
Res Commun 2000;269:537–541.
Rosenkranz K, Hinney A, Ziegler A, Hermann H, Fichter M,
Mayer H, Siegfried W, Young JK, Remschmidt H, Hebebrand
J. Systematic mutation screening of the estrogen receptor b
gene in probands of different weight extremes: identification of
several genetic variants. J Clin Endocrinol Metab 1998;83:
4524–4527.
Sundarrajan C, Liao WX, Roy AC, Ng SC. Association
between estrogen receptor-b gene polymorphisms and ovulatory dysfunctions in patients with menstrual disorders. J Clin
Endocrinol Metab 2001;86:135–139.
Gao J, Shan G, Sun B, Thompson PJ, Gao X. Association
between polymorphism of tumour necrosis factor a- 308 gene
promoter and asthma: a meta-analysis. Thorax 2006;61:466–471.
Hirata H, Hinoda Y, Okayama N, Suehiro Y, Kawamoto K,
Kikuno N, Rabban JT, Chen LM, Dahiya R. CYP1A1,
SULT1A1, and SULT1E1 polymorphisms are risk factors for
endometrial cancer susceptibility. Cancer 2008;112:1964–1973.
Beleza-Meireles A, Kockum I, Lundberg F, Soderhall C,
Nordenskjold A. Risk factors for hypospadias in the estrogen
receptor 2 gene. J Clin Endocrinol Metab 2007;92:3712–3718.
Thellenberg-Karlsson C, Lindstrom S, Malmer B, Wiklund F,
Augustsson-Balter K, Adami HO, Stattin P, Nilsson M,
Dahlman-Wright K, Gustafsson JA, et al. Estrogen receptor b
polymorphism is associated with prostate cancer risk. Clin
Cancer Res 2006;12:1936–1941.