Download File

DNA the molecule of life

The nucleus of every cell of your body
contains DNA deoxyribonucleic acid.

DNA is the only molecule known that is
capable of replicating itself, thereby permitting
cell division.

DNA provides the directions that guide the
repair of worn cell parts and the construction
of new ones.
Read

Read pages 642-643, 646-647
 DNA contains instructions that ensure
continuity of life – offspring share structural
similarities with those of their parents.
However, not all
offspring are identical
to their parents. Why?
New combinations of genes and mutations – a
change in the DNA sequence, affect the
uniqueness of descendants.
Searching for the Chemical of Heredity

Early 1940’s:
biologists began to
accept hypothesis
that genetic material
was found within
chromosomes - long
threads of genetic
material found in
nucleus of cells.
 Chromosomes are composed of relatively
equal amounts of proteins and nucleic acids.
Proteins (histones)
- basic units are
amino acids
- made up of 20
different amino acids
which can be
arranged to make an
almost infinite
amount of proteins.
Nucleic Acids
-basic unit is the
nucleotide
- Nucleotides are
made up of
phosphates, sugar
molecules and one
of four different
nitrogen bases:
adenine, guanine,
cytosine & thymine.
 At this point in time it was
thought that the key to the
genetic code lied in the proteins.
This hypothesis was logical, but
incorrect.
 1950 – A chemist named
Rosalind Franklin developed a
way of using X-rays to take
pictures of the DNA molecule.
 Her pictures showed that DNA was shaped
like a spiral, or helix.
 1953 – James Watson & Francis Crick
developed a 3-dimensional model of the DNA
molecule.
 This model is known as the double helix
model and it resembles a twisted ladder.
Watson
Crick
Structure of DNA

The uprights of the DNA
“ladder” are composed of
phosphates & sugars.
a. The bases form the
“rungs” of the ladder
b. The sugar and
phosphate form the
“uprights”
Did you know?
Human DNA is 3
billion base pairs and
about 2 m in length.
The two purines are adenine and guanine
Double ring
structures
The two pyrimidines are thymine and cytosine
Single ring
structures
Cytosine pairs with guanine
Adenine pairs with thymine
Nucleotides are complementary.
a.
A pyrimidine pairs with a purine
Thymine with Adenine
Cytosine with Guanine
b.
Bases are held together with
relatively weak hydrogen
bonds (They can “unzip”…)
Structure of DNA
Replication of DNA

DNA is the only molecule
that is known to be
capable of duplicating
itself. This process is
known as replication.
Replication occurs during
interphase of the cell cycle.

•During replication, the weak
hydrogen bonds that hold the
nitrogen bases together are
broken. The DNA “unzips”
itself into two parent strands.
The enzyme helicase breaks the
hydrogen bonds.
DNA helicase - an enzyme that uses ATP
to “unzip” the DNA molecule
This process is known as
the “Semi-conservative
Replication Model” –
Meselson & Stahl (1958).
Each strand of DNA pairs
with a complementary
“new” strand.
 This produces two, “half old, half new”
strands of DNA.
 Each “unzipped” parent strand acts as a
template to which “free floating” nucleotides
in the cell can attach.
 Enzymes called DNA polymerase bring these
“free floating” nucleotides into the replication
fork and pair them with their complimentary
bases (A with T; C with Where
G). do free floating
nucleotides come from?
The food we eat.
Our body producing
proteins.
Proteins -> amino acids
-> nucleotides.
 Enzymes called DNA ligase fuse the free
nucleotides together by catalyzing the
formation of the sugar-phosphate bonds
between adjacent nucleotides.
Steps for DNA Replication
Step 1 – Unzipping
and unwinding of DNA
molecule.
- The enzyme,
Helicase, breaks the
weak hydrogen
bonds between the
bases to form two
strands
Step 2 – Pairing of Nitrogenous
Bases
- “Free floating” nucleotides
bind to the “unzipped”
strands of DNA.
- DNA polymerase facilitates
the insertion of the
nucleotides.
- 2 new complementary
strands formed.
Step 3 – Linking of the sugar-phosphate groups
- Deoxyribose sugar of one nucleotide
combines with a phosphate group of an
adjacent nucleotide.
- DNA ligase enzyme joins the nucleotides
together to form two new DNA strands.
- Bases form hydrogen bonds.
- Product = 2 identical strands of DNA.
Complete Enzyme Function
Summary Chart on page 666
Important to note:
 During the replication process, genetic
mistakes (base pair error) can occur but these
occurrences are infrequent.
 Environmental factors such as hazardous
chemicals or radiation are one source of
genetic mistakes.
 These factors can cause uncomplimentary
bases to become paired.
 Enzymes that act as “proofreaders” run
along the DNA looking for genetic mistakes
like these.
 If a damaged section is detected, it can be
repaired by an endonuclease enzyme
“snipping” out the error from the DNA
sequence, and an enzyme called ligase, that
patches the DNA back together.
What do you
knowSynthesis
about PROTEINS?
Protein

Proteins in our
bodies are made up
of different
combinations of 20
amino acids.
The
production of
proteins is
controlled by
genes.

