Download SPT4, a gene important for tr

Mol Gen Genet (1993) 237 :449~459
© Springer-Verlag 1993
Molecular and genetic characterization of SPT4,
a gene important for transcription initiation
in Saccharom yces cerevisiae
Elizabeth A. Malone*, Jan S. Fassler**, and Fred Winston*
Department of Genetics, Harvard Medical School, Boston, MA 02115, USA
Summary. Mutations in the SPT4 gene of Saccharomyces
cerevisiae were isolated as suppressors of g insertion
mutations that interfere with adjacent gene transcription.
Recent genetic evidence indicates that the SPT4 protein
functions with two other proteins, SPT5 and SPT6, in
some aspect of transcription initiation. In this work we
have characterized the SPT4 gene and we demonstrate
that spt4 mutations, like spt5 and spt6 mutations, cause
changes in transcription. Using the cloned SPT4 gene,
spt4 null mutations were constructed; in contrast to spt5
and spt6 null mutants, which are inviable, spt4 null mutants are viable and have an Spt- phenotype. The DNA
sequence of the SPT4 gene predicts a protein product of
102 amino acids that contains four cysteine residues
positioned similarly to those of zinc binding proteins.
Mutational analysis suggests that at least some of these
cysteines are essential for SPT4 function. Genetic mapping showed that SPT4 is a previously unidentified gene
that maps to chromosome VII, between ADE6 and
CL Y8.
Key words: Saccharomyces cerevisiae - Transcription spt mutants
Introduction
The process of mRNA transcription initiation in eukaryotes involves the interaction of a large number of general
and specific transcription factors with a chromatin template (for recent reviews see Sawadogo and Sentenac
1990; Grunstein 1990; Pugh and Tjian 1992). These
factors include RNA polymerase II, several general factors required for transcription in vitro, and activating
and repressing proteins involved in transcriptional regu* Present address: Department of Genetics, SK-50, University of
Washington, Seattle, WA 98195, USA
** Present address: Department of Biology, University of Iowa,
Iowa City, IA 52242, USA
Correspondence to: F. Winston
lation. Some proteins that are essential or important
for proper transcription initiation in Saccharomyces
cerevisiae have been identified by isolation of suppressors
of transposable element insertion mutations that disrupt
expression of adjacent genes (Winston et al. 1984a, 1987;
Fassler and Winston 1988; Natsoulis et al. 1991). Mutations in 17 S P T genes (SPT = suppressor of Ty) suppress
such insertion mutations and many of these spt mutations have additional effects on gene expression (for
examples see Neigeborn et al. 1987; Hirschhorn and
Winston 1988; Eisenmann et al. 1989; Fassler and Winston 1989; Rowley et al. 1991). Genetic analysis of one
insertion mutation, his4-9126, indicated that competition
exists between the tandemly arranged 6 TATA and HIS4
TATA sequences (Hirschman et al. 1988), suggesting
that one possible function of the S P T genes is to influence the strength of different TATA elements in vivo.
Two loci identified by selection for spt mutants encode
biochemically characterized proteins believed to affect
the transcription of a wide variety of genes: SPT15 encodes the TATA binding protein TFIID (Eisenmann et
al. 1989) and H T A l ( S P T l l ) - H T B l ( S P T 1 2 ) encodes
the historic proteins H2A and H2B (Clark-Adams et al.
1988). Many other spt mutants can be classified into two
groups on the basis of phenotypes they share with either
spt15 mutants or htal-htbl mutants, suggesting that
other SPT gene products may play important roles in
transcription, related to either TFIID or to chromatin
structure.
The SPT4 gene analyzed in this study falls into the
"histone group" of S P T genes. SPT4 was previously
identified by mutations that suppress the 8 insertion
mutations his4-9126 and lys2-1286 (Winston et al. 1984a;
Fassler and Winston 1988). More recent analysis has
revealed that spt4 mutations also suppress mutations in
the gene encoding the transcriptional activator SNF2 for
defects in transcription of both the SUC2 gene and Ty
elements (Happel et al. 1991; Swanson and Winston
1992). These phenotypes are shared by mutations in the
group of S P T genes that includes HTA1-HTB1, SPT5,
SPT6, and SPT16 (Clark-Adams and Winston 1987;
450
Neigeborn et al. 1987; Clark-Adams et al. 1988; Happel
etal. 1991 ; Swanson and Winston 1992; Hirschhorn etal.
1992). In addition, genetic evidence suggests that SPT4
interacts with the SPT5 and SPT6 gene products: recessive mutations in SPT4 do not complement recessive
mutations in SPT5 or SPT6 and combinations of mutations in any two of these three genes are lethal (Winston
et al. 1984a; Swanson and Winston 1992). These observations have led to the model that the SPT4, SPT5,
and SPT6 proteins form a complex that is required for
the normal transcription of a large number of loci in
Vivo.
To understand further the function of SPT4, we have
characterized some effects of spt4 mutations on transcription and we have analyzed the SPT4 gene and its
product. We have also used the cloned SPT4 gene to
construct an spt4 null mutation. Unlike SPT5 and SPT6,
SPT4 is not essential for growth. The spt4 null mutation
does cause suppression of 6 insertion mutations at the
transcriptional level, resulting in patterns of transcription similar to those described previously in spt5 and spt6
missense mutants, as well as in other spt mutants (ClarkAdams and Winston 1987; Clark-Adams et al. 1988;
Eisenmann et al. 1989; Malone et al. 1991; Swanson et
al. 1991). We genetically mapped the SPT4 gene to a new
locus, indicating it has not been previously characterized.
The sequence of the SPT4 gene predicts a 102 amino acid
protein with an arrangement of cysteine residues suggesting a zinc binding region. Alteration of some of the
cysteines indicates that they are required for SPT4 function.
Brackets indicate integrated plasmids. Strain DBY703
was from David Botstein. Strains K382-23A, K398-4D,
K399-7D, and K396-11A are described by Klapholz and
Esposito (1982). All other strains were constructed in this
laboratory. The his4-9126 mutation is an insertion of a
element at position - 97 relative to the HIS4 transcription initiation site (Chaleff and Fink 1980; Farabaugh
and Fink 1980; Roeder and Fink 1980). The lys2-128~
mutation is a fi insertion at + 153 relative to the LYS2
translation initiation site (Simchen et al. 1984; ClarkAdams and Winston 1987). Standard procedures for
yeast crosses, sporulation, and tetrad analysis were
followed (Rose et al. 1990). Yeast strains were transformed using the lithium acetate method (Ito et al. 1983).
A number ofEscherichia coli strains were used. Strain
HB101 (Boyer and Roulland-Dussoix 1969) was a host
for plasmids. Strain SY316 (F- (lac pro) AXIII ara
argE, mnalA rif R B1- recA srl: :TnlO cys: :Tn5; obtained
from M. Syvanen) was used for Tn5 mutagenesis of
SPT4. Strain JM101 (Messing 1979) was a host for M13
bacteriophage vectors. Strain CJ236 (dut-1, ung-1, thi-1,
reIA-1; pCJ105 Cm9 (Biorad, Richmond, Calif.) was
used to synthesize uracil-containing DNA for use in vitro
site-directed mutagenesis. These strains were transformed or transfectes as previously described (Maniatis et al.
1982).
Media. Yeast strains were grown using rich medium
(YPD), minimal medium (SD), SD with nutritional supplements, or synthetic complete media lacking single
nutrients (e.g. SC-ura lacks uracil) (Rose et al. 1990).
Presporulation and sporulation media have been
previously described (Rose et al. 1990).
Materials and methods
Strains and genetic methods. The Saccharomyces
eerevisiae strains used in this study are listed in Table 1.
