Download Rice 5 S Ribosomal RNA and Its Binding Protein Genes: Structure

Mol. Cells, Vol. 5, No. 4. pp. 381-387
Rice 5 S Ribosomal RNA and Its Binding Protein Genes:
Structure and Expression
Ju-Kon Kim* and Baek Hie Nahm 1
Department of Genetic Engineering, The University of Suwon, Suwon 440-600, Korea;" [Department
of Biological Science, Myunggi. University, Yongin 449-828, Korea
(Received on June 20, 1995)
We have isolated a genomic clone containing rice 5 S ribosomal RNA (rRNA)-encoding genes
(rDNA). The clone contains 10 repeat units of 290 bp, plus 2.0 kb of flanking genomic sequence at one border. Sequencing of individual repeat units shows that the sequence of the
5 S rRNA coding region is very similar to that reported for other flowering plants, while
the nontranscrihed spacer region is diverged. Genomic DNA-blot analysis indicates that 5 S
rDNA occurs in long tandem arrays. A rice 5 S rRNA-binding protein gene (RL5) was previously isolated and sequenced [Kim, J.-K., and Wu, R. (1993) Plant MoL BioL 23, 409-413J.
Amino acid sequence analysis of the RL5 protein revealed that it has many intriguing features.
These include the presence of three repeated amino acid sequences and the conservation of
glycine residues, which may he important for 5 S rRNA/RL5 protein interactions. Genomic
DNA-blot analysis indicates that there are fewer copies of the RL5 gene in rice than in other
eukaryotes. The RL5 gene appears to be constitutively expressed at high levels in rice tissues.
Ribosomal components are an extraordinarily conserved class of macromolecules found in nature (Gouy
and Li, 1990; Lake, 1990; Wittmann-Liebold et al.,
1990). This is most likely a consequence of their central importance in protein synthesis. The 80 S ribosome, as compared with the E. coli 70 S ribosome,
has a larger number of proteins (about 75 versus 55)
and an additional small 5.8 S rRNA (Wittmann-Liebold et al., 1990). A number of complete sequences
are known for eukaryotic ribosomal proteins from
yeast, Xenopus laevis, and Drosophila. However, there
are only a few reported sequences of cytoplasmic ribosomal proteins in plants while many sequences of organellar ribosomal proteins are known (Subramanian
et al., 1990). In the case of plant ribosomal 5 S RNAbinding proteins (L5), there are only two complete
deduced amino acid sequences available from rice
(Kim and Wu, 1993) and alfalfa (Asemota et al., 1994)
so far. Over a hundred 5 S rRNA sequences have
been determined (Specht et ai., 1991) including rice
5 S rRNA (Hariharan et ai., 1987).
Ribosomal components have the ability to self-assemble and therefore provide excellent means of
studying protein-protein and protein-RNA interactions.
Ribosomal 5 S RNA and proteins that bind to it have
more advantages for these studies than the other
rRNA systems primarily because the nucleic acid is
small and only a few proteins bind to it (Chan et
aI., 1987). Moreover, ribonucleoprotein complexes containing 5S rRNA can be reconstituted independently
* To whom correspondence should be addressed.
of other ribosomal components and they can be removed from, and added back to, the ribosome as a
unit (Chan et al., 1987).
Based on the conserved bases of the sequences,
minimal models of 5 S rRNA secondary structure
have been proposed (Specht et ai., 1990). Furthermore,
protein-binding sites on several 5 S rRNAs for the
Escherichia coli ribosomal proteins L5, LI8, and L25
(Huber and Wool, 1984), for the yeast ribosomal protein YL3 (Nazar and Wildeman, 1983), for the rat ribosomal protein L5 (Huber and Wool, 1986a), and
for Xenopus Laevis transcription factor IlIA (Huber and
Wool, 1986b) have been identified. Very little information, however, is known about binding sites on those
proteins.
To study the protein-RNA interactions in plant ribosomes, a rice cDNA (RL5) coding for 5 S rRNAbinding protein was previously isolated and sequenced
(Kim and Wu, 1993). In this paper, we report the isolation and structural analysis of a rice 5 S rRNA gene,
the structural features of the RL5 protein, and the
constitutive expression of the RL5 gene in different
tissues.
