Download Codons and Amino Acids

Codons and Amino Acids
Genes are segments of DNA that control a trait by providing the code for making a
specific protein. Proteins are large molecules that regulate cell function and produce
traits in an organism. Proteins are made out of smaller building block molecules called
amino acids.
DNA messages are “read” by ribosomes which make the proteins. In this sense, DNA
provides a recipe. Each ingredient in the recipe consists of a three nucleotide group
called a codon, and each codon specifies an amino acid to be added to the protein.
The table below shows the codons (three nucleotide groups) that specify the 20
different amino acids found in living things. Use this table to complete the questions on
the back of this worksheet.
1. What is a codon? Briefly describe and give an example.
2. Some amino acids have multiple codons that specify them, others only one. Identify
two amino acids that are specified by only one codon and list them below.
3. Which amino acid is specified by the greatest number of codons? List the codons
that specify this amino acid.
4. How many codons specify the amino acid serine? List them.
5. Use the table to decode the following codons. Write the name of each amino acid
next to the codon.
AAT ____________________ CAT ____________________
CAA ____________________ GAA ____________________
ATG ____________________ TGA ____________________
5.
Decode the following sequence and write the amino acids in order on the line
provided:
GGTCCTCTTCAATAG
__________ __________ __________ __________ _________
6
Encode the following Amino Acid Sequence
serine, valine, lysine, proline, glycine, stop
Mutations
In this activity you will learn how the genes in our DNA influence our characteristics.
For example, how can a gene cause albinism (very pale skin and hair)?
Basically, a gene is a segment of DNA that provides the instructions for making a
protein and proteins influence our characteristics. This chart describes how two different
versions of a gene can result in either normal skin and hair color or albinism.
DNA

Protein

Characteristic


Version of the gene that
provides instructions to make
normal protein enzyme.
Normal enzyme that makes
 the pigment molecule in skin
and hair

Normal skin and hair
color
Mutated version of the gene
that provides instructions to
make a defective enzyme.
Defective enzyme that does
 not make this pigment
molecule

Albinism (very pale
skin and hair)
Mutations are accidental errors in the DNA sequence. DNA must be copied every time
a cell divides (to reproduce) and a mutation is an accidental error in this copying
process. Because the DNA is used to produce instructions for building proteins, any
errors may change the protein and lead to a change in the trait the protein controls.
Mutations can take the form of insertions (a nucleotide is added), deletions (a nucleotide
is removed), and substitutions (a nucleotide is replaced with one that has a different
base).
Compare each of the numbered DNA sequences to the original sequence, and then
answer the following questions.
Original Sequence:
CAATTTTGGCAAAAAATGGTTATTTAG
A.
CAATTTTGGCAATAAAATGGTTATTTAG
B.
CAATTCTGGCAAAAAATGGTTATTTAG
C.
CAATTTTGGCAAAAAAAGGTTATTTAG
D.
CAATTTTGGCAAAAAATGTTATTTAG
1. Which of the sequences is an example of an insertion? Draw a box around the
base that was added and place a small “+” sign below the box.
Sequence:________
2. Which of the following sequences is an example of a deletion. Draw a vertical
line between the two bases on either side of the missing base. Put a small “-“
sign under this line.
Sequence:________
3. Which of the following sequences are examples of substitutions? Circle the base
where the substitution occurred in the sequences?
Sequence:________
Sequence:________
Decode the original sequence and each of the two sequences that have a substitution in
the space below.
4. Original:
5. Substitution 1:
6. Substitution 2:
7. Would both of these mutations affect the organism equally? Explain your
answer.
Sickle Cell Anemia
A common disease cause by a gene
mutation is sickle cell anemia. This mutation
causes abnormalities in blood cells that
produce serious health problems for
individuals with the disease.
Normal Blood
Cell
Sickle Blood
Cell
Each gene encodes the amino acid sequence to make a single protein.
In humans, the HBB gene is used to produce the protein hemoglobin. Hemoglobin is
the protein our blood uses to transport oxygen.
Each complete hemoglobin protein has more than 100 amino acids. The sequence
below is just the beginning of a normal hemoglobin protein sequence. Decode this
sequence and determine the first seven amino acids in a normal hemoglobin molecule.
Normal Hemoglobin Sequence:
DNA
Amino
Acid
GTGCACCTGACTCCTGAGGAG
Each complete hemoglobin protein has more than 100 amino acids. Sickle cell
hemoglobin and normal hemoglobin differ in only a single amino acid. This difference in
a single amino acid results in the very different properties of sickle cell hemoglobin,
compared to normal hemoglobin. Below is the mutated sequence that produces an
abnormal version of hemoglobin called hemoglobin-s.
Decode this sequence and determine the first seven amino acids in the abnormal
hemoglobin-s molecule
Mutated Hemoglobin Sequence: GTG CAC CTG ACT CCT GTG GAG
DNA
Amino
Acid
Where is the location of the mutation that produced hemoglobin-s? What kind of a
mutation is it (substitution, deletion, or insertion)?
How does this mutation affect the amino acid sequence as compared to a normal
hemoglobin molecule?
This difference results in the very different properties of sickle cell hemoglobin,
compared to normal hemoglobin.
If a person inherits mutated copies of the hemoglobin from both parents, they then
produce only sickle cell hemoglobin. The sickle cell hemoglobin molecules tend to
clump together in long rods. These rods can change the shape of the red blood cells
from their normal disk shape to a sickle shape. Sickle-shaped red blood cells can block
blood flow in the small blood vessels. This causes pain and damage to body organs. In
addition, sickle-shaped red blood cells do not last nearly as long as normal red blood
cells, so the body cannot produce enough replacement red blood cells and the person
develops anemia (not enough red blood cells).