DNA preparation. Plasmid DNA was prepared from
bacteria by the alkaline lysis method (Birnboim and Doly
1979). Plasmid and genomic DNA were prepared from
Table 1. Yeast strains
Strain
Genotype
FW221
JF2
JF125
M A T a his4-9126 spt4-3 ura3-52 ade2-1 lysl-1 can R
M A Ta his4-912~ spt4-3 ura3-52
M A T a / M A T~ his4-9218/his4-912 ~ or his4-917 5 lys2-128 8/lys2-128 6 SPT4/spt4-3
ura3-52/ura3-52 trp A1/trp A1
M A T a his4-9125 lys2-1286 ura3-52 leu2A1
M A T a his4-912 8 lys2-1286 spt4 A : : Tn5-156:: URA3 ura3-52 leu2 A1
M A T a his3 trpl ura3-52 cir °
M A Tct his3 trp l ura3-52 cir ° [SPT4-pJF27-SPT4]
M A T a s p o l l ura3 canl cyh2 ade2 his7 horn3
M A T a s p o l l ura3 ade6 ar94 aro7 asp5 m e t l 4 lys2 p e t l 7 trpl
M A T a s p o l l ura3 his2 leul lysl met4 pet8
M A T a s p o l l ura3 adel hisl leu2 lys7 met3 trp5
M A T a lys2-1285 ade6 ely8 leu2-3 ura3-52
M A TcL lys2-1288 spt4-3 his4-917 ura3-52
M A T a his4-9128 lys2-128 8 spt4 : : Tn5-156 ura3-52
M A T a his4-9125 lys2-128~ spt4-289 ura3-52 ade2-1
M A T a his4-9128 lys2-128 ~ spt4-3 ura3-52
M A Te~ lys2-128~ spt4-6 ura3-52
M A Ta his4-9128 lys2-128~ ura3-52
M A Ta leu2A1 ura3-52
M A Ta ura3-52 leu2A1 spt4A1 :: URA3
FY120
FY243
DBY703
JF103
K382-23A
K398-4D
K399-7D
K396-11A
JF135
JFll3
L793
L331
L351
L374
FW619
FY98
FY247
451
yeast as previously described (Hoffman and Winston
1987; Rose et al. 1990). Restriction enzymes were purchased from New England Biolabs (Beverly, MA) or
Boehringer Mannheim (Indianapolis, Ind.). Restriction
fragments were separated by electrophoresis and purified
by electroelution. Southern hybridization analysis was
performed as previously described (Southern 1975;
Roeder and Fink 1980). Plasmids used as probes were
labeled with [~_32p] dATP (Amersham, Arlington
Heights, Ill) by nick translation (Rigby et al. 1977) or
random priming (Feinberg and Vogelstein 1983) using
kits from Boehringer Mannheim. T4 DNA ligase and
DNA polymerase I large (Klenow) fragment were from
New England Biolabs and bacterial alkaline phosphatase
was from Boehringer Mannheim.
Plasmids. The plasmids pJF17, pJF42, and pBM25 contain subclones of the cloned SPT4 gene in the centromere-containing vector YCp50 (Johnston and Davis
1984) and were used to delimit the SPT4 gene (Fig. 1).
The HindIII fragment that contains SPT4 function was
cloned in the integrating vector YIp5 (Struhl et al. 1979),
creating pJF19. The effect of increased copy number of
the SPT4 gene was tested using pJF27, which was constructed by inserting the 8.0 kb BamHI-BglII SPT4 fragment in the 2 gm vector YEp24 (Botstein et al. 1979). The
3.1 kb EcoRI fragment containing the SPT4 gene was
cloned in pUC18 (Norrander et al. 1983), creating pJF64
for use as a hybridization probe. E. coli strains carrying
SPT4 on plasmids that are maintained in high copy
numbers in E. coli, such as pUC18, grew poorly.
Plasmids used as probes were: for HIS4, pFW45
(Winston et al. 1984b); for LYS2, pFW47 (a BglII-XhoI
restriction fragment internal to L YS2 cloned in pBR322;
Clark-Adams and Winston 1987) and pFW112 (an Eco
RI-Bg/II restriction fragment from the 5' region of L YS2
cloned in pBR322; Clark-Adams and Winston 1987); for
TUB2, pYST 138 (Sore et al. 1988); and for SPT4, pJF64,
which recognizes two transcripts in addition to the SPT4
mRNA.
Construction of spt4Al: :URA3. spt4 null mutants were
constructed in several steps. First, Tn5 transposon mutagenesis was used to disrupt the SPT4 gene. Bacterial
strain SY316 was transformed with pJF42. Ampicillinresistant transformants were purified on LB plates containing 50 gg/ml kanamycin, and single colonies were
then streaked on LB plates containing 1 mg/ml neomycin, to select for increased expression of the kan gene
in Tn5. Increased expression is expected to result from
transposition of Tn5 into the plasmid and subsequent
amplification (Van Dyk et al. 1986). Plasmid DNA was
prepared from independent Neo r colonies and screened
by restriction digestion with HindIII to identify plasmids
carrying Tn5 insertions. Of approximately 50 Neo r candidates screened, about 50% of the plasmids contained
a Tn5 element. Of these, about one-third were in the
SPT4 insert. These plasmids were used to transform
strain JF2 to Ura +, and screened for their ability to
complement spt4-3. One plasmid (pJF72, containing
spt4: : Tn5-156) did not complement. Further restriction
mapping with PvuII confirmed that the site of insertion
is approximately 1.8 kb to the left of the HindIII site,
within the SPT4 open reading frame (Fig. 1). The twostep gene replacement method (Scherer and Davis 1979)
was used, beginning with strain JF125, to construct a
diploid strain containing spt4::Tn5-156. Following
sporulation and tetrad dissection, we determined that
haploid strains that contain spt4." .'Tn5-156 are viable
and Spt-.
Next, a deletion derivative of spt4. :Tn5-156 was
created, pJF72 was digested with PvuII, which cuts in the
Tn5 element and in the adjacent SPT4 gene. Self-ligation
of the fragment containing YCp50, SPT4, and some Tn5
sequences resulted in pJF91, which contains a deletion of
a part of the SPT4 gene, spt4A1. The EcoRI fragment
containing spt4A1 was subcloned into the integrating
vector pRG331 (generously provided by Richard
Gaber), yielding pJF101. The URA3 gene was inserted at
the unique XhoI site in the remaining portion of the Tn5,
resulting in pJF104. The EcoRI fragment containing
spt4A 1 : : URA3 was purified and used to transform strain
FY120 to Ura + (Rothstein 1983), creating strain FY243.
Southern hybridization analysis (Southern 1975) confirmed that the wild-type SPT4 allele had been replaced
by spt4A 1 . : URA3.
RNA preparation and analysis. Cells used for preparation
of RNA were grown at 25°C in SD medium supplemented with the necessary requirements to a density of
1-2 x 107 cells per ml. RNA was prepared (Carlson and
Botstein 1982), fractionated on formaldehyde agarose
gels, and blotted to GeneScreen (New England Nuclear,
Boston, Mass) as previously described (Swanson et al.
1991). Probes were hybridized by the dextran sulfate
method as described in the GeneScreen manual. Prior to
hybridization of additional probes, membranes were
stripped of old probes by incubation at 80° C in 0.15 M
NaC1, 0.015 M sodium citrate, 50% formamide. The
amounts of RNA in each lane were standardized based
on hybridization to TUB2 DNA.