Materials and Methods
General materials and methods
Restriction endonucleases were obtained from New
The abbreviations used are: 5 S rRNA, 5 S ribosomal RNA;
L5, 5 S ribosomal RNA-binding protein; RL5, rice 5 S ribosomal RNA-binding protein gene.
© 1995 The Korean Society for Molecular Biology
382
Rice 5 S Ribosomal RNA and Protein Genes
England Biolabs (Beverly, MA), Bethesda Research
LaboratOIies (Gaithersburg, MA), or Boehringer Mannheim (Indianapolis, IN). 17 sequencing™ kit was
from Pharmacia LKB Biotechnology (Piscataway, NJ).
[a-32P}dNTPs were from Amersham Corp. (Arlington
Heights, IL). Preparation of phage and plasmid DNA,
restriction enzyme digestion, [ 32PJ-dATP random-hexamer labeling of DNA fragments, and bacterial transformation were performed according to standard protocols (Sambrook et al., 1989).
Library screening and DNA sequencing
A genomic library containing partially digested Sau3
A fragments of 0. sativa cv. IR36 genomic DNA in
the lambda-EMBL vector was a gift from Dr. Ray
Wu at Comell University. Approximately 1 X 105 plaques were screened with a random-primed [ 32 P}
labeled flax 5 S ribosomal DNA (Goldsbrough et aI.,
1982) as a probe. Plaque transferring and hybridization to DNA on the Gene ScreenTM fUters (New England Nuclear, Albany, MA) for both primary and secondary screenings was carried out according to the
manufacturer's manual. Prehybridization and hybridization were carried out at 42 °C for 24 hand 30 h,
respectively, in 50% (v/v) formamide, 6 X SSC (0.45
M sodium chloride, 0.045 M sodium citrate), 0.5%
(w/v) SDS (sodium dodecylsulfate), 5X Denhardt's
solution, and 100 /lg/rnl of salmon sperm DNA. The
ruters were washed successively at 42 °C for 20 min
in the following solutions: 2 X SSC; 0.5 X SSC, 0.1 %
(w/v) SDS; 0.1 X SSC, 0.1 % (w/v) SDS. Several phage
clones were isolated and three of the clones were further analyzed by using DNA gel blots. DNA was digested with EcoRl, SalI, XbaI, and BamHI, fractionated
by agarose gel electrophoresis, and blotted onto NYTRAN ruters (Schleicher and Schuell, Keene, NH).
The ruter was then hybridized to a [ 32PHabeled flax
...,
5 S DNA fragment. .
Appropriate restriction fragments of DNA were subcloned into the M13mpl8 and M13mp19 vectors (New
England Biolabs, Beverly, MA) and sequenced by the
dideoxynucleotide chain-termination method of Sanger
et al. (1977) with the manufacturer's modifications
(Pharmacia).
Genomic DNA gel-blot hybridizations
For the genomic DNA hybridization analysis, total
cellular DNA was isolated from leaves and digested
with the appropriate restriction enzymes, fractionated
through 1% agarose gels, and transferred to NYTRAN
filters. The rice genomic DNA on the fIlters was prehybridized for 3 h at 42 °C and hybridized with a
32
[ pJ-labeled probe DNA for 15 h at 42 °C in the
same solutions used for library screening. The ruters
were washed successively at 60 "c for 20 min in each
of the following solutions: 2 X SSC; 0.1 X SSC, 0.1 %
(w/v) SDS; om X sse, 0.1% (w/v) SOS. After washing,
all filters were exposed to Kodak XAR5 fUm with an
intensifying screen at - 20 °C.
M ol.
Cells
RNA gel blot analysis
Rice seedlings (approximately 7 days old) with 40
mm long shoots were grown at 25 °C. The shoots and
roots of seedlings were cut off with a razor blade and
frozen in liquid nitrogen for preparation of RNA extraction. Total RNAs from shoots and roots was extracted with the Guanidine/HCl method as described
in Sambrook et al. (1989).
