* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Nucleotide sequences from tomato leaf curl viruses from different
Survey
Document related concepts
Bisulfite sequencing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Adeno-associated virus wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Human genome wikipedia , lookup
DNA vaccination wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Microevolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microsatellite wikipedia , lookup
Metagenomics wikipedia , lookup
Point mutation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Transcript
Journal of General Virology (1995), 76, 2043 2049. Printed in Great Britain 2043 Nucleotide sequences from tomato leaf curl viruses from different countries: evidence for three geographically separate branches in evolution of the coat protein of whitefly-transmitted geminiviruses Y. G. Hongl~ " and B. D. Harrison z* 1 Scottish Crop Research Institute, bTvergowrie, Dundee D D 2 5 D A and 2 Department o f Biological Sciences, University o f Dundee, Dundee DD1 4 H N , U K The coat protein (CP) gene-containing circular DNA molecule of an isolate of tomato leaf curl geminivirns (ITmLCV; 2749 nt) obtained from southern India, and the CP genes of tomato yellow leaf curl geminivirus isolates from Nigeria and two regions of Saudi Arabia were sequenced. ITmLCV DNA had the same arrangement o f ORFs, and the same pattern of repeats in the large intergenic region as is found in DNA-A of other whitefly-transmitted geminiviruses (WTGs) from the Old World. However, the sequence of ITmLCV DNA and the sequences of its predicted translation products differed substantially from those of other WTGs, including one isolate obtained from a tomato plant in northern India. Comparison of the four CP sequences deduced here with those of 18 WTGs previously studied indicated that their relationships can be represented by a tree with three branches that are unrelated to plant host species but which contain viruses from the Americas, Africa to the Middle East, and Asia to Australia, respectively. It is suggested that WTG CP evolution has proceeded along different paths in these three main regions, and that WTGs have adapted freely to new hosts in each region. Indeed, the virus isolates causing similar diseases of tomato plants in the different continents are, with few exceptions, not closely related and warrant recognition as separate species. Introduction appear to have only one, which closely resembles DNA-A. Moreover, the nucleotide sequences of the different isolates, although related, are no more similar to one another than to the sequences of WTGs from other plant species. Evidence of antigenic differences, which parallel these genomic differences, was provided by the results of tests in which extracts of naturally infected tomato leaves from many countries were allowed to react with panels of MAbs raised against the particles of two other WTGs, African cassava mosaic and Indian cassava mosaic viruses. The WTGs from tomato plants in different geographical regions proved to have consistently different epitope profiles, whereas those from the same region had similar profiles (Harrison et al., 1991; Muniyappa et al., 1991; Macintosh et al., 1992). To obtain further information on genomic and antigenic differences among tomato-infecting WTGs, we have determined the nucleotide sequences of a DNA molecule (equivalent to DNA-A of other WTGs) of a tomato leaf curl virus isolate from southern India (ITmLCV; Muniyappa et al., 1991) and of the coat protein (CP) genes of tomato yellow leaf curl virus isolates from Nigeria and two regions of Saudi Arabia. Comparison of the nucleotide sequence of DNA-A of ITmLCV with the equivalent sequence of a virus isolate from northern Diseases described as tomato leaf curl and tomato yellow leaf curl occur in many parts of the tropics and subtropics, ranging from Central America to the Mediterranean region, Africa, Asia and Australia. They are important causes of loss in yield of tomato crops (Cohen & Harpaz, 1964; Makkouk & Laterrot, 1983; Saikia & Muniyappa, 1989) and have become increasingly prevalent in recent years. The diseases are caused by whitefly-transmitted geminiviruses (WTGs) but the genomes of