Genetic mappin9 of the SPT4 9ene. The SPT4 gene was
first localized to chromosome VII using the 2 ~tm mapping method (Falco and Botstein 1983). The 2 gm plasmid pJF27, which contains SPT4, was integrated into the
genome following transformation of the cir° strain
DBY703. Strain JF103 resulted from this transformation, and Southern hybridization analysis showed that
integration occurred at SPT4. The integration of a part
of the 2 gm circle has been shown to cause instability of
the chromosome in which integration occurred (Falco et
al. 1982). Strain JF103 was crossed to strains K382-23A,
K398-4D, K399-7D, and K396-11A, and diploids were
selected on SD + trp and purified on YPD. The diploids
were then plated for single colonies on YPD and replica
plated to SC-ura and S D + u r a + t r p . Colonies that did
not grow on either plate had lost the URA3 gene integrated at SPT4 and had gained another auxotrophy. Of
the Ura- colonies from the cross with K398-4D, 85%
were also Ade-, indicating that SPT4 is on the same
chromosome as ADE6 (chromosome VII). Genetic link-
452
age of SPT4 to ADE6 and CLY8 was determined by
tetrad analysis of the cross of strains JF135 and JF113.
spt4-3 was scored by suppression of lys2-128fi and cly8
was scored by temperature sensitive lethality.
DNA sequence analysis. DNA fragments were cloned in
the vectors M13mpl8 and M13mpl9 (Norrander et al.
1983) and sequenced by the dideoxy chain-termination
method (Sanger et al. 1977) using [a35S] dATP (New
England Nuclear, Boston, Mass) and Sequenase (US
Biochemical, Cleveland, Ohio). All sequences were determined on both strands. The primers used in sequencing
and in oligo-directed mutagenesis were synthesized by
Lise Riviere and Mark Fleming, Biopolymers Laboratory, Department of Genetics, Harvard Medical School.
Verification of the SPT4 open readin9 frame. To confirm
the location of the SPT4 gene within the cloned DNA,
we constructed a frameshift mutation in the SPT4 open
reading frame. The 2.4 kb EcoRI-HindIII SPT4 fragment was cloned in pUC19. The resulting plasmid,
pBM27 was digested with AccI. The 5' overhanging ends
were made flush with DNA polymerase I large (Klenow)
fragment and ligated to create pBM28, containing a + 2
frameshift. The EcoRI-HindIII fragment of pBM28 was
cloned into YCp50, and the resulting plasmid (pBM30)
was transformed into strain L793 to test for complementation of spt4 : :Tn5-156.
To determine the DNA sequence of three spontaneous spt4 mutations, the mutations were first cloned
by the method of gap repair (Oft-Weaver et al. 1983).
pJF42 was digested with BstEII and XbaI, which cut on
either side of the SPT4 open reading frame. The gapped
plasmid was then used for transformation of spt4 mutant
strains L331, L351, and L374. Plasmid DNA was
prepared from Ura + Spt- transformants, and the EcoRIHindIII fragments containing spt4 mutations were
cloned into M13mp18 and M13mp19 prior to sequence
analysis.
analysis. Primers of 31 to 61 nucleotides were used to
make sequence alterations such that the codons 7, 24,
and 27 of SPT4 would be changed from U G U (cysteine)
to either U C U (serine) or CAC (histidine). HindIII fragments containing mutations in SPT4 were subcloned into
the low-copy-number vector YCp50 and fragments encoding HA1-SPT4 and mutant versions were subcloned
into the high-copy-number 2 gm vector pCGS42 (Collaborative Research, Bedford, Mass.). The low-copynumber plasmids and the SPT4 amino acid changes they
encode are as follows: pBM47, C7S (Cys7~Ser);
pBM49, C7H; pBM50, C27S; and pBM61, C27H. The
high-copy-number plasmids and the SPT4 amino acid
changes they encode are as follows: pBM76, C7S;
pBM77, C7H; pBM89, C24S; pBM83, C24H; pBM79,
C27S; pBM80, C27H; and pBM84, C24H and C27H.
Following transformation of strain L793 with the resulting plasmids, the effect of the mutations on SPT4 function was assessed by determining the Lys phenotypes of
the Ura ÷ transformants on SC-ura-lys plates.
Immunoblot analysis. Strains were grown in SC-ura
medium to maintain selection for plasmids, and total
protein extracts were prepared as previously described
(Celenza and Carlson 1986). Proteins were separated by
electrophoresis in 15% SDS polyacrylamide gels and
transferred by electrophoresis to nitrocellulose. To detect
wild-type or mutant HA1-SPT4 hybrid proteins, filters
were incubated with the HAl-specific monoclonal antibody 12CA5 (Niman et al. 1983) diluted 1 : 500, and then
with alkaline phosphatase conjugated goat anti-mouse
immunoglobulin G (Promega, Madison, Wis.) diluted
1:7,500. The Prot-blot system (Promega) was used to
visualize the HAl-specific bands.
Nucleotide sequence accession number. The GenBank
accession number for the SPT4 sequence is M83672.
Results
Site-directed mutagenesis of SPT4. To allow identification of the SPT4 protein, sequences that encode a 9-amino acid epitope from influenza virus hemagglutinin HA1
(Niman et al. 1983; Field et al. 1988) were inserted at the
5' end of SPT4 using oligonucleotide-directed mutagenesis (Kunkel et al. 1987) with the Muta-Gene M13 kit
(Biorad). The 2.0 kb ScaI-EcoRI fragment containing
SPT4 was subcloned into the EcoRI and HincII sites of
M13mpl8 (Norrander et al. 1983) to construct pM106A,
the template used for in vitro oligonucleotide-directed
mutagenesis. The primer used in mutagenesis included 15
nucleotides 5' of the SPT4 initiation codon, the initiation
codon, 27 nucleotides encoding the HA1 epitope, and 15
nucleotides 3' to the SPT4 initiation codon. Creation of
the correct insertion was verified by DNA sequence
analysis. Digestion with HindIII resulted in a 1.6 kb
HA1-SPT4 fragment, which was cloned into the HindIII
site of pCGS42 to create pBM65.
Mutations in the SPT4 coding sequence were created
in a similar manner using either pM106A or the HA1SPT4 encoding template and were verified by sequence
Clonin 9 of SPT4 and construction of an spt4 null
mutation
To study the effects of complete loss of SPT4 function,
we cloned the SPT4 gene and used it to construct an spt4
null mutant. We cloned SPT4 by screening a yeast
genomic library (Rose et al. 1987) for plasmids that
complement the recessive spt4-3 mutation. The recipient
strains, FW221 and JF2, contain his4-9123 but are His +
due to suppression by spt4-3. After screening approximately 12000 Ura + transformants, we identified six Hiscolonies. Purification and retransformation of the plasmids showed that the Spt + phenotype is conferred by the
plasmids. To determine if the plasmids contain DNA
linked to SPT4, a common 3.5 kb HindIII restriction
fragment was subcloned into an integrating vector, creating plasmid pJF 19. Integration of pJF 19 into strain JF2
(spt4-3) resulted in a strain with an Spt ÷ phenotype that
was then crossed with strain FW619 (SPT4+). Of 53
complete tetrads analyzed, all displayed 4:0 segregation
453
Tn5-156
plasmid
pJF27
pdF18
pJF17
pJ F42
pBM25
SPT4
function
l
I
I I
+
+
+
+
500 bp
Fig. 1. The S P T 4 restriction map. D N A cloned from a yeast genomic library is shown as an open bar. Flanking D N A of the YCp50
vector is shown as a line. Subcloned D N A fragments are pictured
below with their ability to complement spt4 mutations. The positions of the Tn5 insertion and the PvuII site used in construction
of spt4Al: :URA3 are shown, as is the E c o R V site at which the
URA3 gene was inserted in a separate construction. The XbaI and
BstElI sites used to gap pJF42 for rescue o f s p t 4 mutations are also
shown. There is an additional E e o R V site outside of the 3.1 kb
EcoRI fragment and there may be additional BstEII and XbaI sites
as well. The location of the S P T 4 open reading frame (Fig. 5) and
direction of transcription are indicated by the arrow
for Spt + : Spt-, demonstrating that pJF19 directed plasmid integration to the SPT4 locus.
