Download Protein Synthesis Name “An English sentence building metaphor

Protein Synthesis
“An English sentence building metaphor”
Name
Date
Introduction
DNA is a code for each physical trait that makes up a living organism. The codes within an entire
DNA molecule for any living thing are its genome. An organism’s genome can be deciphered by examining
the long strands of nRNA molecules a cell uses to decipher the DNA sequence. Ribosomes read the
transcribed code and translate each set of three bases, or codons, into a chain of amino acids linked together
in a pattern following the order of codons in the mRNA molecule. In this activity you will decipher DNA
codes into sentences by using words to represent amino acids. Instead of building a protein you will build a
sentence and try to figure out the messages hidden within a DNA code.
Materials
• 20 DNA Template Cards: these will be kept on your desk at all times, DNA cannot leave the nucleus.
• 64 tRNA cards: These will be scattered around the classroom. (Like floating in the cytoplasm of a cell.)
• Paper: to transcribe (write down) the mRNA and the tRNA molecules then translate “protein” sentence.
Procedure
1. Work in teams of 2-3 people.
2. Each student needs a Protein Synthesis (sentence building) Data Sheet.
3. Each student will have a role in the process of protein synthesis:
•
•
•
•
Student 1: DNA transcriptase - Student transcribes DNA sequence into mRNA.
Student 2: Codon Identifier – Student identifies the correct three-base codes in mRNA by placing a
o vertical line between each codon in the mRNA molecule.
Student 3: tRNA – Student gathers anti-codon cards for protein (sentence building).
Team: Ribosomes – Students assemble the anti-codon cards into the correct protein (sentence).
4. When the mRNA has been translated from its code into a readable sentence each student must write
down the sentence on the appropriate line of his or her data table.
5. Before building another protein (sentence) one member of the team must bring the translated
sentence to the teacher and check for the correct translation of the code. Any mistakes are mutations
in the code and must be corrected before the protein (sentence) is considered “working”.
6. After your team has completed building a correct protein (sentence) continue building another protein
sentence until all twenty DNA cards have been transcribed and translated.
Protein Synthesis Sentence Building Data Table
1. mRNA
tRNA
Protein sentence
2. mRNA
tRNA
Protein sentence
3. mRNA
tRNA
Protein sentence
4. mRNA
tRNA
Protein sentence
5. mRNA
tRNA
Protein sentence
6. mRNA
tRNA
Protein sentence
7. mRNA
tRNA
Protein sentence
8. mRNA
tRNA
Protein sentence
9. mRNA
tRNA
Protein sentence
10. mRNA
tRNA
Protein sentence
11. mRNA
tRNA
Protein sentence
12. mRNA
tRNA
Protein sentence
13. mRNA
tRNA
Protein sentence
14. mRNA
tRNA
Protein sentence
15. mRNA
tRNA
Protein sentence
16. mRNA
tRNA
Protein sentence
17. mRNA
tRNA
Protein sentence
18. mRNA
tRNA
Protein sentence
19. mRNA
tRNA
Protein sentence
20. mRNA
tRNA
Protein sentence
Post Lab Discussion Questions
1. Mistakes are common in this lab. What was a common error that caused a mistake in creating your
team’s protein sentence? What did this do to the sentence your team tried to make?
2. If these were real proteins being made, what would have happened if these kinds of mistakes really
happened? What are these kinds of mistakes called?
3. Using the amino acid chart found in your textbook (p. 303), write down the order of the amino acids
that would create the protein chain from one of the sentences from above. Write the abbreviation of
the amino acids in their proper order, in the space below. (Also write down which number sentence.)
4. Here is a section of the gene for human insulin:
AATCTCCCATCAGACGTTTTTGCCCCGTAACAACTTGTTACAACA
mRNA
TGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACGTTAACT
mRNA
Write out the mRNA code for this section and then translate the code into codons by drawing vertical lines
between each three-base code in the mRNA molecule.
5. Translate the code from the above nRNA sequence for human insulin into the protein it is meant to
build by writing out the chain of amino acids using three letter abbreviations in the space below.
Example: Glycine = Gly, Alanine = Ala, Tryptophan = Try.
6. If there was a mutation in the above sequence what would happen to the protein chain that would
make insulin? What would be the disease and symptoms a person would have caused by nonworking insulin?
7. Sickle cell anemia is caused by a single mutation in the gene. This mutation substitutes valine
instead of glutamic acid in the sixth position of the beta subunit of the hemoglobin chain. Use your
book to identify the differences between the codons for glutamic acid and valine.
Glutamic acid codon
Valine codon
8. Describe the differences in the codons between these codons and also the differences you would
expect to see in the DNA sequence for this recessive gene.
9. In many cases a single difference in the sequence of DNA molecules would have no affect on the
physical traits of an organism. This ability to have a variety in DNA allows for variety in codon
sequence in mRNA. Use your textbook to identify what amino acids can be used from more than one
codon sequence.
10. Using the list of words from your protein sentences above, create your own sentence and work
backwards to find the DNA message that codes for your sentence.
Sentence
tRNA
mRNA
DNA