Proteins are
chemicals that
make up the
structure of cells.
 The “recipe” for proteins is
found in the nucleus of the
cell, but proteins are made in
the cytoplasm.
 The DNA molecules do not
leave the nucleus because
they are too big.
 Instead, a messenger molecule, called mRNA,
makes a copy of the DNA and takes it to the
cytoplasm of the cell so that proteins can be
made.
 The mRNA is a type of
RNA (ribonucleic acid) with
a structure similar to that of
DNA.
 RNA is a single helix
molecule that contains the
sugar ribose.
Protein Synthesis is divided into
two parts:
1)Transcription
2)Translation
Transcription

mRNA molecules
“transcribe”
information from a
DNA molecule.

the double stranded
DNA molecules in the
nucleus start to
“unzip” at a point
where there is a gene
that codes for a
particular protein
 As
the double
helix uncoils,
mRNA nucleotides
“floating around”
in the nucleus bind
to the open DNA
bases on one side
of the DNA
molecule.
 the mRNA transcript
begins to form a long
chain.
Once the mRNA has
been completely formed,
the mRNA moves away
from the DNA, and the
DNA recoils back into a
double helix.
 The single stranded mRNA molecule is
small enough to pass through the nuclear
pores and moves into the cytoplasm of the
cell
Initiation


Transcription starts when the RNA polymerase
enzyme binds to a segment of DNA to be
transcribed
It binds in front of the gene in a region called
the promoter which indicated where the DNA
strand should be transcribed.

This is a region with a sequence of A’s and T’s

ACCATAATATTACCGACCTTCG
Elongation

Once the RNA polymerase binds to the
promoter and opens the double helix, it starts
building single stranded mRNA in the 5’ to 3’
direction



Similar to DNA replication, but it does not require a
primer and copies only one strand
The transcribed DNA strand is called the
template strand
It is complimentary except that in the place of of
thymine there is uracil
Termination



Synthesis of mRNA continues until RNA
polymerase reaches the end of the gene
Termination sequence is at the end of the gene
and signals this stop
mRNA and RNA polymerase are released and
go transcribe another gene
Translation
 Translation
is the process
by which the mRNA strand
is “translated” into an
amino acid sequence
(protein).
 The mRNA molecule
attaches itself to a ribosome
in the cytoplasm located in
the rough endoplasmic
reticulum.
Every three nitrogen
bases on an mRNA
strand codes for one
amino acid. This is called
a CODON.
Not all codons code for
amino acids. There are 4
codes that code for
initiator or terminator
codons. These are
codons that tell protein
synthesis to start (AUG)
or stop (UAA, UAG,
UGA.
tRNA - transfer RNA
I)
Carries amino acids to the mRNA
ii)
Clover leaf shape
when the mRNA initially binds
to a ribosome, the ribosome
attaches to an initiator codon
on the mRNA.
TRNA (transfer RNA), picks
up amino acids that are
circulating within the
cytoplasm and shuttles them to
the mRNA.
Each tRNA molecule has an
anti-codon to each mRNA
codon. This helps the tRNA
find the correct amino acid in
the cytoplasm
The tRNA “drops off ” the amino
acid (“taxi”) at the ribosome and
goes to search again for more.
The ribosome moves another three
spaces and the next tRNA molecule
binds and “drops off ” its amino
acid. (The ribosome helps in the
binding of mRNA and tRNA
molecules).
This continues until a terminator
codon (“stop” codon) is reached and
protein synthesis is complete.
Initiation



Occurs when an ribosome (carries out protein
synthesis) recognizes a specific sequence on the
mRNA and binds to it.
Ribosomes consist of two subunits (large and
small) which bind to mRNA, clamping it
between them.
It moves along adding new amino acids to the
growing polypeptide chain each time it reads a
codon
Initiation

The start codon is AUG



If it starts reading in the wrong place all the codons
will be misread.
tRNA delivers the amino acids during
translation
At one end of the tRNA is the anticodon which
is complementary to the mRNA, the other end
carries the corresponding amino acid
Example

If mRNA has the codon UAU, the
complementary base sequence of the anticodon
is AUA, and the tRNA would carry the amino
acid tyrosine
Elongation

The ribosome has two sites for tRNA to attach: the aminoacyl
(A) site and the peptidyl (P) site
 The anticodon (UAC) complimentary to the start codon
(AUG) enters the P site
 The next tRNA carrying the required amino acid enters the A
site
 A peptide bond forms between the two and a polypeptide
chain is forming
 The ribosome has shifted over one so the second tRNA is
now in the P site, allowing the A site to be open.
 This continues until the entire code of mRNA has be
translated and the ribosome reaches a stop codon
Termination