Subcloning indicated that a small portion of the
cloned DNA contains the SPT4 gene. The 1.5 kb ScaIHindIII fragment has full SPT4 function when cloned in
YCp50 (pBM25; Fig. 1). In addition, insertion of the
URA3 gene at the EcoRV site within this fragment does
not disrupt SPT4 function (Fig. 1).
To determine the effects of complete loss of the SPT4
gene, we constructed an spt4 null mutation (see Materials
and methods). Strains carrying this spt4 null mutation
are viable, have an Spt- phenotype, and grow slightly
more slowly than SPT4 + strains. The spt4 null mutation,
like other spt4 alleles, is fully recessive. Therefore, an
Spt- phenotype is caused by loss of SPT4 function.
Previous analysis of SPT5, SPT6, SPT16, and HTA1HTB1, mutations in which cause phenotypes similar to
those of spt4 mutations, showed that increased dosage of
these genes also causes an Spt- phenotype (Clark-Adams
et al. 1988; Clark-Adams and Winston 1987; Malone et
al. 1991 ; Swanson et al. 1991). To test if the SPT4 gene
shares this property, we cloned SPT4 on a high-copynumber, 2 gin-based plasmid. Transformation of strain
FY120 (SPT4 +) with this plasmid, pJF27, had no effect
on suppression of his4-9126 or Iys2-1285. Immunoblot
analysis (described below) demonstrated that increased
SPT4 gene dosage does cause a significant increase in the
level of SPT4 protein (data not shown). Therefore, the
lack of a high-copy-number suppression phenotype distinguishes SPT4 from other phenotypically related S P T
genes.
,A
Transcription of c~ insertion mutations is altered in spt4
mutants
Mutations in SPT4 were previously shown to suppress
the His- and Lys- phenotypes caused by the 8 insertion
mutations his4-9128 and lys2-128~ (Winston et al. 1984a;
Fassler and Winston 1988). To determine if the suppression by spt4 mutations is the result of changes in transcription, we analyzed transcription at both his4-9125 and
lys2-128~ by Northern hybridizations.
The 5 element in his4-9128, located between the HIS4
upstream activating sequence (UAS) and the HIS4
HIS4
I
his4-9128
II
+
I
-t-
HIS4
TUB2
1
2
3
4
B
UAS
~
TATA
SPT4 +
spt4AI::URA3
~i~i~i ~i~i~i ~i!i i!i!i~!ii:i ~i!~i!~i~i ~i!i !~i~i ~i ~i~i~i~i~i~!~!~!i~i~!~!!~i!!~i!i i ~i ~i~i~!i~i~i~!ii i !~i~i~i~i i~i!~i!i !~i!~ii~i~!!~!!~i!~ii!~ii~i!!ii!~
~:~s:~i:~:~s:~!i:~i~i!i:~s:~:~:~i!si!~i~i!i:!:~:!~!~:!~:!i!~:~:~i~:~i~i~i~i~isi~i:~i:~i~:i!i:~i~:!~:s~:!~i)l
a:~i~:~i:~s:i~i:~!i!iai!~:!~:!~:~is)~
H
His-
~
His+
Fig. 2A, B. Transcription of his4-9125 in spt4 mutants. A Total
R N A was separated in a 1.2% agarose gel and subjected to Northern hybridization analysis. The membrane was hybridized first to
the HIS4 probe pFW45 and then to the TUB2 probe pYST138 In
lanes 1 and 2, approximately 1.5 gg of R N A was loaded, and in
lanes 3 and 4, approximately 10 gg was loaded. The strains used
were (left to right) FY98, FY247, FY120, and FY243. B The top
line depicts the structure of his4-912& The stippled box represents
the HIS4 open reading frame. This thin lines represent flanking
DNA. The box with the solid triangle represents a solo S-element.
Labels above indicate the relative positions of known T A T A boxes
(TATA) and upstream activating sequences (UAS). The lower lines
depict the probable origins of transcripts in S P T 4 + and spt4 strains
454
A
L YS2
I
II
"I-
1:
1
2
m a n et al. 1988; Silverman and Fink 1984). In
spt4Al: :URA3 mutants, transcription of his4-9128 is
altered; a transcript that co-migrates with the wild-type
HIS4 m R N A is present as well as the longer, nonfunctional transcript (Fig. 2A, lane 4).
F o r lys2-1286, altered transcription was also observed. The 6 element in lys2-1286 is located in the 5' end
of the L Y S 2 open reading frame. In S P T 4 + strains,
transcription of lys2-1288 initiates at the L YS2 initiation
site and the small transcript size indicates that termination occurs in the 6 (Fig. 3A, lane 3). In spt4Al: .'URA3
strains, a transcript slightly shorter than the wild-type
L Y S 2 m R N A is found in addition to the short transcript
(Fig. 3A, lane 4). Similar changes in his4-9126 and lys21286 transcription have been observed in spt5, spt6,
sptl6, and htal-htbl mutants (Clark-Adams and Winston 1987; Clark-Adams et al. 1988; Malone et al. 1991 ;
Swanson et al. 1991). These results suggest that these spt
mutations permit use of a second, downstream transcription initiation, site in addition to the upstream site preferred in S P T + strains (Fig. 2B; Fig. 3B).
We also examined transcription of the wild-type HIS4
and L YS2 genes and of Ty elements. We found that
spt4A 1 : : URA3 slightly reduces the level of HIS4 transcription and has no effect on transcription of L YS2 or
Ty elements (Fig. 2A, Fig. 3A, E.A. Malone, J.S. Fassler,
and F. Winston, unpublished results). Like spt4 mutations, spt5, spt6, sptl6, and htal-htbl mutations have
little or no effect on the levels of these transcripts (ClarkAdams and Winston 1987; Clark-Adams et al. 1988;
Malone et al. 1991 ; Swanson et al. 1991). Another group
of spt mutants (spt3, spt7, spt8, and sptl5) can be distinguished from spt4 mutants in part because they have
dramatically reduced levels of Ty transcription (Winston
et al. 1984b; 1987; Eisenmann et al. 1992).
ly$-1288
I
::
LYS2
L YS2
TUB2
3
4
B
TATA
UAS
TATA
[ i iii i iii~i?i;i
SPT4 +
spt4AI::URA3
iii iiii iiiiiiiiii i~i!i:~:?:::::~:~:~:~:~:~:~
::iiii ~i~iiiili~:.
i!ii i;ili~!~i~i~!
?!!!~ili~ii i:.