different virus isolates differ in complexity and nucleotide sequence. Virus isolates from Thailand (Rochester et al., 1994) and northern India (Padidam et al., 1995a) have genomes consisting of two molecules of circular ssDNA (DNA-A and DNA-B), whereas isolates from Israel (Navot et al., 1991), Sardinia (Kheyr-Pour et al., 1992) and Australia (Dry et al., 1993) * Author for correspondence. Fax +44 1382 562426. e-mail [email protected] ~ Present address: Department of Virus Research, John Innes Centre, ColneyLane, NorwichNR4 7UH, UK. The nucleotide sequence data presented in this paper have been submitted to the EMBL database under accessionnumber Z48182. 0001-3203 © 1995 SGM Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36 2044 Y. G. Hong and B. D. Harrison India shows that there are many differences between the two isolates, although the deduced amino acid sequences of their CPs are similar. Comparison of the four new CP sequences with other published sequences identifies a consistent pattern of geographical variation among WTGs from tomato plants. Methods Virus isolates. Four virus isolates were studied. ITmLCV was originally obtained from a leaf curl-affected tomato plant from Bangalore, southern India; it was transmitted initially by a single whitefly (Bemisia tabaci) and subsequently was cultured in graftinoculated tomato plants (Muniyappa et al., 1991). The other three isolates were obtained from yellow leaf curl-affected tomato plants growing at Ibadan, Nigeria (TYLCV-NIG), A1 Soudieri, central Saudi Arabia (TYLCV-NSA) and Najran, southern Saudi Arabia (TYLCVSSA) (I. A1-Shahwan, B. D. Harrison & P. F. McGrath, unpublished), and were cultured in graft-inoculated tomato cv. Moneymaker plants. All inoculated plants were kept in containment conditions under licence from the Scottish Office Agriculture and Fisheries Department. D N A extraction and P C R . Total DNA was extracted as described by Hong et al. (1993) from young leaves of tomato plants that had recently developed systemic symptoms. Viral CP genes were obtained by PCR using degenerate primers P1 and P2, and these genes were then cloned in pUC19, as previously described (Hong et al., 1993). Full-length DNA-A of ITmLCV was amplified by PCR using total DNA from infected leaf tissue as the template, and the following two primers based on sequences in the CP gene. In primer Pa [5' d(cgggatcc ACAGCCTCTAGGAACATCAG) Y], the upper-case letters represent nucleotides complementary to residues 504-485 in the viral sequence, and in primer Pb [5' d(cgggatcc GAGGGTCCATGTAAGGTCC) 3'] they represent residues 505 523. The lower-case octanucleotides in each primer contain a B a m H I site. Reaction mixtures (100 lal) contained 1 5 lag total DNA, 75 pmol each of Pa and Pb, 100 laM of each dNTP, 2.5 mM-MgC12, 50 mM-KC1, 0.1 rag/m1 gelatin, 10 mM-Tri~HCI (pH 8.0) and 2.5 units of Taq DNA polymerase (Cambio). The reaction mixture was overlaid with 50 lal of light oil. PCR was initiated with one cycle at 94 °C for 2 min, 52 °C for 1.5 min, 72 °C for 3 min, followed by five cycles at 94 °C for 30 s, 55 °C for 1 min, 72 °C for 3 min, then by 30 cycles at 94 °C for 30 s, 58 °C for 1 rain, 72 °C for 3 min, and finally by one cycle at 72 °C for 5 min, in a Cambio Intelligent Heating Block. After electrophoresis of the PCR products in a 1-0 % LMP agarose (Gibco BRL) gel, the required fragment was recovered and cloned into the B a m H I site of pUCI9. Sequence analysis. Nucleotide sequences were determined by the dideoxynucleotide chain termination method (Sanger et al., 1977) in both directions using plasmid DNA templates and the Klenow fragment of Escherichia coli DNA polymerase I (Pharmacia) or Sequenase Version 2.0 (United States Biochemical) with 7-deazadGTP in the sequencing reaction. Sequences were assembled and analysed using UWGCG software (Devereux et al., 1984). Other WTG sequences used in the comparisons were those of abutilon mosaic virus (AbMV; Frischmuth et al., 1990), African cassava mosaic virus from Kenya (ACMV-K; Stanley & Gay, 1983), Nigeria (ACMV-N; Morris et al., 1990) and Ghana (ACMV-G; Y. G. Hong & B. D. Harrison, unpublished), bean dwarf mosaic virus (BDMV; Hidayat et al., 1993), bean golden mosaic virus (BGMV; Howarth et al., 1985), East African