For RNA gel-blot analysis, total RNAs (20 /lg) from
shoots and roots were electrophoresed in 1% agaroseformaldehyde gels, transferred to NYTRAN filters. The
filters were baked at 80 "c for 1 h, prehybridized 3
h at 42 °C, and hybridized with appropriate probes
for 15 h at 42 °C as in the same solutions used for
library screening. The fUters were then washed successively at 60 °c for 20 min in each of the following
solutions: 2 X SSC; 0.1 X SSC, 0.1 % (w/v) SDS; 0.01 X
SSC, 0.1 % (w/v) SDS. After washing, all ftlters were
exposed to Kodak XAR5 film with an intensifying
screen at - 20 °C.
Results arid Discussion
Isolation and sequence analysis of a genomic clone containing 5 S rRNA genes
In order to isolate a clone containing a cluster of
tandernly repeated 5 S ribosomal RNA genes, a flax
5 S ribosomal DNA was used to probe a rice genomic
library. Out of approximately 100,000 phages in the
genomic library, twenty-six positive plaques were retrieved. Three of them showed stronger hybridization
signals than the others because they presumably contain more copies of the 5 S ribosomal RNA gene.
Restriction enzyme analysis and Southern blot hybridization by using [ 32PHabeled flax 5 S ribosomal
DNA showed that these three plaques are identical.
A 5.0 kb EcoRl fragment from the phage DNA that
contains rice 5 S ribosomal RNA gene was subcloned
into the pBluescript vector for restriction mapping and
the resulting plasmid was named pR5s.
As shown in Figure 1, the 5.0 kb EcoRl fragment
in the pR5s contains a HincH site and can be digested
with the enzyme into two fragments of 2.0 kb and
3.0 kb. They are referred to as HincII-2.0 and HincII-
RI
HIli Hcll B B B B
B
B B
B B B RI
!
II
L---..J
500 bp
Figure 1. Restriction map of a 3.0 kb HincII-EcoRI DNA
fragment containing a tandem cluster of 5 S rRNA genes
in the plasmid pRSs. The black box indicates a tandem
cluster of 5 S rRNA genes. The white box represents a unrelated flanking rice DNA fragment. Restriction sites: B,
BamHI ; HIlI, HindiIl; Hcn, HincIl; RI, EcoRI.
Vol. 5 (1 995)
A.
Ju-Kon Kim & Baek Hie Nahm
383
5S rDNA
1G3ATIX'CA'IC'JGAACTCCGAl~lGI'lGI'KTNnA'IDJ3IG
60
BamHI
G"TTI IG::::Ai@cctttttgtctctctctccccccttttgactc120
TV
r..-.v-v-n"V"V"T;I1
T n'
gcgccgctgctccctcgtgtatgctggggagaat cggatgtaacattttctgtagatgtccgt 180
ggatatatcatttgcctgattccgagtccgtatgagaaagttacgcctattttaagaaatgac 240
5S rDNA
accccaatgacgc caaagCatgtdiAo:ro::::GATCATAo::::1O:::AcrAANrACC03A'IC'CCA'lC
300
&mHI
3 60
B.
5S rDNA
A'lGA.C't3AANXA.'IGTCGAo:ro::::GATCATA~T'CCijtcctttttgtC
....
I
60
tctctctccccccttttgacttggcccgctgcgtccctcgtgtagctggggagaatcgga
120
tgtaacattttctgtagatgtccgtggatatatcat ttgcctgattccgagtcgtatgag
180
aaagttacgcctattt taagaaat gacacccgaatgacgccaaaggaatgt@'IGI'A
240
5S rDNA
TCAT~crAAA:rACC03A'ICCCA'lClGAACICCGAf\~
295
BamHI
c.