Lys -
~
~
=
Lys +
Fig. 3A, B. Transcription of lys2-1286 in spt4 mutants. A Total
RNA was fractionated in a 1% agarose gel and subjected to Northern hybridization analysis. The membrane was hybridized first to
a mixture of the internal LYS2 probe pFW47 and the 5' LYS2
probe pFW 112 and then rehybridized to the TUB2 probe pYST 138
Because the 5" L YS2 transcript is much more abundant than the
long LYS2 transcript, we used a pFW47 probe that was approximately 10-fold more radioactive than the pFW112 probe. In lanes
1 and 2, approximately 2.5 gg of RNA was loaded, and in lanes 3
and 4, approximately 10 p~gwas loaded. The strains used were the
same as those shown in Fig. 2A. B The top line depicts the structure
of lys2-1288. The stippled box represents the LYS2 open reading
frame. The thin lines represent flanking DNA. The box with the solid
triangle represents a solo g-element. Labels above indicate the
relative positions of known TATA boxes (TATA) and upstream
activating sequences (UAS). The lower lines depict the probable
origins of transcripts in SPT4 + and spt4 strains. The dotted line
indicates that the site of transcription initiation is not known
T A T A box, contains a weak UAS, a T A T A box and an
initiation site (Elder et al. 1983; Liao et al. 1987). In
S P T 4 + strains, transcription initiation occurs predominantly at the 8 initiation site and results in a longer,
non-functional HIS4 m R N A (Fig. 2A, lane 3; Hirsch-
Genetic mapping o f the SPT4 9ene
We genetically m a p p e d S P T 4 to determine whether it is
a previously identified gene. First, by the 2 g m m a p p i n g
method (Falco and Botstein 1983; see Materials and
Methods) we determined that S P T 4 is on c h r o m o s o m e
VII. Second, tetrad analysis demonstrated that S P T 4 is
on the right a r m of c h r o m o s o m e VII, linked to A D E 6
(0.7 cM) and C L Y 8 (26.5 cM) (Table 2). In the single
case of recombination between A D E 6 and SPT4, C L Y 8
and S P T 4 had not recombined, indicating the gene order
A D E 6 - S P T 4 - C L Y 8 (Fig. 4). N o other gene has been
m a p p e d to the position of S P T 4 (Mortimer et al. 1989).
Table 2. Mapping SPT4 by tetrad analysis
Segregating markersa
PD b
NPD
T
cM
spt4-cly8
spt4-ade6
cly8-ade6
3l
66
30
0
0
0
35
1
36
26.5
0.7
27.3
a The tetrads scored come from the cross JF135 x JF113
b PD, parental ditype; NPD, nonparental ditype; T, tetratype
455
v,,
o
reading frame adjacent to SPT4 revealed that it has
significant sequence similarity to an open reading frame
on the S. cerevisiae chromosome III, YCR28C (37%
identity over 178 amino acids; Oliver et al. 1992).
Analysis of spt4 mutations confirmed our identification of the SPT4 open reading frame. First, we created
a + 2 frameshift at the AccI site in the SPT4 open reading
frame (Fig. 5). This mutation was unable to complement
an spt4 mutation, indicating that the AccI site is in the
SPT4 gene. We also cloned and sequenced three spontaneous spt4 alleles by the gap rescue method (OrrWeaver et al. 1983; see Materials and methods). The
sequence changes in these mutants verifies this open
reading frame as encoding SPT4:spt4-6 is a small deletion (positions 553 to 584 in Fig. 5) and spt4-3 and
spt4-289 are nonsense mutations at codons 32 and 57,
respectively, in the SPT4 open reading frame (Fig. 5).
The predicted SPT4 amino acid sequence was compared to other predicted protein sequences in GenBank
by the program Blast (Altschul et al. 1990) and it was also
examined for previously described sequence motifs. Although no significant similarity was found to other proteins in GenBank, the SPT4 amino acid sequence contains four cysteines (at amino acid positions 7, 10, 24 and
27) that are spaced like those found in zinc binding
proteins (reviewed in Berg 1986; 1990). Most other amino acid residues conserved in different classes of zinc
binding proteins are not present in SPT4. As described
in a later section, these cysteines in SPT4 are required for
SPT4 function.
/
Fig. 4. Genetic map position of SPT4. Tetrad analysis demonstrated S P T 4 is linked to ADE6 and C L Y 8 on chromosome VII (See
Table 2 and text). The position of TRP5 is shown as an additional
reference point
Therefore, we conclude that it is a previously unidentified
gene.
Sequence of the SPT4 9ene
To understand better the function of SPT4, we sequenced most of the 3.1kb EcoRI DNA fragment that
includes SPT4. We identified a single open reading frame
in the region of the clone previously shown to be required
for SPT4 activity (Figs. 1 and 5). The SPT4 DNA
sequence predicts a 102 amino acid protein of 11 kDa.
The size is consistent with subcloning experiments and
with the size of the SPT4 m R N A (0.46 kb (E.A. Malone,
J.S. Fassler, and F. Winston, unpublished results). The
orientation of the SPT4 open reading frame is consistent
with the direction of transcription, as determined by
Northern hybridization analysis using single-stranded
probes (E.A. Malone, J.S. Fassler, F. Winston, unpublished results; diagrammed in Fig. 1). (Analysis of the
predicted 485 amino acid sequence of a partial open
1
61
AATATGGAGGAAAGAGATGGTTACTACTATTTAAAGCGGTCCTC
GAAGTAGATAGGTATATTACGCTTTAGACAC
CATACCT
121
TAATTTAATCATCT
181
TCTATGAGTGAAATCGAGTGAAAAAGTGAAATTTAAGAAAGGGCT
241
GTAATAAT
301
361
CGAAGGAT
TACACCTGGCCACATTCAGTTTGGCAAAAGCGAACGAGGTACAGT
S
E
R
TGTATGCT
A
C
M
GTAAGAG
GTGTGGCATAGTGCAGACCACAAAT
L
C
G
I
V
Q
T
T
GTAC T GT
GAGTTTAAT
N
E
F
20
N
AGAGATGGTTGTCCC~CTGTCAGGGTATTTTTG~GAGGCAGGTGTTTCTAC~TGG~
R
421
S
CAAATAAATATATTCATGTATA
TCTATCTATAATTAATCTCGATGTTGATA/IAGGTCACCTTATACGT
ATGTCTAGTGAAAGAGCC
M
GTAGTCCAATTTACGT
D
G
C
P
N
C
Q
G
I
F
E
E
A
G
V
S
T
M
40
E
TGTACGTCGCCTTCTTTCGAGGGCCTCGTAGGAATGTGTAAGCCTACT_AAGTCGTGGGTA
C
T
S
P
S
F
E
G
L
V
G
M
C
K
P
T
K
S
W
V
60
AccI
481
GCAAAGTGGCTGAGCGTAGATCATAGTATAGCTGGTATGTACGCCATCAAGGTCGATGGT
A
K
W
L
S
V
D
H
S
I
A
G
M
Y
A
I
K
V
D
G
80
G
S
Q
i00
PvuII
541
AGACTACCAGCTGAGGTTGTGGAGCTGTTGCCTCACTACAAACCGAGGGATGGCAGTCAA
R
L
P
A
E
V
V
E
L
L
R
H
Y
K
P
R
D
EcoRV
601
GTTGAGTAA/%ACCTTCCGTTCTGATATCACATGTATAATAGTAATGAATTTTTTTTACTT
V
E
*
661
TTTTTTTTTTTTAGTAAATATTCTAGCATATGAGTTTATGCTTTCATTTATTTAACGTTC
721
TGCACTTTTGTTTTTGCTGGCAAACCCAATTTTTCTACCGTCCAGTAATTCAACTAAGGC
781
TAAAAAGACTTTCATTAGAAAAAAAAGGTCCAAGGATAGGA/iAATTTCAAGATA_AAGTAT
102
Fig. 5. Nucleotide sequence of the S P T 4
gene and the predicted sequence of the
SPT4 protein. Most of the EeoRI fragment containing S P T 4 was sequenced on
both strands, and a portion of the
sequence is shown here. (The entire region that was sequenced has been submitted to GenBank, accession number
M83672.) Nucleotides are numbered on
the left and amino acids are numbered
on the right. The PvuII site used in restriction mapping, the E e o R V site at
which the URA3 gene was inserted, and
the AecI site used in construction of a
frameshift are labeled above the D N A
sequence. Underlinin9 highlights the location of three spontaneous spt4 mutations. The bases at positions 394 and 469
are thymidines in spt4-289 and spt4-3,
respectively. Bases 553 to 584 are deleted
in spt4-6. The cysteines that comprise the
zinc-binding motif are also underlined
456
,,¢
I--.
