* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Protein adsorption wikipedia , lookup
Community fingerprinting wikipedia , lookup
Polyadenylation wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
List of types of proteins wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular evolution wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Non-coding RNA wikipedia , lookup
Biochemistry wikipedia , lookup
Point mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Expanded genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Protein Synthesis DNA Transcription Translation Nucleus Cytoplasm Gene mRN tRNA Amino Acid Protein Transcribing DNA • Double stranded DNA unzips at Gene • Gene – a coding section of DNA • Helicase is the enzyme that does the unzipping Helicase T G G T A C A G C T A G T C A T CG T A C CG T Matching bases of DNA & RNA • U instead of T is matched to A DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC DNA vs. RNA DNA • deoxyribose sugar • nitrogen bases RNA • ribose sugar • nitrogen bases • G, C, A, T • T:A • C:G • G, C, A, U • U:A • C:G • double stranded • single stranded Matching bases of DNA & RNA • RNA nucleotides, floating in nucleus, connect to DNA bases on one of the exposed DNA strands • Nucleotide – a phosphate, a sugar, a base • RNA Polymerase is the enzyme that attaches them together A G C U A G G U U C A AG C G A U A C A C C RNA polymerase A U G T G G T A C A G C T A G T C A T CG T A C CG T U C From nucleus to cytoplasm nucleus transcription DNA mRNA cytoplasm Translation - mRNA to Protein • The Instructions mRNA • The Reader Ribosome • The Transporter of Amino Acids Transfer RNA (tRNA) ribosome mRNA A C C A U G U C G A U C A GU A GC A U G GC A U GG tRNA aa aa aa U A C tRNA aa A GC tRNA aa C U AG tRNA aa mRNA to protein = Translation • tRNA drops off it’s Amino Acid • tRNA then goes back into the cytoplasm, to pick up another amino acid. • All 20 Amino Acids are floating free and waiting in the Cytoplasm. • The amino acid chain is left to become the functioning Protein. cytoplasm mRNA amino acid chain From mRNA to Protein tRNA translation transcription DNA mRNA nucleus cytoplasm mRNA codes for amino acids in triplet bases (codons) DNA TACGCACATTTACGTACGCGG codon mRNA ribosome AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala Codon = block of 3 mRNA bases amino acids (aa) The mRNA Codon Chart • For ALL life! • Code has duplicates • several codons for each amino acid • mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG DNA Proteins Cells Bodies DNA has the information to build proteins Genes - DNA coding sections proteins cells DNA DNA gets all the glory, Proteins do all the work bodies How do proteins do all the work • Proteins run and make living organisms • Enzymes – protein catalysts • control all chemical reactions in living organisms • Structure • all living organisms are built out of proteins Only 4 DNA bases (A,U,G,C) and 20 amino acids Code for ALL life on Earth TACGCACATTTACGTACGCGG DNA ribosome mRNA AUGCGUGUAAAUGCAUGCGCC ? protein aa Met Arg Val Asn Ala Cys Ala aa aa aa aa aa aa aa for Protein Synthesis! It’s Growth It’s Repair It’s YOU