5 -a3AT..JJJ3AtX:AUAo::::1O:::AOJAAA:rACC03Ar.rrr:.PJJ:A
I
40
BamHI
GAAClXX:GAAGUU~JIOJACUA
80
Figure 2. Nucleotide sequence of 5 S rRNA genes. Two sequences, 360 bp (A) from one end and 295 bp (B) from th,e '
other end of 3.0 kb Hin cII-Eco Rl DNA fragme nt (see Fig. 1) were obtained. Nucleotide sequence of 5 S rRNA, whic~
was deduced from DNA sequences shown in A and B is presented (C). White boxes represent DNA sequences of transcribed
5 S rRNA genes. Nontranscribed spacer regions are indicated by lower case italic letters. Nucleotides are nu mbered on
the right. Restriction site of BamHI is marked. The vertical li ne followed by an arrow in B represents a 30 bp unrelated
fl anking rice DNA.
384
Mol. Cells
Rice 5 S Ribosomal RNA and Protein Genes
3.0, respectively. The HincII-3.0 fragment showed hybridization to [32pJ-Iabeled flax 5 S ribosomal DNA.
confirming that it contains the 5 S rRNA genes. The
HincIl-3 .0 fragment was then subcloned into the M13
phage vector for sequencing. Two sequences, one that
was 360 bp from one end and another that was 295
bp from the other end of the HincII-3.0 fragment., were
obtained, both of which contain more than one unit
of the 5 S rONA including nontranscribed spacer regions (Fig. 2). The 295 bp sequence contains an additional 30 bp unrelated flanking genomic DNA
Computer search against the GenBank and EMBL
databases showed that the sequence of the 5 S rRNA
coding region is over 97% identical to all published
5 S RNA genes from flowering plants. The nontranscribed spacer (NTS) region did not show any significant sequence similarity to those from other plants.
However, the NTS regions between the two repeats
shown I in Figures 2A and 2B share 92% sequence
identity'. The repeating unit of the rice 5 S rONA is
290 bp in length (Fig. 2A), thus the HincIl-3.0 fragment contains a tandem cluster of 10 highly conserved
5 S ribosomal RNA genes.
To reveal the genomic organization of the repeat
units, genomic DNA was digested with BamHI, which
cuts once in the repeats, and with EcoRI which lacks
recognition sites in the repeats shown in Figures I
and 2. The digested DNA was hybridized with labeled
0.29 kb BamHI-BamHI fragment of the pRSs plasmid
The results of various degrees of partial digestion with
BamHI shows that the 0.29 kb Bam HI-Bam HI fragment is the major repeat for 5 S rONA in rice genome
and 5 S rONA occurs in long tandem arrays (Figure
3, lanes 1-4). A complete digestion with EcoRl gave
a single band of about 12 kb in size (Figure 3, lane
5), confirming the restriction map shown in Figure
1.
Taken together, our results are well consistent with
studies of other 5 S rDNAs (Campell et al., 1992;
Goldsbrough et al., 1982; Hariharan et al., 1987). In
most eukaryotes, the 5 S rDNAs are organized as separate clusters of tandem repeats consisting of highly
conserved sequence with a variable nontranscribed
spacer.
Structural features of RL5 protein for RNA-protein
interactions
As mentioned before, the 5 S rRNAs are known
to interact with the 5 S rRNA-binding proteins in eukaryotic ribosomes. To study the RNA-protein interactions, we have previously isolated and sequenced a
rice 5 S rRNA-binding protein gene, RL5 (Kim and
Wu, 1993). In this study, the amino acid sequence
of the RL5 protein was analyzed, revealing many intriguing features that might be important for RNAprotein interactions. Because multiple protein-binding
sites appear to be present in the 5 S rRNA (Nazar
and Wildeman, 1983), repeating features of L5 proteins
that interact with the RNA were of great interest. As
Rice DNA
1
2
3
4
P
5
6
kb
~
10.0
~
5.0
~
3.0
~
2.0
1.6
...::
1.0
~
0.5
...::
0.3
~
Figure 3. Hybridization of aSS rRNA gene probe to the
gel blot of rice genomic DNA Various amounts of BamHI
(2.5 U, lane 1; 5 U, lane 2; 10 U, lane 3; 20 U, lane 4)
or EcoRl (20 U, lane 5) were used to digest rice genomic
DNA (5 IJg per each reaction) for 2 h at 37 t .The plasmid
pRSs (P) was digested with EcoRl plus BamHI (lane 6), The
resulting reaction mixtures were resolved on a 1% agarose
gel and blotted to a NYfRAN filter. The filter was prehybridized and hybridized to a random-hexamer [ 32PHabeled
290 bp BamHI-BamHI 5 S rONA as described in Materials
and Methods. Molecular weight markers are described in
kb on the right-hand side.
