* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genetic Engineering
Promoter (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
DNA supercoil wikipedia , lookup
DNA vaccination wikipedia , lookup
Non-coding DNA wikipedia , lookup
List of types of proteins wikipedia , lookup
Point mutation wikipedia , lookup
Molecular evolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular cloning wikipedia , lookup
Community fingerprinting wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Genetic Engineering The principles of genetics are being used to change the world! Chapter 13 Honors Living Environment Mrs. Mascia How are these organisms different? Are they the same species? Who h is involved l d with h making these variations? • How are these apples different? • Are they the same species? • Who iis involved Wh i l d with i h making these variations? Selective Breeding • • Selective breeding, g or artificial selection, is when people take control and cross organisms with selected traits. Humans use selective breeding to pass desired traits on to the next generation of organisms. – For example, e ample domestic dogs are bred for desirable physical characteristics and health traits. – For example, example most crop plants are crossed for desirable tolerances to temperatures and diseases. Selective Breeding (cont (cont’d) d) American botanist Luther Burbank developed the disease-resistant Burbank p potato in the late 1800s – which aided in fighting the Irish potato blight. g To do this, he used Hybridization. y Hybridization Hybridization = the process of crossing dissimilar individuals to bring together the best of both organisms g Hybrids = make hardier individuals Inbreeding Inbreeding = the continued breeding of individuals with similar characteristics One major problem: Inbreeding is more likely to cross two recessive alleles producing genetic defects Concept Map Section 13 13-1 1 Selective Breeding consists of Inbreeding Hybridization which crosses which crosses Similar organisms Organism breed A Organism breed B Organism breed A which Retains desired characteristics Go to Section: for example for example Dissimilar organisms which Combines desired characteristics What about Variation? Some scientists try to preserve the diversity in our world Other scientists try to increase the diversity in our world = more variation! Breeders can increase the genetic variation in a population by inducing mutations, which are the ultimate source of genetic variability! Mutations Remember: Mutations are inheritable changes in DNA You can wait for mutations to occur spontaneously, or you can increase the rate of mutations by using radiation or chemicals Mutations can be harmful or desirable to an organism! Some Mutant Examples New Bacteria: Scientists have been able to develop hundreds of useful bacterial strains with mutations. y For F example, l bacteria b t i th thatt digests di t oilil and d cleans l water after oil spills New Plants: Scientists have been able to develop drugs that prevent chromosomal separation during meiosis in plants (polyploidy ) (polyploidy.) y For example, polyploid plants have many sets of g and hardier chromosomes and are often larger This is all Genetic Engineering! • Genetic engineering g g changes g the arrangement of DNA that makes up a gene. Genes can also be inserted into cells to change how the cell performs performs. • For example, large volumes of medicines, such as insulin, can be produced by bacteria given the insulin gene or plants resistant to certain diseases can be developed. • Biotechnology is a branch of science studying genetic engineering g g g and changing g g the way y we interact with the living world. Other Uses of Genetic Engineering • In the past, people bred for organisms with desired traits by selective breeding, but now people can insert genes (DNA) into cells to produce organisms with those same desired traits by genetic engineering (Cell Transformation) • • Gene therapy is a form of genetic engineering that inserts a normal allele into a virus that attacks a target cell and inserts the normal allele into the body cell. Cloning is the process of making a new identical copy of an organism from a single adult cell. Cloning can occur naturally as identical twins, or by genetically engineering plants and animals, endangered or extinct species, a deceased pet or stem cells. • Stem cells are the cells that all of your cells “stem” from. Stem cells can be used to determine the function of specific genes, manipulate genes, or make new cells or tissue to treat injuries or diseases. Let’ss Review Let Selective Breeding: y Hybridization = dissimilar individuals y Inbreeding = similar individuals Let’ss Review Let Increasing variation: y Mutations = alter/change DNA y Polyploidy = interfers with meiosis by not allowing chromosomes to separate. Let’ss Review Let Genetic Engineering: y Cell Transformation = insert foreign DNA into a cell y Cloning = use a single adult cell to produce a genetically identical duplicate individual What do you think are some of the pros and cons of genetic engineering? Pros and Cons of Genetic Engineering Pros Better Taste,, Nutrition and Growth Rate Crops like potato, tomato, soybean and rice are currently being genetically engineered to obtain new strains with better nutritional qualities and increased yield. The genetically engineered crops can be used to impart a better taste to food. Pest-resistant Crops and Longer Shelf life Engineered seeds are resistant to pests and can survive in relatively harsh climatic conditions. It can thus result in fruits and vegetables that have a greater shelf life. Genetic Modification to Produce New Foods Genetic engineering in food can be used to produce totally new substances such as proteins and other food nutrients. The genetic modification f off foods f can be used to increase their medicinal value, thus making homegrown edible vaccines available. Cons May y Hamper p