Download POGIL3TranslKey v3

Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
Model 1: Elongation Phase of Translation
1. Label as many components of the cartoon as you can.
2. Label the 5' and 3' sides of each codon and anticodon.
3. a. How many nucleotides are there in a codon? 3 In an anticodon? 3
b. Do codons overlap? no
c. Which molecule contains codons? mRNA Which contains anticodons? tRNA
d. How many amino acids does each tRNA carry? 1
4. The following statements are partially correct. Write a better statement for each one that is
completely correct and describes the process more accurately.
a) The codons bind to anticodons and then the anticodon makes a protein.
Codons form hydrogen bonds with the anticodons of tRNA molecules. Then the ribosome catalyzes
the formation of peptide bonds between the amino acids being carried by the tRNAs.
b) If the anticodon is attached to the wrong amino acid, then the ribosome will still use the anticodon but
no protein will be formed.
If the tRNA that has a certain anticodon is attached to the wrong amino acid, the ribosome will have
no way of knowing this. It will simply attach that amino acid to the growing protein.
5. Translation ALWAYS begins with a tRNA carrying the amino acid Met.
a. What is the sequence of the "Start Codon"? Label with 5' and 3'.
5'AUG3'
b. In which direction must the ribosome move ("translocate") along the mRNA? 5' 3'
(From 5' to 3' or from 3' to 5'?). How did you decide this?
1
Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
Model 2: Initiation Phase of Translation
The ribosome is made up of both protein and RNA. A small ribosomal RNA is positioned in
the small subunit that will bind to a part of the mRNA.
6. Label as many components of the cartoon as you can.
7. a. Circle the ribosome binding site (RBS) in the mRNA.
b. Is the RBS closer to the 5' or 3' end of the mRNA? 5'
c. Which are more prevalent in the Ribosome Binding Site, pyrimidines or purines? purines
d. What types of bonds hold the mRNA and small ribosomal subunit together? hydrogen bonds
e. What other molecules (in this figure) are
held together with these same types of bonds? the mRNA and the tRNAs (H-bonds of base
pairs)
8. a. Does the first tRNA bind before or after the ribosome is complete? before
b. Translation ALWAYS begins with a tRNA carrying the amino
acid Met. What is the name of the sequence that that first tRNA binds to? start codon
9. a. How many nucleotides are there between...
... the RBS and the start codon? 4
... the 5' end of the mRNA's and the start codon? 14
b. Are either of your answers in "a" multiples of 3? no!!!
c. Using what you know from 9a and 9b, what establishes the "frame" of triplet codons for
translation?
the start codon "sets the frame"
10. In the mRNA sequence below, circle and label the most likely RBS and the start codon. Note: Like
many nucleotide sequences, the RBS can vary between species
5' UCUUAAGAAGGAUCUGUAAUGUCUGUAUGUCUGUAGUGUAUGUCUUGUAUCG 3'
2
Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
Model 3: Termination Phase of Translation
"release
factor"
11. Label as many components of the cartoon as you can.
12. List two things that are different between the release factor and a tRNA:
release factor does not have an amino acid attached, it doesn't have an anticodon, not a nucleic acid
13. List two things that happen after release factor binds to the ribosome:
i. the new protein is separated from the last tRNA
ii. the two ribosomal subunits separate and the tRNAs, the mRNA and the release factor dissociate
14. What is the sequence of the codon that indicates the end of this protein? 5' UAG 3'
(This is called a "stop codon".)
15. Is release factor an enzyme? Yes What is your reasoning for your answer?
After release factor binds, the covalent bond between the new protein and the last tRNA is
hydrolyzed. A catalyst is needed to break a covalent bond, and release factor is a protein, therefore
it is an enzyme.
16. What would happen if there were a tRNA in the cell that could base pair with a stop codon?
Then it would compete with release factor proteins for binding to stop codons, meaning that
translation would not always stop at a stop codon, and those proteins would be longer.
17. The release factor binds to the A-site of the ribosome (the one on the right) relatively weakly
compared to the correct tRNA. Why is this weak binding a good thing for correct translation of
proteins?
Release factor is forming hydrogen bonds with the specific bases of the stop codons. If it was able to
bind more strongly, or bind non-stop codons… then it would possibly terminate translation too
often, resulting in shorter proteins.
3
Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
Integration Questions
Learning goal: synthesize information from all three phases
of translation with your new group
General questions for all group members
1. What is the purpose of translation?
To synthesize proteins using an mRNA template
2. Orient yourself to the schematic on the right. Identify the
following: f-Met, tRNA, mRNA, ribosome and anticodon.
3. In the chart below, fill in the function of each of the components
and whether they are necessary for the different stages of translation
Component
Function
mRNA
Template for synthesis,
binds ribosome and tRNAs
Binds to start codon
f-Met tRNA
ribosome
release
factor
anticodon
"Platform" and catalyst for
translation
Binds stop codons and
catalyzes hydrolysis of
protein from last tRNA
Part of a tRNA that binds to
the codon in an mRNA
Necessary for
initiation?
Yes
Necessary for
elongation?
Yes
Necessary for
termination?
Yes
Yes
No
Yes
No (except for
the first
peptide bond)
Yes
No
No
Yes
Yes
Yes
No (except for
the tRNA
holding the
peptide in the
P-site
Yes
-----------------------------------------------------------------------------------------------------------------------------Initiation Integration Questions: Initiation Expert helps other group members answer the following
questions.