shown in Figure 4A. there are three short repeating
features observed in the primary structure of rice RL5
protein. One of the repeats, MAY, was previously
identified by Tong and Nazar (1991) when they compared the amino acid sequences of yeast YL3, rat L5,
and an E. coli 5 S rRNA-binding protein, ELl 8. Interestingly, we found that all three repeated sequences
of rice RL5 are repeated at intervals of 20 residues,
exactly as Tong and Nazar (1991) observed in two
repeats from YL3, rat L5, and ELl8.
The Xenopus transcription factor IlIA (TFIIIA), even
if it is not a ribosomal protein, binds to the 5 S rRNA
Ju-Kon Kim & Baek Hie Nahm
Vol. 5 (1995)
A
385
B
3 5 IRLTNQD
II I I I I
54 VRFTNKD
77 MAYS
IIIII
97 MAYC
Rice
Yeast
TFIIIA
Xena
Xenb
Chick
Rat
51
50
79
49
49
49
49
RFVVRFTNKDIT
RLVVRFTNKDII
GCDLRFTTKANM
RMIVRVTNRDII
RMIVRVTNRDII
RMIVRVTNRDI I
RMIVRVTNRDI I
160 FGALK
IIIII
180 FAGFK
Figure 4. Repeated sequence elements in rice RL5 (A) and comparison of eucaryotic 5 S rRNA-binding proteins in a
homologous region (B). A) Repeated amino acid sequences in rice RL5. The numbers indicate the relative position of
the fIrst amino acid residue of each repeated sequence with N-terminal Met residue as 1. Identical amino acids and conservative replacements are shown with short vertical lines. B) Comparison of eucaryotic 5 S rRNA-binding proteins in a homologous region. The sequences of the rice protein RL5 (rice) (Kim and Wu, 1993), the Saccharomyces cerevisiae protein YL3
(yeast) (Tang and Nazar, 1991), eucaryotic transcription factor IlIA (TFIIIA) (Ginsberg et aI., 1984), two Xenopus laevis proteins
L5a and LSb (Xena and Xenb, respectively) (Wormington, 1989), the chicken protein L5 (chick) (with accession number
p2245l in SwissProt protein sequence data base), and the rat protein L5 (rat) (Chan et aI., 1987) were aligned. The numbers
indicate the relative position of the fIrst amino acid of each sequence from N-terminal end. The homologous region of
each sequence are shown by bold letters.
transcript as well as to the 5 S rRNA gene itself for
the transcription of the gene by RNA polymerase ill
(Huber and Wool, 1986b; Shastry et al., 1984; Tso et
al., 1986). The TFIllA sequence was, therefore, compared with rice RL5 and other eukaryotic L5 homologues. As shown in Figure 4B, a homologous region
(residues 54-59 and 82-87 of rice RL5 and TFIIIA,
respectively) between TFlliA and rice RL5 amino acid
sequence has been found. The same region is also
conserved among the other 5 S rRNA-binding proteins compared (Fig. 4B). Miller et at. (1985) uncovered
an extraordinary feature of TFIIIA It has nine repeats
of a 30-residue unit called "zinc fingers" in which
pairs of cysteines and histidines tetrahedrally coordinate a zinc molecule and an extended loop of amino
acids forms a DNA-binding region. The homologous
region that we found is located within one of the repeated sequences in rice RL5 (Figs. 4A and 4B) and
in the center of the third repeat in TFIllA which is
responsible for forming DNA-binding domain.