cassava mosaic virus (EACMV; Hong et al., 1993), Indian cassava mosaic virus (ICMV; Hong et al., 1993), potato yellow mosaic virus (PYMV; Coutts et al., 1991), squash leaf curl virus (SqLCV-E; Lazarowitz & Lazdins, 1991), tomato golden mosaic virus (TGMV; Hamilton et al., 1984), tomato mottle virus (TMoV; Abouzid et al., 1992), tomato leaf curl virus from Australia (TLCV-A; Dry et al., 1993) and northern India (TLCV-IN; Padidam et al., 1995a), tomato yellow leaf curl virus from Israel (TYLCV-ISR; Navot et al., 1991), Sardinia (TYLCV-SAR; Kheyr-Pour et al., 1992) and Thailand (TYLCV-THI; Rochester et al., 1994), and tomato geminivirus from Mexico (TGVMX; R. L. Gilbertson, personal communication). A ca. 2.7 kb product was amplified from samples containing ITmLCV DNA by using the abutting primers Pa and Pb. Two subfragments produced by treatment with B a m H I were cloned in pUC19, and the whole 2749 nt molecule (27.2% A, 19.9% C, 22.4% G and 30.5% T) was sequenced in both orientations from these two contiguous clones. Sequences at the junctions between the two fragments were confirmed by sequencing the CP gene (see below) and a fragment produced by the PCR that spanned nucleotides 125 1245. Results and Discussion Sequences of I T m L C V The complete ITmLCV sequence forms a circular molecule containing, as in other Old World WTGs such as ACMV, ICMV and TYLCV-ISR, two ORFs in the virus sense and four in the complementary sense (Fig. 1). In accord with evidence indicating the site of the nick made during replication of the DNA of other WTGs (Stanley, 1995), nucleotide number 1 was assigned to the A underlined in the sequence TAATATTAC, which also occurs in the intergenic region of all other geminiviruses (Fig. 1). Comparison of sequences of the large intergenic regions of five WTGs from tomato showed that ITmLCV 2749/1 2000 A ~ O0 Fig. I Arrangement of O R E s (VI, nt 301-107] ; V2, nt ]41488; CI, nt 2608 1526; C2, nt 1623 1219; C3, nt 1478-1074; C4, nt 245]-2]58) in the 2749 nt long D N A of ITmLCV. V] encodes the CP. Potential promoter sequences (V) and polyadeny]ation signals (V) are shown inside the circle for virus-sense genes and outside the circle for complementary-sense genes. IR, intergenic region. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36 Tomato geminivirus CP relationships ITmLCV TLCV-IN 1 50 ............ TTTGAATC GGTGGACACT CTAATTCTCT GTATATCGGT IIIII II I1 I I I II III A A A A C T T G T C G T T T T G A T T C GGCGTCCCTC ~.CTTATCTA TATGATTGGT 51 GGAA.TGGTG II I I I T T T T G C T G T C G T T C T G A A T C GGGGGACACT CA~'~GTATCC II ill II I I I ..... T G C G T T T T A G C A A T T GGTGTCTCTC ~..CTTGGT~ I I Ill IIIIII I I I II II ....... GTT G A A A T G A A T C GGTGTCCCTC ~'~.AGC"I~TAT I 1111 TYLCV-SAR TLCV-A TYLCV-ISR ITmLCV III ill AAGTTCCAGT III TYLCV-SAR III ilJll TATTTTTTAA I I il GGAATTGGGG GGCAATATAT I 1 I I TTCATAAATG TTCATTTCAA TTCAAAATTC AAAATTCAAA ITmLCV 201 CTATCATGGT CC ........ CCTCCACTAA TLCV-IN TAGGTGGGCC TYLCV-SAR AGAAGTGGGT CC ........ I I II II I i CCCCCCACGT [ I TLCV-A AAAGTGGTCC TYLCV-ISR TATGTGGTCC CCACGAGGGT TACACAGATG ITmLCV 301 CGCCAAGTTT TACCATTAAA 324 TAAA TLCV-IN CACCAAGTTT I llilill It I 1 1111ILl1 CCCTAAGTTT TLCV-A CCCTAAGTAT TYLCV-ISR CCCCAAGTTT llil ] I il CCAATGAAAT I l]lll I .ACCTGTCGA CGAATGAGAA II]I CTCAAGCGGC II I TAGTTGGACA Ill II IIIIII IIIIIll CTAAATGGCA TAGATGTAAT I I IIIIII CCGTATGGCA tl Illll tlllt TTTTGGTAAT lllllllll IIIIIIIII Illlllllll CATTCGTATA ATATTACCGA ATGGCCGCGC III Illllllll IIIIIIllll CATCCGTATA ATATTACCGG ATGGCCGCGC illllll iillilltll llIllllll ATATTACCGG ATGGCCGCG .... AAAAAAT IIIIII II CATCCGTCTA IIIIIII I TCCCCGATAA I i iiiiiiii11 llIlillIi CATCCGTATA ATATTACCGG ATGGCCGCGC CTTTTCCTTT 251 GTCACGCTGA AAGCTTAATT ATTTATTTTT GTCCT.TATA 300 TAAACTTAGT i TCACGCTACA Ii il il II I ...AAATTTT TTAAAGCGGC LI It I I TGGCCTATTT II II I AGTGCGTGGG i I II TGCAGCCTCA AAGCTTAAAT AACT.GTTCA II III illil t I II CCGCGCGTCA TCGCTTATTT A.AGTTTT.. I I III CCAATCAAAT TGCATTCTCA i I III TTATTGTCAA I III I I 111 AACGTTAGAT II A.AGTGTTCA I I I t II 11 IIII I TAGACTTGCT I I l II I I I l l l l GCTGT.GTTA TAAACTTGCT GATCAATAAA II I[ illll TTGTCGTATA TATACTTGGG II IIIIIIIII TATACTTGGT I II TTTGTCTTTA II I TYLCV-SAR III II GGATCCACAA 1 I JJlJlJ ll[llil[ GATTGATGTG