Nutritional Value Genetic engineering in food involves the contamination of genes in crops. Genetically engineered crops may supersede natural weeds. They may prove to be harmful for natural plants plants. May Introduce Harmful Pathogens Horizontal gene transfer can give rise to new pathogens. While increasing the immunity to diseases in plants, the resistance genes may get transferred to the harmful pathogens. May Lead to Genetic Defects Gene therapy in human beings can have certain side effects. While treating one defect, the therapy may lead to another. Detrimental to Genetic G Diversity Genetic engineering can hamper the diversity in human beings. Cloning can be detrimental to individuality. In recent years, new varieties of farm plants and animals have been engineered by manipulating p g their g genetic instructions to produce new characteristics. In the past past, variation was limited to the variations already in nature or random d variations i ti th thatt resulted lt d from mutations. Now, scientists can change DNA and swap genes from one organism to another, designing new living things. things Molecular Biology Tools Remember: Genetic engineering is making changes to DNA The steps include: y DNA extraction (removal) y Cutting DNA y Separating DNA y Making copies of DNA DNA Extraction Using a simple chemical procedure, cells are opened and DNA is separated and removed from th other the th cellll parts. t Have you ever had to cut something very small at a precise spot? p How did yyou determine where and how to cut it? What did you end up with? 1. Look at the series off DNA nucleotides on your sheet off paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. Highlight the sequence every time you see itit. How many occurrences of the sequence GTTAAC can you find? 3. When you find it, divide the sequence with a mark of your pencil. You will divide it between the T and the A. This produces short s o t seg segments e ts o of DNA. How o many a y ttimes es would ou d you cut tthe e DNA? How many fragments have 6, 10, & 15 bases? Cuttingg DNA DNA is too large to be analyzed, so it is precisely i l cutt iinto t smaller ll fragments f t using restriction enzymes y Each E h restriction t i ti enzyme cuts t DNA att a specific sequence of nucleotides ○ EcoRI codes for CTTAAG and cuts at GAATTC between the G and the A ○ Bam I codes for CCTAGG and cuts at GGATCC between the Gs. ○ Hae III codes for CCGG and cuts at GGCC between the G and the C ○ Hind III codes for TTCGAA and cuts at AAGCTT between the As Restriction Enzymes Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA i t fragments. into f t Sticky end Restriction Enzymes Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end Separating DNA DNA fragments are separated and analyzed using gel electrophoresis. y DNA is placed at one end of a gel and an electric current pulls negatively charged DNA molecules toward the positive end of the gel g y Smaller DNA fragments move faster and farther across the gel y Gel G l electrophoresis l h i iis used d to compare DNA of different organisms or identifying one particular g p gene http://www.dnalc.org/ddnalc/resources/electrophoresis.html Gel Electrophoresis Power source DNA plus restriction enzyme Longer fragments Shorter fragments Mixture of DNA fragments Gel DNA Sequencing Now that the DNA is in manageable form, the DNA sequence can be read, studied or changed to study specific genes, compared to genes off different diff t organisms, i and d one can ttry to identify the function of the different genes. Reading the DNA sequence: Obtain a single g stranded p piece of an organism’s DNA. As it replicates with bases labeled with color coded fluorescent dyes dyes, the replication stops, forming a fragment. After all of the DNA has replicated, tiny l b l d ffragments labeled t are lleft. ft The fragments are separated by gel electrophoresis e ect op o es s a and d tthe e patte pattern o of tthe e co color o coded fragments is read, telling scientists the exact DNA sequence. DNA Sequencing Fluorescent dye Single strand off DNA Strand broken after A Power source Strand broken after C Strand broken after G Strand broken after T Gel Cutting and Pasting Now that the DNA sequence is known, it can be changed. S i ti t can ttake Scientists k a gene (piece of DNA) from one organism and attach it to the DNA off another th organism i = Recombinant DNA (combined (co b ed DNA) Making Copies Scientists need many copies of a gene to study it, so they use a polymerase chain reaction (PCR): ( ) y Scientists add primers (short complementary pieces of DNA) to both ends of the gene, the double stranded DNA is separated into single strands, then DNA polymerase makes copies of the DNA between the primers primers, and each copy serves as another template. PCR DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCR cycles 1 2 DNA copies 1 2 3 4 4 8 5 etc. 16 etc. During transformation, a cell takes in DNA from outside the cell, and the external DNA becomes a part of the cell cell’s s own DNA Plasmid Is a small circular DNA molecule found naturally in some bacteria. The plasmid has a genetic marker which is a gene that makes it possible to distinguish bacteria that carry the Plasmid (meaning the foreign DNA) from those that don’t. Bacterial DNA Recombinant DNA/plasmid Quick Review Different enzymes y can be used to cut, copy, py and move segments of DNA. Characteristics produced by the segments of DNA may be expressed when these segments are inserted into new organisms, such as bacteria. Inserting, deleting, or substituting DNA segments genes. ((mutations)) can alter g An altered gene may be passed on to every cell that develops from itit. Transforming Bacteria Bacteria can be transformed using recombinant DNA. Foreign g DNA jjoins to a small circular DNA called a plasmid, which are naturally found in some bacteria. y It serves as a bacterial origin of replication (it will be replicated if it gets inside the