Another interesting feature of the primary structure
of rice RL5 protein is the sharing of conserved glycine
residues with all the eucaryotic L5 homologues of rat,
chicken, Xenopus laevis, and yeast Eighteen out of 25
glycine residues in rice RL5 protein are conserved at
the: other homologues in their corresponding positions,
which are concentrated in the center of the molecules.
Alignment of a number of eucaryotic RNA-binding
proteins revealed that they bear a conserved RNAbinding domain. This domain is composed of a highly
conserved octapeptide surrounded by other conserved
amino acid residues, designated the ribonucleoprotein
consensus sequence and auxiliary domain, res~ctively
(Bandziulis et al., 1989; Query et al., 1989). Even if
the ribonucleoprotein consensus sequence is not present in rice RL5 and other eucaryotic homologues,
the glycine-rich sequences of the L5 homologues appear to be similar to the glycine-rich domains of the
abundant nucleolar pre-mRNA-binding protein, nucleolin, and of the yeast poly (A)-binding proteins
(Bandziulis et al., 1989; Query et al., 1989), suggesting
that the glycine-rich feature of L5 proteins is important for their RNA-binding activities.
Copy Number of the RL5 gene
To estimate the number of copies of the RL5 gene
in the rice (Oryza sativa Indica IR36) genome, DNA
blot hybridization analysis was perfo~d on rice high
molecular weight DNA (Fig. 5). DNA was digested
to completion with EcoRl or BamHI that do not cut
within the RL5 cDNA sequence and probed with random-primer labeled 1.0 kb EcoRl fragment of the RL5.
The probe hybridized strongly to the 6.0 kb band in
EcoRl-cut DNA (Figure 5, lane 1) and to the 4.5 kb
and 3.2 kb bands in Bam HI-cut DNA (Figure 5, lane
2), indicating that the RL5 gene is present in one to
two copies in the rice genome. The number of copies of the RL5 gene in rice is much less than expected because ribosomal protein genes in mammalian
cells are present in mUltiple copies, numbering between 7 to 20 (Monk et al., 1981; Wool et al., 1990).
They are also dispersed in the genome (D'Eustachio
386
Mol. Cells
Rice 5 S Ribosomal RNA and Protein Genes
E 8
kb
~
s
R
6.0
~4.0
~
3.0
<II(
2.0
~
1.0
Figure 6. Accumulation of RL5 transcripts in rice shoots
and roots. Total RNAs were isolated from shoots (S) and
roots (R) and the RNA gel-blot with equal amounts of RNA
was probed with the 1.0 kb RL5 cDNA as described in
Mate rials and Methods. Transcript size is approximately 1
kb.
Figure 5. Hybridization of a RL5 cDNA probe to the gel
blot of rice genomic DNA. 10 Ilg of EcoRl digest (E) or
BamHI digest (B) of rice DNA were resolved on a 1% agarose gel and blotted to a NYfRAN filter. The filter was
prehybridized and hybridized to random-hexamer [ 32 pJlabeled 1.0 kb RL5 cDNA as described in Materials and
Methods. Numbers on the right-hand side are the length,
in kb, of DNA size markers.
et al., 1981).
expressed at high levels in germinating rice seeds (data
not shown), suggesting a high level of constitutive
expression of the gene in virtually all kinds of rice
tissues. These results together with the high sequence
homology of the RL5 gene to other eukaryotic homologues, makes the RLS cDNA very useful as a constitutive control for expression studies of regulated genes
in plants.
The RL5 gene is constitutively expressed at high
References
levels
The steady-state levels of rice RL5 transcripts were
examined by RNA gel-blot analysis. The 1.0 kb RL5
cDNA was used as a probe to hybridize to equal
amounts of total RNA isolated from rice shoots and
roots. After hybridization, the membrane was washed
under such high stringency conditions that the signals
should correspond to the RL5 transcripts. As shown
in Figure 6, a single transcript of expected size (1.0
kb) was found in the samples tested, showing the accumulation of the transcripts at high levels both in
shoots and roots. In addition, the RL5 gene is also
Asemota, 0., Breda, C , Sallaud, C, EI Turk, 1., de Kozak,
I., Buffard, D., Esnaul t, R , and Kondorosi, A. (1994) Plant
Mol. BioI. 26, 120 1-1 205.