Ililtll Ill GTAAAGCGGC I I II[IIIIIII TTTCTGTCGA IIIII I llillll f lillill AATCAAATCA 250 CCAATCATAT II i IIIII I [I TCAA CCAATGAAAT II i IIIIII I llllill ATCATTTCCA C ......................... II CTAAAGCGGC 1 ATGATGCCCC I GTCTTATTTA IIIII1111 ATTCAAATCC [ IIIIIIII TACGCAGTAG II III GTC..T.GGG i[ TTTTTTTTTG II TYLCV-ISR i IIIIII 200 CTTTCTGTCA CTCA ......... AAAGTAA ATAATTCAAA il I ATGGCCGCGC TCGGAGAATT I 1 IIIIIIit TTATTGTAAT [ Illlll ATATTACCGG TLCV-A 1 I CATCCGTATA i i IIIIII t I 151 AAATTGCGGC GTAATAAATT III III CCATATGGCA I 150 CA . . . . . . . . . A T A T C C C G G II ill II AGGTAAGACA ATTTGGTAAT TTCAAATTCC III I IIIIII CCTAATGGCT I I I I I TAATTGTAAT TACTTGGACA AAAGAAA ATTACTTTAA II Illlll TCCTATATAT I CCAAATGGCA GTCTTACTTA [ I I ACCCTGTCCA GTA..TCGGT TTTGA .................. TATTCAAA ............ I GTC..TGGAG I TLCV-IN I00 GACAATATAT IIIII AGC~TTG~ I III II ATG~TCC-GT IIIIIII GGCAATC~T II i01 TACCATTA ............ I 2045 AAAAAATATA I q CAAA II TTAGGCCCAT l il AC.. I i i TTTGTCTTGC AAA. iP AAT. Fig. 2. Comparisonof the sequences of the intergenic regions of fiveWTGs derived from tomato. Dots represent spaces inserted to improvethe match. The sixth nucleotide in the ITmLCV sequence is residue 2614 in the complete sequence. differed not only from TYLCV-ISR, T Y L C V - S A R and TLCV-A (61%, 65% and 53 % identity, respectively), but also from T L C V - I N (60 % ; Fig. 2). However, despite these differences, the 34 nucleotide sequence G C G G C C A T c C G T a T A A T A T T A C C G G A T G G C C G C G , which can form the well-known stem-loop structure, was the same in all five viruses except that the lower case ' c ' is T in T L C V - I N and the ' a ' is C in TLCV-A. This sequence, or only slightly different versions of it, also occur in other WTGs, such as ICMV, E A C M V and ACMV, which are obtained from hosts other than tomato. Like those of other W T G s (Argfiello-Astorga et al., 1994), the large intergenic region of I T m L C V contains short nucleotide sequence repeats. The sequence A T C G G T G G A at nucleotides 2614-2622 is repeated at nucleotides 2641-2649, and the overlapping sequence G G T G G A C A (2617-2624) also occurs at nucleotides 2652-2659 and in the complementary sense at nucleotides 2670-2677. This arrangement of iterations is similar to that found in other W T G s from the Old World; most of the sequence that is repeated also occurs in TYLCV-ISR, T L C V - A and a Brazilian form of B G M V (ArgfielloAstorga et al., 1994). The comparable repeats in TYLCVSAR and T L C V - I N differ to a greater extent from those in ITmLCV. Analysis of the intergenic region of I T m L C V therefore suggests that the virus is distinct from T L C V - I N and also from the other W T G s obtained from tomato plants. Comparison of the deduced amino Table 1. Percentage amino acid sequence identity of putative products of open reading frames of 11 WTGs compared with ITmLCV Open reading frame Virus V1 V2 C1 C2 C3 C4 TYLCV-ISR TYLCV-SAR TLCV-A TLCV-IN ICMV ACMV-K AbMV BGMV PYMV SqLCV-E TGMV 74 69 74 86 87 71 76 72 74 73 75 69 64 59 61 69 62 78 74 80 77 74 73 62 63 69 56 67 67 62 63 58 62 66 50 54 53 49 50 68 61 63 64 67 64 53 50 54 48 53 72 48 52 58 51 31 55 53 23 54 13 - - acid sequences of the gene products of I T m L C V and 11 other W T G s provides further support for this proposition (Table 1). The products of O R F s C2, C3 and C4 are most similar to those of T Y L C V - I S R whereas the CI product is most like that of T L C V - A ; the V1 product (CP) is most like that of I C M V and the V2 product is similar to the same extent to those o f I C M V and TYLCV-ISR. With the possible exception of CP, the gene products of I T m L C V differ from those of other W T G s to about the same extent that other WTGs differ from one another. However, the C1, C2 and C3 products Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36 2046 Y. G. Hong and B. D. Harrison 1 TYLCV-NSA 50 MSKRPGDIII STPVSKVRRR LNFDSP__YSSR~VAPIVPGIN TYLCV-ISR ............................... TYLCV-NIG TYLCV-SAR ........................... .P..T.,.L .................. TYLCV-SSA .................................... TLCV-IN ITmLCV TLCV-A TYLCV-THI .A...A ....... AV...Q.T A.M.. .G .... Y..L A..V .... A ..... K ..... A..L ........... A .... V.T.R..S T.. ,A..T.Q.,* A ............. ..... ..... KRRSWTYRPM Q.T .......... .......... ........... GA. ..V..ARVT* .AKA..N... .SSI .... K. ...N..FK.A .AVR..R.T* .AV,T.RVT* .GKE.AN.,. R..T.VN... .AV.T,RVT* .GQV.KN..A .................. N.. 51 i00 TYLCV-NSA TYLCV-ISR TYLCV-NIG YRKPRIYRMY ........... ..... M...F RSPDVPRGCE GPCKVQSYEQ RDDIKHTGIV R ............................. .T..I .................. V..V... TYLCV-SAR TYLCV-SSA TLCV-IN ..... M .......... P ................ ........... T ............... FDK N .... M ..................... F.S V .... V. .H.L .... E. .H.VS.I.K. LC ....... MC ....... N T ITmLCV TLCV-A TYLCV-THI N...MF...F .G ............... .... MM, .LF ..................... ....... M ........ K .......... .H,.I.I.K. H. VA. V. K. KN..G.M.K. MCI ...... LC ....... ICLY ..... T T I TYLCV-NSA TYLCV-ISR GITHRVGKRF CVKSIYFLGK VWMDENIKKQ ~HTNQVMFFL .................................................. TYLCV-NIG TYLCV-SAR TYLCV-SSA SL ......... ........... .L ......... I .... I ................. I .... I... I .......... I .... IV .......... VK N ............. ISI .............. .... TC..W ....... .L ............ .L ............ ..... T ..... V.V... V.V,.. I .... V... I ....... TK I ....... TK I...D...TR .... S ........... T.*. .... S ........ ...VD*K .... T ........ ..... *T I ....... .... T.L.WI F.S FDA RRVSDVTRGS C ........ °C.°°,,,°, .C°°°...o° i01 TLCV-IN ITmLCV TLCV-A TYLCV-THI 150 .L ............ L..V.. VK VRDRRPYGNS *. T. VT*T .... G.T.*T 200 151 TYLCV-NSA TYLCV-ISR TYLCV-NIG TYLCV-SAR TYLCV-SSA TLCV-IN ITmLCV TLCV-A TYLCV-THI TYLCV-NSA TYLCV-ISR TYLCV-NIG TYLCV-SAR TYLCV-SSA TLCV-IN ~MD[GQ~__N.NM FDNEPSTATV KNDLRDRFQVMRKFHATVIG .................................................. .S .... I ............ I N ...... Y.. L...S .......... .YG..EL... .Q...E .Q...D ................ ................ .K ........ .Y..Q .... V Y ............ Y ............ 201 VKRFFRVNSH VTY**NHQEA ..E.VK..NY IN..YKIYN. IRK.Y...NY TYLCV-NSA TYLCV-ISR 251 260 RIYFYDSIS~ .......... TYLCV-NIG TYLCV-SAR TYLCV-SSA ...... AVT. ...... AVT. .V ........ TLCV-A TYLCV-THI ......... ....... ....... AT. VT. ........ Q. .S ..... VT. C ..... Y .......... V ......... C. C.. LKR.T..PEC .QYAS...CV MH...Y.. MH...Y.. M..G... Q ...... AKYENHTENA L..W L..W .... T. .... T. .TYAS .QYAS ..... ..... IK.WS...T. I.R.Q...T. .QYAS .QYAA .... I .... I LLLYMACTHA 250 SNPVYATMKI ..... KI ..... LFIFI ................................. ..... K..N. .V.**..HDE ...A ....................... L .... KI.T. .V.** .... Q ........................... IR..YKIYN. IV.** .... Q G .......................... .RK.V...NY .V.**.Q.., G .......... M ............... ITmLCV TLCV-A TYLCV-THI TLCV-IN ITmLCV LI*MT ............ Y ........ I ....... ~PSGMKEQAL .V.**,Q... G .......... M ............... C..** ................................ .V.** ..... G .......................... L.. L.. L.. L.. L.. L.. L.V Fig, 3. Comparison of the amino acid sequences of the CPs of nine WTGs derived from tomato. Differences from TYLCV-NSA are indicated and conserved residues are underlined; an asterisk indicates that the residue is absent. Virus acronyms are given in the text. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36 Tomato geminivirus CP relationships ~ -- PYMV -- TGV-MX BDMV TMoV AbMV I SqLCV-E - - TGMV BGMV ~ ACMV-G ACMV-N ACMV-K EACMV TYLCV-SAR TYLCV-ISR I TYLCV-NSA TYLCV-NIG 2047 substitutions found, many occur between residues with similar properties, such as V/I and R/K, and most are clustered in specific parts of the sequence, notably residues 2847, 78-93, 129-130, 147-157 and 174-221. In addition, TYLCV-SAR lacks residue 163, and TYLCVISR has two residues (FI) inserted at positions 214-215. Other regions, notably residues 222-256 in Fig. 3, are strongly conserved. Comparisons of pairs of sequences show that those of TYLCV-NSA and TYLCV-ISR are 96% identical, suggesting that these two isolates are strains of the same virus. In contrast, the CP of TYLCV-SSA is distinct from that of TYLCV-NSA and of the other isolates from Mediterranean countries or West Africa (75-78 % identity), and slightly more like those of the two Indian isolates, which are even more similar (86%) to one another. TYLCV-NIG CP is most similar to those of TYLCV-ISR and TYLCV-NSA (84-86 %). TLCV-A CP does not closely