1. Imagine you replace four purines with pyrimidines in a ribosome binding site.
Which of the following statements would be true?
F
The rate of formation of peptide bonds will decrease
T
The affinity of the small ribosomal subunit for ribosome binding site will decrease
T
The rate of initiation will decrease
F
The affinity of large ribosome subunit for small ribosome subunit will decrease
2. What establishes the reading frame? (circle the correct answer)
A. The ribosome binding site
B. The start codon
C. The 5’ end of the mRNA
D. The distance between the ribosome binding site and the start codon
3. What is the next codon that will be read by the ribosome in the schematic above? 5' GAA 3'
4
Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
4. Stop and reflect. All group members should now be able to explain 1) how the reading frame is
established, 2) the purpose of the ribosome binding site and 3) the triplet nature of codons.
5
Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
Elongation Integration Questions: Elongation Expert helps other group members
answer the following questions
1. A covalent bond between which two molecules keeps the growing protein chain attached to the
ribosome? a tRNA and the last amino acid of the growing protein
2. Which direction will the ribosome move in the model shown above? to the right
3. What is the function of the tRNA?
The tRNA binds to a codon and carries the corresponding amino acid.
4. What would happen if all the tRNAs in a cell with anticodons for lysine carried glycine amino acids
instead of lysine amino acids? Circle the correct answer.
A. Translation would still occur but the protein product would contain glycines in place of lysines
B. Translation would stop at the first lysine codon
C. Translation would still occur but there would be no lysines or glycines in the protein
D. Translation would still occur but the protein product would contain lysines in place of glycines
5. Stop and reflect. All group members should now be able to explain 1) the relationship between
codons and anticodons, 2) how the structure of a tRNA impacts its function and 3) why the ribosome
moves in a 5’ to 3’ direction.
-----------------------------------------------------------------------------------------------------------------------------Termination Integration Questions: Termination Expert helps other group
members answer the following questions
1. Identify the release factor in the model to the right
2. Compare and contrast a release factor to a tRNA: How are they different?
How are they similar?
Different: Release factor doesn't carry and amino acid, it is made of protein,
and does not have an anticodon (it cannot "base pair" with the mRNA)
Similar: The overall shape of a tRNA and release factor is similar so they both
bind in the tRNA binding site of the ribosome, they both bind to codons.
3. What has to happen for the growing protein to be released from the ribosome?
(Hint: look back at Elongation Integration Question 1)
The bond between the last amino acid and the tRNA has to be broken.
4. How does the structure of the release factor impact its function?
The shape is important for fitting in the tRNA binding pocket, and the "bottom" part must form
hydrogen bonds with the bases in stop codons so that it will stay long enough to hydrolyze the
bond.
5. Stop and reflect. All group members should now be able to explain 1) the role of a release factor
during termination and 2) how the structure of the release factor impacts its function.
------------------------------------------------------------------------------------------------------------------------------
6
Bio200 Cell Biology Activity – Translation ********KEY********
Autumn 2014
On your own questions for practice:
The reaction catalyzed by the ribosome is
shown to the right.
amino acid
1. Label an arrow pointing to...
... an "Amino-acyl tRNA"
... the "Peptidyl tRNA"
... the "Empty tRNA"
tRNA with the
nucleotide at one end
shown much larger
than the rest of the
molecule
2. Which end of the tRNA is attached to
the amino acid, 5' or 3'?
3'
3. a. In the top half of the model...
... circle the two atoms that will be
by a new bond.
connected
... draw a slash through the bond that will
broken.
be
b. In the bottom half of the model, circle
the newly formed bond.
N
2. The drawing to the right shows a short protein of 8
amino acids that is complete, but is still in the ribosome.
a. Label the amino terminus and the soon-to-be-carboxyl terminus
of the protein.
b. Circle the bond that needs to be broken before the protein
can be used.
c. What molecule catalyzes the reaction in "b"? _________________
d. Draw a square around a peptide bond.
C
7
Bio200 Cell Biology Activity – Translation
3. This is the sequence of a complete mRNA from a bacterial cell:
Summer 2014
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label
the amino (N) and carboxyl (C) termini of the protein.
N-Met-Lys-Phe-Met-Gly-Arg-Val-C
b. How many tRNAs will bind to the ribosome to make this protein? 7
c. Which of the following sequences within the mRNA most likely contains the ribosome
binding site? (Circle ONE)
5'AAGGAGGC3'
4. For each different mutant cell described
below, assume that ONE specific molecule
or part of a molecule is mutated in that cell
so that the molecule’s function has
changed. Name as many molecules that
could result in the description (but
remember that for the mutant phenotype,
you are considering each mutation by
itself).
Cell 1: In many different types of proteins,
there is the amino acid Thr (threonine)
where an Ala (alanine) should be.
The amino-acyl tRNA synthetase that
normally binds alanine now binds
threonine instead
Cell 2: Many different types of proteins
are much shorter than in a normal cell, but
have the correct sequence up to that point.
tRNA levels are normal in the cell.
release factor
Cell 3: About a third of all new proteins in a mutated cell are not doing their jobs correctly. When you
compared to proteins in a healthy cell, these proteins appear much larger overall.
Some tRNA has changed it’s anticodon to recognize one of the three STOP codons, so this is
erroneously allowing elongation to continue in proteins that normally use that STOP codon.
8