n
•"r-
n
¢/1
116-66-45--
29--
12-6--
Fig. 6. Identification of the
SPT4 protein. Proteins were
separated in a 15% SDSpolyacrylamide gel, electrophoretically transferred to nitrocellulose, and probed with
an HAl-specific antibody. In
each lane, 175 gg of total yeast
protein was loaded. The locations of proteins of known
molecular weight (kDa) are indicated on the left. Protein extracts were prepared from
strain FY120 transformed with
pBM65 (HA1-SPT4, lane 1)
and pBM25 (SPT4, lane 2)
Identification of the SPT4 protein
To facilitate detection of the SPT4 protein, we constructed a fusion gene that encodes a 9-amino acid epitope
from the hemagglutinin HA1 of influenza virus (Niman
et al. 1983; Field et al. 1988) fused to the amino-terminus
of SPT4 (see Materials and methods). The fusion gene
has full SPT4 function, as judged by its ability to complement an spt4 null mutation. A monoclonal antibody that
recognizes the HA1 epitope (Niman et al. 1983) specifically recognizes the HA1-SPT4 fusion protein (Fig. 6).
A second protein consisting of the HA1 epitope fused to
the carboxy-terminus of SPT4 was not detected with this
antibody (E.A. Malone, J.S. Fassler, and F. Winston,
unpublished results). Based on its migration on SDSpolyacrylamide gels, the HA1-SPT4 protein has an apparent molecular weight of 14 kDa, in close agreement
with the predicted size of 12 kDa (Fig. 6). HA1-SPT4 was
only detected when the fusion gene was carried on a
high-copy-number plasmid, indicating that the increased
copy number results in a higher level of SPT4 protein. In
addition, we were unable to detect HA1-SPT4, even
when on a high-copy-number plasmid, by indirect immunofluorescence using fixed cells. These results suggest
that the SPT4 protein is maintained at low levels, consistent with the relatively low levels of SPT4 m R N A detected on Northern blots (E.A. Malone, J.S. Fassler, and
F. Winston, unpublished results).
Particular cysteine residues of SPT4 are required for
function
The pattern C X2-C-X13-C-X2 C found at amino acid
positions 7-27 of SPT4 is similar to the pattern found in
some zinc-binding proteins (Berg 1990). To test if these
cysteines are important for SPT4 function, we used sitedirected mutagenesis to change these residues to serine
or histidine. Serine is structurally most like cysteine, and
histidine, like cysteine, can participate in binding metal
ions (Berg 1986).
The mutations were analyzed in two types of plasmids. First, we analyzed one set in low-copy-number
plasmids to assess function under approximately normal
gene dosage conditions. Second, we examined a larger set
of mutations in a high-copy-number plasmid in which
SPT4 was fused to H A l (pBM65). Use of these highcopy-number constructs gave us the potential to determine the level of the mutant protein present in vivo. All
plasmids were tested for complementation of spt4: ."Tn5156 by examining suppression of lys2-128~ after transformation of strain L793.
The results of testing changes in three different cysteines in the SPT4 zinc-binding domain demonstrate that
these particular amino acids are essential for SPT4 function. First, each change of cysteine to serine eliminated
SPT4 function (Table 3). Second, changes of cysteine to
histidine also confirmed the importance of these amino
acid residues and further suggested that their role may be
in metal binding. The C y s 7 ~ H i s change eliminated
SPT4 function; however, both the C y s 2 4 ~ H i s and
Cys27-~His changes resulted in only a partial loss-offunction. For the C y s 2 7 ~ H i s change, increased gene
dosage resulted in increased SPT4 function (Table 3).
The partially functional substitution of histidine for cysteine indicates that both Cys24 and Cys27 may be involved in binding to metal ions. When all these plasmids
were transformed into the SPT4 + strain FY120 no mutant phenotypes were detected; therefore, these mutations are recessive.
To determine the levels of the mutant SPT4 proteins,
we used immunoblot analysis to compare the amount of
wild-type and mutant SPT4 proteins in transformants of
Table 3. Effect of altering cysteines in SPT4
Amino acid changes"
None
Cys7--,Ser
Cys7-~His
Cys24~Ser
Cys24~His
Cys27--*Ser
Cys27--+His
Cys27~His, Cys24~His
SPT4 function b
Low copy
number
High-copy
number
+
ND
ND
- /+
ND
+
+/+
" Mutations carried on low-copy-number CEN plasmids were constructed in the wild-type SPT4 gene. Mutations carried on highcopy-number 2gm plasmids were constructed in the HA1-SPT4
fusion gene. In both cases, amino acids are numbered as in Fig. 5
b SPT4 function was assessed based on growth of tranformants of
strain L793 on SC-ura-lys plates after 2 days at 30° C. +, + / - ,
- / + , and - indicate no growth, weak growth, moderate growth,
and strong growth, respectively. ND indicates that the effect was
not determined
457
both strains F Y t 2 0 and L793. Surprisingly, we were
unable to detect any of the mutant proteins, including the
two with partial function (E.A. Malone, J.S. Fassler, and
F. Winston, unpublished results). The implications of
this result are discussed in the following section.
Discussion
Previous studies of spt4 mutations have shown that they
can suppress solo 8 insertion mutations and a deletion of
the gene that encodes the transcription activator SNF2
(Happel et al. 1991; Swanson and Winston 1992). Furthermore, genetic studies have suggested that the SPT4
protein interacts with the essential proteins SPT5 and
SPT6 (Swanson and Winston 1992). In our current work,
we have characterized the effect of spt4 mutations on
transcription, as well as the SPT4 gene and its product.
In spite of many similarities between spt4, spt5, and
spt6 mutants, our analysis of the SPT4 gene and its
product indicates that some features of SPT4 are quite
distinct from SPT5 and SPT6. First, SPT5 and SPT6 are
essential for growth (Clark-Adams and Winston 1987;
Swanson et al. 1991), while an spt4 null mutation results
in only a minor growth defect. Second, spt4 mutants are
mildly sensitive to the mutagens methyl methanesulfonate and ?-rays, a phenotype not caused by spt5 or spt6
mutations (Winston et al. 1984a; E.A. Malone, J.S. Fassler, and F. Winston, unpublished results). Third, increased dosage of SPT5 and SPT6 causes an Sptphenotype (Clark-Adams et al. 1988; Clark-Adams and
Winston 1987; Swanson et al. 1991), a characteristic not
shared by SPT4. Finally, SPT5 and SPT6 both encode
large proteins with very acidic amino-termini (Swanson
et al. 1990; 1991). In contrast, the SPT4 protein is small
and has no acidic regions. Thus, although these SPT
proteins are likely to be involved in the same process, the
function of SPT4 is probably different from those of
SPT5 and SPT6. Mutations in SPT4, SPT5, or SPT6
also confer many phenotypes similar to those conferred
by mutations in SPT16 (Malone et al. 1991 ; Rowley et
al. 1991). However, genetic evidence suggests that there
is no direct interaction of SPT 16 with the putative SPT4SPT5-SPT6 complex (Malone et al. 1991).