resemble CP of any other isolate but is most similar to the proteins of the Indian and Thailand isolates (74-77%), whereas TYLCV-SAR CP most closely resembles the CPs of TYLCV-ISR and TYLCVNSA (84-85 %). ICMV [-~ TLCV-IN Geographical variation in geminivirus coat proteins ffmLCV The similarities and differences among these tomato WTGs are put in perspective by including in the analysis the CPs of 13 other WTGs from a variety of hosts. It can then be seen that sequence divergence is independent of the natural host of each virus (Fig. 4). Thus on the basis of their CPs, WTGs from tomato in the New World resemble WTGs from other hosts in New World countries more closely than they resemble Old World WTGs from tomato. Comparable similarities in epitope profiles of the particles of WTGs from the Americas, and differences between these and Old World WTGs, were found by Swanson et al. (1992). Indeed, inspection of Fig. 4 shows that the relationships among the CPs reflect the geographical sources of the viruses. The dendrogram has three main branches, representing viruses from the Americas, Africa/Mediterranean region/Middle East and Asia/Australia, respectively. The CPs of WTGs from different geographical regions typically have 67-79 % sequence identity, whereas the values for WTGs from the same region range from 80-97 % mostly. This pattern of geographically associated variation in WTG CP is suggestive of (i) an effect of spatial isolation, coupled with non-adaptive genetic drift and/or adaptive change in response to regionally specific selection pressures, and (ii) an ability of the virus lineage in a specific region to adapt to different hosts. Evidence for a difference associated with spatial isolation is provided by comparison of TYLCV-NSA and TYLCV-SSA, the TYLCV-THI TLCV-A TYLCV-SSA Fig. 4. A dendrogram produced by using the UWGCG program PILEUP, showingrelationshipsamongthe CPs of 22 WTGs.The three main branches contain the proteins of viruses from the Americas (upper branch), Africa/Mediterraneanregion/Middle East (middle branch) and Asia/Australia(lowerbranch). Virus acronymsare given in the text. of ITmLCV are more like those of Old World than New World WTGs. We have no information on the possible existence of DNA-B in ITmLCV or on the infectivity of the molecule we have sequenced. Coat proteins of tomato geminiviruses To obtain a more complete picture of the relationships among tomato WTGs from different parts of the world, nucleotide sequences were determined for the CP genes of TYLCV-NIG, TYLCV-NSA and TYLCV-SSA, and the deduced amino acid sequences were compared with those of ITmLCV, TLCV-A, TLCV-IN, TYLCV-THI, TYLCV-ISR and TYLCV-SAR (Fig. 3). The proteins all consist of 256-260 residues, about 45 % of which are identical in all nine sequences. Of the amino acid Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36 2048 Y. G. Hong and B. D. Harrison Saudi Arabian sources of which are separated by a large expanse of desert. Where no such barrier exists, as in India, the CPs of ITmLCV and TLCV-IN are considerably more alike. Evidence that a geographically related selection pressure operating on CP structure may be exerted by vector whiteflies comes from three findings : the key role of geminivirus CP specificity in effecting transmission by insect vectors (Briddon et al., 1990), the occurrence of different biotypes of B. tabaci in different countries (Costa & Brown, 1991), and the greater frequency of transmission of a WTG by a sympatric than by an allopatric biotype (McGrath & Harrison, 1995). The association of different WTGs with similar diseases of the same plant species in different countries, and the possibility that WTGs can adapt more readily than other plant viruses to different host species, raises the questions of how WTGs should be distinguished and what criteria should be used to justify naming individual virus species. For WTGs with bipartite genomes, the ability of two viruses to form pseudo-recombinants is a strong indication that they are best considered as strains of the same virus and such findings appear to correlate with an identity of the iterated sequences in the large intergenic region of their DNA (Argfiello-Astorga et al., 1994). However, tests for pseudo-recombinant production