bacterial cell) y It has a genetic marker (a gene that is distinguishable between bacteria with/without the foreign DNA) http://www.dnai.org/text/mediashowcase/index2.html?id=549 Making Recombinant DNA Recombinant DNA Gene for human growth hormone Gene for human growth hormone Human Cell Bacterial Cell Bacterial chromosome Plasmid Sticky ends DNA recombinatio n DNA insertion Bacterial cell for containing gene for human growth hormone http://www.bioteach.ubc.ca/TeachingResources/Applications/ GMOpkgJKloseGLampard2.swf Transformingg Plant Cells In nature, there’s a bacteria that can insert a p plasmid into p plant cells,, producing tumors. Scientists use this same bacteria, but insert foreign DNA, producing d i a recombinant bi t plasmid l id th thatt can infect plants. OR, OR DNA can be injected into some cells. OR, OR scientists can remove the cell wall and allow plant cells to take up the DNA on their own http://www.bioteach.ubc.ca/TeachingResources/Applications/GMOpkgJKloseGLampard2 .swf Transforming Plant Cells Either way, y, if transformation is successful,, the recombinant DNA is integrated into one of the chromosomes of the cell, the cell can be cultured (to make more cells) to produce adult plants plants. Transforming Animal Cells DNA can be injected into egg cells and enzymes in the cell will insert the foreign DNA into the chromosomes of that cell. http://www.youtube.com/watch?feature=pla yer_embedded&v=YXPnQvcqHkg#! Are They “Designer” Scientists? Scientists can insert foreign DNA that will recombine with specific sequences in a host chromosome, “knocking out” or replacing the host gene with ith a new gene. y Used to study specific functions of genes, genes possibly treat disorders caused by single genes (gene therapy), or possibly ibl design d i b babies, bi etc… t Using your knowledge of genetic engineering, explain how the plant and dog glow. A genetically modified virus was used to inject the new genetic code directly into a stem cell nucleus. l Th t nucleus That l was th then inserted into a de-nucleated egg cell and placed in a surrogate mother. An eating, g, sleeping, p g, glowing (literally) puppy!!! A firefly’s gene (for the enzyme luciferase) was inserted into a tobacco plant cell, then that cell was cultured producing tobacco plants that glow!!! Transgenic What does the word transgenic mean? y Trans = across y genic = the genes Making organisms that contain genes from other organisms organisms. Genetic engineering has spurred the growth of a whole new branch of biology: biotechnology! Biotechnology Knowledge of genetics is making possible new fields of health care: y Finding genes which may have mutations that can cause disease will aid in the development of preventive measures to fight disease di y Substances, such as hormones and enzymes from genetically engineered enzymes, organisms may reduce the cost and side effects of replacing p g missing g body y chemicals. Transgenic Microorganisms Transgenic bacteria produce many important substances for health and industry, y, because theyy reproduce p quickly and are easy to grow: y Human forms of proteins, including insulin, growth hormone, and clotting factor are being produced. Future Transgenic Microorganisms In the future future, transgenic microorganisms may produce: y Substances to fight cancer y Raw materials for plastics or synthetic fibers Transgenic Plants Much of our food supply, especially beans and corn, is transgenic or genetically modified (GM). y Many crop-grown GM plants now contain genes that produce a natural insecticide or resistance to chemicals or diseases diseases. One of the greatest GM plants developed was a rice i plant l t th thatt adds dd vitamin it i A to t rice! i ! This was HUGE for nations with ith starving t i populations. l ti Future Transgenic plants In the future future, transgenic plants may produce: y Human antibodies that can fight diseases y Foods resistant to rot and spoilage Transgenic Animals Used to study genes and improve food supplies, for example: p y Mice with immune systems similar to humans are used to study how diseases may affect humans. y Livestock Li t k with ith extra t growth th hormone genes grow faster and a dp produce oduce leaner ea e meat eat Future Transgenic Animals In the future future, transgenic animals may produce/become: y Chickens resistant to bacterial infections that cause food poisoning y Human proteins: for example, sheep and pigs that produce human proteins in their milk. Stem Cells Stem cells are derived from human embryos before the cells differentiate. The embryonic stem cells can combine with nuclei of differentiated tissue needed. A new tissue can be cultured and used to “heal” heal a person by replacing damaged tissue. Future Stem Cells? Future stem cells could be used in treating: y Parkinson Parkinson’s s Disease y Alzheimer’s Disease y Diabetes y Spinal Cord injuries Cloning Clone = member of a population of genetically identical cells produced from a single g cell Cloning unicellular organisms is easy, but it took a long time for scientists to clone a multicellular organism. y Sheep, p, cows,, p pig, g, mice and other mammals have been cloned Cl i Cloning A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. egg The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal. Cloning of the First Mammal – Dolly!!! A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell Egg Cell The nucleus of the egg cell is removed. An egg cell is taken from an adult female sheep. Cloned Lamb The fused cell begins dividing normally. Embryo The embryo develops normally into a lamb—Dolly Foster Mother The embryo is placed in the uterus of a foster mother. Future Clones? C Clones are not necessarily y transgenic, g , but scientists hope to use cloning to make copies of transgenic animals that produce genetically engineered substances substances. In the future, cloning could possibly save endangered species. Or possibly humans??? Æ Ethical issues?!