Our mutational analysis suggests that metal binding
may be important for the function of SPT4. The arrangement of cysteines at the amino-terminus of SPT4
(C~2-C-X13-C-X2-C) is similar to patterns found in
proteins known to bind zinc ions. We have individually
changed three of these cysteines to serine, an amino acid
of a similar structure, and have shown that these changes
eliminate SPT4 function. Substitution of histidine for the
cysteine at position 24 or 27, however, has a less severe
effect on SPT4 function. Since histidine residues can also
coordinate zinc and other metal ions, these results support the idea that folding of this SPT4 domain around
a metal ion is important for activity of the SPT4 protein.
Functional substitution of histidine for zinc-binding cysteines has been accomplished previously in the glucocorticoid receptor (Severne et al. 1988; Hard et al. 1990; Pan
et al. 1990).
Our experiments to analyze the roles of the cysteines
in the SPT4 metal-binding motif were inconclusive, due
to the fact that the mutant SPT4 proteins have decreased
stability compared to wild-type SPT4. Perhaps the instability of the mutant SPT4 proteins is due to an inability to interact normally with SPT5 or SPT6 or due to an
inability to bind zinc. More sensitive methods to measure
SPT4 protein levels, as well as more direct experiments
must be done before we can conclude that metal-binding
plays a role in SPT4 function.
Our results suggest that the SPT4 protein (along with
SPT5 and SPT6) may normally act to repress transcription at a variety of loci, In this current work, we have
shown that spt4 mutations result in new transcripts from
his4-9128 and lys2-1288, probably through the use of
additional transcription initiation sites. Similarly, spt4
mutations partially restore expression of SUC2 and Ty
elements in the absence of the transcriptional activator
SNF2 (Happel et al. 1991 ; Swanson and Winston 1992).
These results are consistent with the idea that SPT4
(along with SPT5 and SPT6) plays a role in chromatin
structure or assembly. In vitro studies have indicated that
chromatin structure is a general repressor of transcription. Furthermore, in vivo alterations in yeast histone
genes, like mutations in SPT4, permit transcription from
otherwise inactive promoters, including some of those
activated by spt4 mutations (Clark-Adams et al. 1988;
Han and Grunstein 1988; Kayne et al. 1988; Mcgee et
al. 1990; Park and Szostak 1990; Hirschhorn et al. 1992).
Analysis of chromatin structure spt4 mutants would begin to address this hypothesis. Alternatively, SPT4 may
repress transcription by interactions with certain promoter sequences or by inhibition of either specific activators or general transcription factors. However SPT4 may
function, it apparently does so in combination with SPT5
and SPT6.
Acknowledgements.This work was supported by National Institutes
of Health grant GM32967, National Science Foundation grant
DCB8451649, and grants from the Monsanto Company and the
Stroh Brewery Company, all to F.W.E.A.M. was supported by an
National Institutes of Health training grant to the Genetics Program (T32-GM07196) and by the Lucille P. Markey Charitable
Trust. J.S.F, was supported by National Institutes of Health Grant
GM10168 and a Charles A. King Trust fellowship from The Medical Foundation.
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990)
Basic local alignment search tool. J Mol Biol 215:403-410
Berg JM (1986) Potential metal binding domains in nucleic acid
binding proteins. Science 232:485-487
Berg JM (1990) Zinc fingers and other metal binding domains.
J Biol Chem 265 : 6513-6516
Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure
or screening recombinant plasmid DNA. Nucleic Acids Res
7:1513 1523
Botstein D, Falco SC, Stewart SE, Brennan M, Scherer S, Stinchcomb DT, Struhl K, Davis RW (1979) Sterile host yeasts (SHY):
A eukaryotic system of biological containment for recombinant
DNA experiments. Gene 8:17 24
458
Boyer HW, Roulland-Dussoix D (1969) A compIementation analysis of the restriction and modification of DNA in E. coli. J Mol
Biol 41:458-472
Carlson M, Botstein D (1982) Two differentially regulated mRNAs
with different 5' ends encode secreted and intracellular forms of
yeast invertase. Cell 28 : 145-154
Celenza JL, Carlson M (1986) A yeast gene that is essential for
release from glucose repression encodes a protein kinase.
Science 233:1175 1180
Chaleff DT, Fink GR (1980) Genetic events associated with an
insertion mutation in yeast. Cell 21:227-237
Clark-Adams CD, Norris D, Osley MA, Fassler JS, Winston F
(1988) Changes in histone gene dosage alter transcription in
yeast. Genes Dev 2:150-159
Clark-Adams CD, Winston F (1987) The SPT6 gene is essential for
growth and is required for g-mediated transcription in Saccharomyces cerevisiae. Mol Cell Biol 7:679-686
Eisenmann DM, Dollard C, Winston F (1989) SPT15, the gene
encoding the yeast TATA binding protein TFIID, is required
for normal transcription initiation in vivo. Cell 58:1183-1191
Eisenmann DM, Arndt KM, Ricupero SL, Rooney JW, and Winston F (1992) SPT3 interacts with TFIID to allow normal
transcription in Saccharomyces cerevisiae. Genes Dev
6:1319 1331
Elder RT, Loh EY, Davis RW (1983) RNA from the yeast transposable element Tyl has both ends in the direct repeats, a structure
similar to retrovirus RNA. Proc Natl Acad Sci USA
80 : 2432-2436
Falco SC, Botstein D (1983) A rapid chromosome-mapping method
for cloned fragments of yeast DNA. Genetics 105:857 872
Falco SC, Li Y, Broach JR, Botstein D (1982) Genetic properties
of chromosomally integrated 2 g plasmid DNA in yeast. Cell
29:573 584
Farabaugh PJ, Fink GR (1980) Insertion of the enkaryotic transposable element Tyl creates a 5-base pair duplication. Nature
286:352-356
Fassler JS, Winston F (1988) Isolation and analysis of a novel class
of suppressor of Ty insertion mutations in Saccharomyces
cerevisiae. Genetics 118:203 212
Fassler JS, Winston F (1989) The Saccharomyces cerevisiae SPT13/
GALl1 gene has both positive and negative regulatory roles in
transcription. Mol Cell Biol 9:5602-5609
Feinberg AP, Vogelstein B (1983) A tecnique for radiolabeling
restriction endonuclease fragments to high specific activity. Anal
Biochem 132:6-13
Field J, Nikawa J-I, Broek D, MacDonald B, Rodgers L, Wilson
IA, Lerner RA, Wigler M (1988) Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by
use of an epitope addition method. Mol Cell Biol 8:2159 2165
Grunstein M (1990) Histone function in transcription. Annu Rev
Cell Biol 6: 643-678
Han M, Grunstein M (1988) Nucleosome loss activates downstream
promoters in vivo. Cell 55:1137-1145
Happel AM, Swanson MS, Winston F (1991) The SNF2, SNF5, and
SNF6 genes are required for Ty transcription in Saccharomyces
cerevisiae. Genetics 128:69 77
Hard T, Kellenbach E, Boelens R, Maler BA, Dahlman K, Freedman LP, Carlstedt-Duke J, Yamamoto KR, Gustafsson J-A,
Kaptein R (1990) Solution structure of the glucocorticoid receptor DNA-binding domain. Science 249:157-160
Hirschhorn JN, Brown SA, Clark CD, Winston F (1992) Evidence