require considerable effort and are not applicable to WTGs with monopartite genomes. For WTGs in general, a convenient rule of thumb for distinguishing and naming different viruses is that their large intergenic regions should differ in nucleotide sequence and their putative gene products, other than CP, should in general have sequence identities of less than 80 %. By these criteria TYLCV-ISR, TYLCV-SAR, TYLCV-THI, TLCV-A, TLCV-IN and ITmLCV are different virus species. Further data are needed to enable the status of TYLCVNIG and TYLCV-SSA to be assessed but the difference between the CP of TYLCV-SSA and CPs of other WTGs suggests that TYLCV-SSA is likely to represent a seventh species. The comparisons made in this paper and elsewhere (Padidam et al., 1995b) imply that WTGs are evolving rapidly and may be able to adapt more readily to new host species than plant viruses with RNA genomes. This is despite the general conclusion that the mutation rate caused by copying errors during replication is several orders of magnitude less for viral DNA than viral RNA, probably because of the host proof-reading mechanism that exists for DNA replication (Reanney, 1984). However, variants were found to occur more frequently than expected in isolates of some vertebrate-infecting viruses with ssDNA genomes (Cotmore & Tattersall, 1987; Gottschalck et al., 1991) and their occurrence may perhaps be characteristic of other eukaryote-infecting viruses with genomes of this type. If so, their existence could be a factor underlying the occurrence of swarms of variant WTG isolates that differ to greater or lesser extents in nucleotide sequence and so provide raw material on which selection pressures can act. We thank R. N. Beachy, C. M. Fauquet, R. L. Gilbertson and M. Padidam for providing sequences before publication and our colleague David Robinson for helpful comments. We are indebted to the EEC [Contract TS2A-0137-C(CD)] for financial support. References ABOUZID, A. M., POLSTON, J. E. 8,~HIEBERT, E. (1992). The nucleotide sequence of tomato mottle virus, a new geminivirus isolated from tomatoes in Florida. Journal of General Virology 73, 3225-3229. ARG/JELLO-ASTORGA, G., HERRERA-ESTRELLA, L. & RIVERABUSTAMANTE, R. (1994). Experimental and theoretical definition of geminivirus origin of replication. Plant Molecular Biology 26, 553 556. BRIDDON, R.W., PINNER, M.S., STANLEY, J. & MARKHAM, P. G. (1990). Geminivirus coat protein gene replacement alters insect specificity. Virology 177, 85-94. COHEN, S. & HARPAZ, 1. (1964). Periodic, rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius). Entomologia Experimentalis et Applicata 7, 155-166. COSTA, H. S. & BROWN, J. K. (1991). Variation in biological characteristics and esterase patterns among populations of Bemisia tabaci, and the association of one population with silverleaf symptom induction. Entomologia Experimentalis et Applicata 61, 211-219. COTMORE, S.F. & TATTERSALL, P. (1987). The autonomously replicating parvoviruses of vertebrates. Advances in Virus Research 33, 91-174. COUTTS, R. H. A., COFFIN,R. S., ROBERTS,E. J. F. & HAMILTON,W. D. O. (1991). The nucleotide sequence of the infectious cloned DNA components of potato yellow mosaic virus. Journal of General Virology 72, 1515-1520. DEVEREUX,J., HAEBERL1,P. & SMITHIES,O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387 395. DRY, I.B., RIDGEN, J.E., KRAKE, L.R., MULLINEAUX, P. M. & REZAIAN, M . A . (1993). Nucleotide sequence and genome organization of tomato leaf curl geminivirus. Journal of General Virology 74, 147 151. FRISCHMUTH, T., ZIMMAT, G. & JESKE, H. (1990). The nucleotide sequence of abutilon mosaic virus reveals prokaryotic as well as eukaryotic features. Virology 178, 461-467. GOTTSCHALCK, E., ALEXANDERSEN, S., COHN, A., POULSEN, L. A., BLOOM, M. E. & AASTED, B. (1991). Nucleotide sequence analysis of Aleutian mink disease parvovirus shows that multiple types are present in infected mink. Journal of Virology 65, 4378-4386. HAMILTON,W. D. O., STEIN,V. E., COUTTS,R. H. A. & BUCK, K. W. (1984). Complete nucleotide sequence of the infectious cloned DNA components of tomato golden mosaic virus: potential coding regions and regulatory sequences. EMBO Journal 3, 2197 2205. HARRISON, B. D., SWANSON,M. M., MCGRATH, P. F. & FARGETTE,D. (1991). Patterns