Download Station #1: Chemistry

Station #1: Chemistry
Answer as many as possible in 4 minutes
Sodium and chlorine will form an ionic bond because both are naturally unstable. Diagram the process below.
1. How many electrons does sodium have? _________
2. How many protons does sodium have? __________
3. How many neutrons does sodium have? ___________
4. How many electrons does chlorine have? ________
5. How many protons does chlorine have? _________
6. How many neutrons does chlorine have? __________
7. Draw the electrons of each atom below.
Na
Cl
#8
#9
#14
#15
#10
#11
#16
#17
#12
#13
#18
#19
Fill in the pH scale below.
Object A has a pH of 4.
Object B has a pH of 6.
Object C has a pH of 10.
Object D has a pH of 12.
23) Which object has the greatest
concentration of H+ ions?
Station #2: Cell Part Identification
Answer as many as possible in 4 minutes
Answer the following questions.
1. Name the organelle that transports ribosomes from one end of the cell to another. _______________________
2. Name the organelle that creates ribosomes. _______________________________
3. Name the organelle that packages and ships protein outside of a cell. __________________________________
4. Name the organelle that creates ATP energy. ______________________________
5. Name the two organelles (besides the nucleus) that contain their own DNA and were probably once free-living
organism. (A) ____________________________ (B) _______________________________
6. Name the organelle that creates lipids. ___________________________________
Label each part of the cell above. These are your choices:
Plasma membrane
Lysosome
Smooth ER
Golgi body
Vesicle
Nucleolus
Cytoplasm
Chloroplast
Mitochondria
Nucleus
Cilia
Cell wall
Rough ER
Flagella
Station #3: The Cell Cycle
1. Which picture is metaphase? _________
2. Which picture has the nucleus dissolving? _____
Answer as many as possible in 4 minutes
8. Cytokinesis takes place at the end of which
picture? _______
3. Which picture has the cell enlarging? ________
9. Which picture shows Anaphase? _______
4. Which picture has DNA being duplicated? _____
10. Which is the 3rd step in the cell cycle? ________
5. Which picture has the spindle fibers being
11. Which is the 3rd step in mitosis? _____________
created? ________
6. Which picture has spindle fibers dissolving? ___
12. In which picture is the cell performing its
normal operations? _________
7. Which picture has the chromatids being pulled
apart? _______
13. How many chromosomes are
found in gamete calls? _________
14. How many chromosomes are
found in diploid cells? _________
15. How many chromosomes are
found in muscle cells? _________
16. How many chromosomes are
found in sperm cells? __________
17. How many chromosomes are
found in brain cells? ___________
18. How many chromosomes are
found in the zygote? ___________
19. How many chromosomes are
found in the egg cells? _________
Station #4: Chemical Reactions, ATP, & Organic
Answer as many as possible in 4 minutes
Molecules
Match the following words with the proper definition:
1. Equilibrium _________
a. The amount of energy that is needed for a chemical reaction
to start.
b. When a reaction takes place at an equal rate in both
directions.
c. A chemical reaction the releases more energy than it
absorbs.
d. Proteins that lower the activation energy in a chemical
reaction.
e. A chemical reaction that absorbs more energy that it
releases.
2. Enzyme _________
3. Endothermic ________
4. Activation Energy ________
5. Exothermic ________
6-9: Label if a statement is true (T) or false (F) about enzymes.
6. Enzymes are made from amino acids._____
7. Enzymes are organic molecules. _____
8. Enzyme spelling ends with the suffix OSE. _____
9. A single enzyme often has many different purposes. ______
Use the four monomer choices to answer questions 10-20.
a. Monosaccharide
b. Fatty acid
10. Which forms the genetic code of a species? ______
11. Which bonds with a glycerol molecule to make a wax?
_______
12. Which is made from a sugar, phosphate, and nitrogen
base? _______
13. Which is a simple sugar? _______
14. Which will form the basis of an enzyme? _______
15. Which is a chain of C, H, and O atoms in a 1: 2: 1
ratio? _______
c. Nucleotide
d. Amino acid
16. Which will bond to make a polypeptide?
_________
17. Which is a monomer of carbohydrates?
__________
18. Which is the monomer of nucleic acids?
_________
19. Which is the monomer of lipids?
_______________
20. Which is the monomer of proteins?
_____________
Station #5: Genetics
Answer as many as possible in 4 minutes
Answer the following questions.
Autosomal Dominance Punnett Squares: Huntington’s disease (H) is a dominant disorder where the healthy allele (h) is
recessive. Rebecca is heterozygous with Huntington’s disease and Jarrod is homozygous recessive. They want to start a
family, but also want to know the risk of passing the disease on to their children.
1) What is Rebecca’s genotype?
a. HH
b. Hh
c. hh
2) What is the probability of each child being healthy?
a. 0%
b. 25%
c. 50%
d. Healthy
e. Huntington’s disease
d. 75%
e. 100%
3) What is the probability of having a homozygous dominant child?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
4) What is the probability of having four children, each with Huntington’s disease? ______________
Autosomal Recessive: Steve and Linda have a history of cystic fibrosis (CF) in their families. Steve is a carrier of CF and
Linda is heterozygous.
5) If they have a single child, what are the chances the child will be born healthy?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
6) If they decide to have 2 children, what are the chances that both would be born healthy? ______________
7) If they have a child, what are the chances the child has the same phenotype Linda?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
Sex-Linked Inheritance: The pedigree shows hemophilia in a small family.
Determine the genotypes of every involved. Use XH for healthy and Xh for
hemophilia.
8) What is the genotype of person C? ____________
9) What is the genotype of person E? ____________
10) If person E and F decide to have another child, what are the
chances the child is a hemophiliac?
a. 0%
b. 25%
c. 50%
d. 75%
e. 100%
Station #6: Transcription & Translation
Answer as many as possible
in 4 minutes
1. Write the amino acids created from the piece of DNA (gene) below.
TACTGATCAGAAAAAAGACCTATT
Fill in the table below using the rules of transcription and translation.
DNA
Codon
Anticodon
CGU
2.
5.
3.
CCT
8.
4.
GAU
6.
9.
Amino acid
7.
10.
Use the DNA letters below to answer the next questions:
TACtgATcAGAAAAAagAcCTATT
11. If the lowercase/underlined letters are introns, list the amino acids that will be delivered to the ribosome.
12. What would we call a mutation found on an intron? _____________________________