that SNF2/SWI2 and SNF5 activate transcription in yeast by
altering chromatin structure. Genes Dev 6:2288 2298
Hirschhorn JN, Winston F (1988) SPT3 is required for normal
levels of a-factor and a-factor expression in Saccharomyces
cerevisiae. Mol Cell Biol 8:822-827
Hirschman JE, Durbin KJ, Winston F (1988) Genetic evidence for
promoter competition in Saccharomyces cerevisiae. Mol Cell
Biol 8:4608-4615
Hoffman CS, Winston F (1987) A ten-minute DNA preparation
from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267-272
Ito H, Fukuda Y, Murata K, Kimura, A (1983) Transformation of
intact yeast cells treated with alkali cations. J Bacteriol
153:163-168
Johnston M, Davis RW (1984) Sequences that regulate the divergent GAL1-GALIO promoter in Saccharomyces cerevisiae. Mol
Cell Biol 4:1440-1448
Kayne PS, Kim U-J, Han M, Mullen JR, Yoshizaki F, Grunstein
M (1988) Extremely conserved histone H4 N terminus is dispensable for growth but essential for repressing the silent mating
type loci in yeast. Cell 55:27-39
Klapholz S, Esposito R (1982) A new mapping method employing
a meiotic rec- mutant of yeast. Genetics 100:387 412
Kunkel TA, Roberts JD, Zabour RA (1987) Rapid and efl]cient
site-specific mutagenesis without phenotypic selection. Methods
Enzymol 154:367-382
Liao X-B, Clare JJ, Farabaugh PJ (1987) The upstream activation
site of a Ty2 element of yeast is necessary but not sufficient to
promote maximal transcription of the element. Proc Natl Acad
Sci USA 84:8520-8524
Malone EA, Clark CD, Chiang A, Winston F (1991) Mutations in
SPT16/CDC68 suppress cis- and trans-acting mutations that
affect promoter function in Saccharomyces cerevisiae. Mol Cell
Biol 11 : 571~5717
Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York
Megee PC, Morgan BA, Mittman BA, Smith MM (1990) Genetic
analysis of histone H4: essential role of lysine subject to reversible acetylation. Science 247:841-845
Messing J (1979) A multipurpose cloning system based on the
single-stranded DNA bacteriophage M13. Recombinant DNA
Technical Bulletin (NIH Publication No. 79 99) 2:43-48
Mortimer RK, Schild D, Contopoulou CR, Kans JA (1989) Genetic
map of Saccharomyces cerevisiae, Edition 10. Yeast 5:321-403
Natsoulis G, Dollard C, Winston F, Boeke JD (1991) The products
of the SPTIO and SPT21 genes of Saccharomyces cerevisiae
increase the amplitude of transcriptional regulation at a large
number of unlinked loci. New Biologist 3:1249-1259
Neigeborn L, Celenza JL, Carlson M (1987) SSN20 is an essential
gene with mutant alleles that suppress defects in SUC2 transcription in Saccharomyces cerevisiae. Mol Cell Biol 7 : 672-678
Niman HL, Houghton RA, Walker LE, Reisfeld RA, Wilson IA,
Hogle JM, Lerner RA (1983) Generation of protein-reactive
antibodies by short peptides is an event of high frequency:
implications for the structural basis of immune recognition.
Proc Natl Acad Sci USA 80:4949-4953
Norrander J, Kempe T, Messing J (1983) Construction of improved
M13 vectors using oligodeoxynucleotide-directed mutagenesis.
Gene 26:101-106
Oliver SG et al. (1992) The complete DNA sequence of yeast
chromosome III. Nature 357:38-46
Orr-Weaver TL, Szostak JW, Rothstein RJ (1983) Genetic application of yeast transformation with linear and gapped plasmids.
Methods Enzymol 101:228-245
Pan T, Freedman LP, Coleman JE (1990) Cadmium-ll3 NMR
studies of the DNA binding domain of the mammalian glucocorticoid receptor. Biochemistry 29:9218 9225
Park E-C, Szostak JW (1990) Point mutations in the yeast histone
H4 gene prevent silencing of the silent mating type locus HML.
Mol Cell Biol 10:4932-4934
Pugh BF, Tjian R (1992) Diverse transcriptional functions of the
multisubunit eukaryotic TFIID complex. J Biol Chem
267 : 679-682
Rigby PW, Diekman M, Rhodes C, Berg P (1977) Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J Mol Biol 113:237-251
459
Roeder GS, Fink GR (1980) DNA rearrangements associated with
a transposable element in yeast. Cell 21:239 249
Rose MD, Novick P, Thomas JH, Botstein D, Fink GR (1987)
A Saccharomyces cerevisiae genomic plasmid bank based on a
centromere-containing shuttle vector. Gene 60:237-243
Rose MD, Winston F, Heiter P (1990) Methods in yeast genetics,
revised edition. Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York
Rothstein R (1983) One-step gene disruption in yeast. Meth Enzymol 101:202-211
Rowley A, Singer RA, Johnston GC (1991) CDC68, a yeast gene
that affects regulation of cell proliferation and transcription,
encodes a protein with a highly acidic carboxyl terminus. Mol
Cell Biol 11 : 5718-5726
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA
74: 5463-5467
Sawadogo M, Sentenac A (1990) RNA polymerase B (II) and
general transcription factors. Annu Rev Biochem 59:711-754
Scherer S, Davis RW (1979) Replacement of chromosome segments
with altered DNA sequences constructed in vitro. Proc Natl
Acad Scie USA 76:4951-4955
Severne Y, Wieland S, Schaffner W, Rusconi S (1988) Metal binding 'finger' structures in the glucocorticoid receptor defined by
site-specific mutagenesis. EMBO J 7:2503-2508
Silverman SJ, Fink GR (1984) Effects of Ty insertions on HIS4
transcription in Saccharomyces cerevisiae. Mol Cell Biol
4:1246-1251
Simchen G, Winston F, Styles CA, Fink GR (1984) Ty-mediated
expression of the LYS2 and HIS4 genes of Saccharomyces
cerevisiae is controlled by the same S P T genes. Proc Natl Acad
Sci USA 81:2431-2434
Som T, Armstrong KA, Volkert FC, Broach JR (1988) Autoregulation of 2 lam circle gene expression provides a model for maintenance of stable plasmid copy levels. Cell 52:27-37
Southern EM (1975) Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J Mol Biol
98:503-517
Struhl K, Stinchcomb DT, Scherer S, Davis RW (1979) High frequency transformation of yeast: Autonomous replication of
hybrid molecules. Proc Natl Acad Sci USA 76:1035-1039
Swanson MS, Carlson M, Winston F (1990) SPT6, an essential gene
that affects transcription in Saccharomyces cerevisiae, encodes
a nuclear protein with an extremely acidic amino terminus. Mol
Cell Biol 10:4935 4841
Swanson MS, Malone EA, Winston F (1991) SPT5, an essential
gene important for normal transcription in Saccharomyces
cerevisiae, encodes an acidic nuclear protein with a carboxyterminal repeat. Mol Cell Biol 11:3009-3019
Swanson MS, Winston F (1992) SPT4, SPT5, and SPT6 interactions: effects on transcription and viability in Saccharomyces
cerevisiae. Genetics 132:325-336
Van Dyk TK, Falco SC, LaRossa RA (1986) Rapid physical mapping by transposon Tn5 mutagenesis of the cloned yeast ILV2
gene. Appl Environ Microbiol 51:206 208
Winston F, Chaleff DT, Valent B, Fink GR (1984a) Mutations
affecting Ty-mediated expression of the HIS4 gene of Saccharomyces cerevisiae. Genetics 107:179-197
Winston F, Durbin KJ, Fink GR (1984b) The SPT3 gene is required for normal transcription of Ty elements in S. cerevisiae.
Cell 39 : 675-682
Winston F, Dollard C, Malone EA, Clare J, Kapakos JG, Farabaugh P, Minehart P (1987) Three genes are required for transactivation of Ty transcription in yeast. Genetics 115:649 656
C o m m u n i c a t e d by D.Y. T h o m a s