Bandziulis, R 1., Swanson, M. S., and Dreyfuss, G. (1989)
Genes & Dev. 3, 431-437.
Campell, B. R , Song, Y , Posch, T. E., C ullis, C A., and
Town, C D. (1992) Gene 112, 225-8.
Chan, Y-L., Lin, A., McNally, 1., and Wool, 1. G. (1987)
J Bioi. Chern. 262, 12879- 12888.
D'Eustachio, P., Meyu has, 0., Ruddle, F., and Perry, R F.
(1981) Cell 24, 307-31 2.
Gi nsberg, A. M., King, B. 0 ., and Roeder, R. G , (1984) Cell
Vol. 5 (1995)
Ju-Ko n Kim & Baek Hie N ahm
39, 479-489.
Goldsbrough, P. B., Ellis, T. H ., and LomonossofI, G. P.
(1982) Nucleic Acids Res. 10, 45014514.
Gouy, M., and Li, W.-H. (1990) in Ribosome: Structure, Function, and Evolution (Hill, W. E., Da hlberg, A., Garret, R.
A., Moore, P. B., Schlessinger, D ., a nd Warner, 1. R., eds)
pp. 573-578, American Society of Microbiology Publications, Washington, D. C.
H arih aran, N ., Reddy, P. S., and Padayatty, J. D. (1987) Plant
Mol. Bioi. 9, 443-451.
Huber, P. W., a nd Wool, I. G . (1984) Proc. Nat!. Acad Sci.
USA. 81, 322-326.
Huber, P. w., and Wool, I. G. (1986a) J BioI. Chern. 261,
3002-3005.
Huber, P. W., a nd Wool, I. G. (1986b) Proc. Natl. Acad Sci
USA 83, 1593-1597.
... Kim, 1.-K, and Wu, R. (1993) Plant Mol. Bioi. 23, 409-413.
Lake, 1. A. (1990) See Gouy and L~ pp. 579-588.
Miller, 1., M cLachlan, A. D., and Klug, A (1985) EMBO
J 4, 1609-1614.
Monk, R. J., M eyuhas, 0 ., and P erry, R. P . (1981) Cell 24,
301-306.
N azar, R. N., and Wildeman, A. G . (1983) Nucleic Acids Res.
11, 3155-3168.
Query, C. c., Bentley, R. c., and Keene, 1. D. (1989) Cell
387
57, 89-101 .
Sambrook, 1., Fritsch, E. F., and Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual, 2nd Ed, Cold Spring Harbor Laboratory Press, New York.
Sanger, F., Nicklen, S., and Coulson, A R. (1977) Proc. Natl.
Acad Sci. USA 74, 5463-5467.
Shastry, B. S., Honda, B. M ., and Roeder, R. C. (1984) J
BiD!. Chern. 259, 11 373-11382.
Specht, T., Walters, J., and Erdmann, V. A. (1990) Nucleic
Acids R es. 18(Suppl), 2215-2230.
Specht, T., Walters, J., and Erdmann, V. A (1991) Nucleic
Acids Res. 19(5uppl), 2189-2191.
Subramanian, A. R., Smooker, P. M ., and Giese, K (1990)
See Gouy and Li, pp. 655-663.
Tang, B., and N azar, R. N. (1991) J Bioi. Chern. 266, 61206121
Tso, 1. Y., Van Den Berg, D. 1., and Kom, L. 1. (1986) Nucleic
Acids Res. 14, 2187-2200.
Wittmann-Liebold, B., Kopke, A. K E., Arndt, E., Kromer,
W., H atakeyam a,T., and Wittmann, H.-G. (1990) See Gouy
and Li, pp. 598-616.
Wool, I. G., Endo, Y., Chan, Y.-L., and G luck, A. (1990)
See Gouy and Li, pp. 203-214
Wormington, W. M. (1989) Mol. Cell. Bio!. 9, 5281-5288.