of antigenic variation in whitefly-transmitted geminiviruses. Report of the Scottish Crop Research Institute for 1990, 88 90. HIDAYAT, S. H., GILBERTSON, R. L., HANSON, S. F., MORALES, F.J., AHLQUIST, P., RUSSELL, D. R. & MAXWELL, D. P. (1993). Complete nucleotide sequences of the infectious cloned DNAs of bean dwarf mosaic geminivirus. Phytopathology 83, 181-187. HONO, Y. G., ROBINSON, D. J. & HARRISON, B. D. (1993). Nucleotide sequence evidence for the occurrence of three distinct whiteflytransmitted geminiviruses in cassava. Journal of General Virology 74, 2437-2443. HOWARTH, A. J., CATON, J., BOSSERT, M. & GOODMAN, R. M. (1985). Nucleotide sequence of bean golden mosaic virus and a model for Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36 Tomato geminivirus C P relationships gene regulation in geminiviruses. Proceedings of the National Academy of Sciences, USA 82, 3572 3576. KHEYR-POUR, A., BENDAHMANE,M., MATZEIT, V., ACCOTTO, J. P., CRESPI, S. & GRONENBORN,B. (1992). Tomato yellow leaf curl virus from Sardinia is a whitefly-transmitted monopartite geminivirus. Nucleic Acids Research 19, 6763-6769. LAZAROW~TZ,S. G. & LAZDINS,I. B. (1991). Infectivity and complete nucleotide sequence of the cloned genomic components of a bipartite squash leaf curl geminivirus with a broad host range phenotype. Virology 180, 58-69. MCGRATH, P. F. & HARRISON,B_ D. (1995). Transmission of tomato leaf curl geminiviruses by Bemisia tabaci: effects of virus isolate and vector biotype. Annals of Applied Biology 126 (in press). MACINTOSH,S., ROBINSON,D. J. & HARRISON,B. D. (1992). Detection of three whitefly-transmitted geminiviruses occurring in Europe by tests with heterologous monoclonal antibodies. Annals of Applied Biology 121, 297-303. MAKKOUK, K. M. & LATERROT,H. (•983). Epidemiology and control of tomato yellow leaf curl virus. In Plant Virus Epidemiology, pp. 315 321. Edited by R. T. Plumb & J. M. Thresh. Oxford: Blackwell Scientific Publications. MORRIS, B., COATES,L., LOWE, S., RICHARDSON,K. & EDDY, P. (1990). Nucleotide sequence of the infectious cloned DNA components of African cassava mosaic virus (Nigerian strain). Nz~cleic Acids Research 18, 197-198. MUNIYAPPA,V., SWANSON,M. M., DUNCAN,G. H. & HARRISON,B. D. (1991). Particle purification, properties and epitope variability of Indian tomato leaf curl geminivirus. Annals of Applied Biology 118, 595-604. NAVOT, N., PICHERSKY,E., ZEIDAN,M., ZAMIR,D. & CZOSNEK,H. (1991). Tomato yellow leaf curl virus: a whitefly-transmitted geminivirus with a single genomic molecule. Virology 185, 151-161. 2049 PADIDAM,M., BEACHY,R. N. & FAUQUET,C. M. (1995a). Tomato leaf curl geminivirus from India has a bipartite genome and coat protein is not essential for infectivity. Journal of General Virology 76, 25-35. PADIDAM,M., BEACHY,R. N. & FAUQUET,C. M. (1995b). Classification and identification of geminiviruses using sequence comparisons. Journal of General Virology 76, 249-263. REANNEY, D. (1984). The molecular evolution of viruses. In 1he Microbe 1984, pp. 175-196. Edited by B . W . J . Mahy & J.R. Pattison. Cambridge: Cambridge University Press. ROCHESTER,D. E., DEPAULO,J. J., FAUQUET,C. M. & BEACHY,R. N. (1994). Complete nucleotide sequence of the geminivirus tomato yellow leaf curl virus, Thailand isolate. Journal of General Virology 75, 477-485. SAIKIA,A. K. & MUNIYAPPA,V. (1989). Epidemiology and control of tomato leaf curl virus in southern India. Tropical Agriculture (Trinidad) 66, 350-354. SANGER, F., NICKLEN, S. & COULSON,A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463 5467. STANLEY, J. (1995). Analysis of African cassava mosaic virus recombinants suggests strand nicking occurs within the conserved nortanucleotide motif during the initiation of rolling circle DNA replication. Virology 206, 702712. STANLEY, J. & GAY, M . R . (1983). Nucleotide sequence of cassava latent virus DNA. Nature 301, 260-262. SWANSON,M. M., BROWN, J. K., POULOS, B.T. & HARRISON,B.D. (1992). Genome affinities and epitope profiles of whitefly-transmitted geminiviruses from the Americas. Annals of Applied Biology 121, 285-296. (Received 14 February 1995; Accepted 20 April 1995) Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Thu, 15 Jun 2017 03:52:36