Eventually, the ribosome reaches one of the
three stop codons.
A protein known as a release factor recognizes
the ribosome has stalled and helps release the
polypeptide chain from the ribosome
The protein has been synthesized
In Summary
mRNA is formed in the
nucleus (transcription)
mRNA travels to ribosome
which
serves
as
the
framework for binding the
mRNA and tRNA molecules
Cell cytoplasm contains a
pool of amino acids. Each
can only link to one specific
tRNA. This linkage requires
energy (ATP) and a specific
enzyme for each amino acid
5.
There are some key differences between
DNA and RNA.
DNA
RNA
deoxyribose
ribose
thymine (T)
uracil (U)
dble strand
single strand
long
short
1 type
3 types
nucleus only
nucleus, cytoplasm
Bonding


A and T form double bonds
C and G form triple bonds
eg.) Predict the mRNA and tRNA base
sequences, as well as the amino acid
sequence, for the following DNA
molecule:

DNA: T A C G C A T T G C C A T A T C C G A C T

mRNA:




AUG CG U A A C G G U A U A G G C U GA

UACG C A U UG C C A U A U CC G A C U
tRNA:
amino
acid:
Methionine/Start; Arg;enine Aspartate; Glycine; Isoline;
Glycine; stop
Gene Recombinations
1)
Recombinant DNA

An application of genetic engineering in
which genetic information from one
organism is spliced into the chromosome of
another organism.
Genetic transformation- introduction and
expression of foreign DNA in a living
organism

DNA Sequencing


Before a DNA sequence can be used to make
recombinant DNA, an isolated piece of DNA
containing that sequence must be identified
This DNA sequencing was used during the
Human Genome Project
Enzymes and Recombinant DNA


Restriction endonucleases (restriction enzymes)
are like molecular scissors than can cut DNA at
a specific base-pair sequence (its recognition
site)
Most recognition sites are 4 to 8 base pairs long
and are usually palindromic

Ex. 5’ GAATTC 3’
3’ CTTAAG 5’
Restriction Enzymes




See Table 2 on page 680
When one strand is longer than the other and
has exposed nucleotides that lack complimentary
bases it is called a sticky end
When the DNA fragments are fully base paired
it is called a blunt end
It is more useful to have sticky ends because
they can be more easily joined together
Methylases



Enzymes than can modify a restriction enzyme
recognition site by adding a methyl (-CH3) group
to one of its base sites.
They protect a gene fragment from being cut in
an undesired location
First identified in bacteria cells and were used to
protect the DNA from digestion by its own
restriction enzymes
DNA Ligase


Joins segments of DNA together
Hydrogen bonds will form between the
complimentary bases
The
Process
Polymerase Chain Reaction




PCR allows scientists to make billions of copies
of pieces of DNA from extremely small
quantities of DNA
This depends on Taq polymerase which
synthesizes DNA during replication
Enzymes have an optimum temperature range
that they function, and Taq polymerase is stable
at much higher temperatures than DNA
polymerase
Each PCR cycle doubles the number of DNA
Polymerase Chain
Reaction
A technique used to amplify a
specific gene in a DNA
sample.

Basically a molecular
photocopier.

A common gene is selected
(i.e. insulin, myosin) and then
amplified exponentially. (1
strand; 2; 4; 8; 16, etc.)

Performed prior to gel
electrophoresis.
DNA is pipetted into
these tubes, nucleotides
and DNA polymerase
are added. The mixture
is heated to separate
DNA, and let the
polymerase work!
Other uses for PCR:
Cloning a gene so it can be inserted into various
samples.
 Genetic diagnosis: sickle cell anemia or cystic
fibrosis

Transformation



Any process by which foreign DNA is
incorporated into the genome of a cell
A vector is the delivery system that is used to
move the foreign DNA into the cell
An organism that has foreign DNA is said to be
transgenic
Transformation of Bacteria


Bacteria are the most commonly transformed
organism
Transgenic bacteria have been engineered to
produce hGH


1) Identify and isolate the DNA fragment that is
being transferred
2) DNA fragment is introduced into the vector



Plasmids are small, circular, double-stranded DNA
molecules that are commonly used as vectors. It
contains genes and is replicated and expressed.
3) Plasmid vector and DNA are cut by the same
restriction enzyme(s)
4) Plasmid and DNA fragment are mixed
together and incubated with DNA ligase



5) This produces recombinant plasmids that
contain the foreign DNA fragment
6) Plasmid is introduced into bacterial cell
7) Once the bacterium has been transformed, it
makes many copies of the recombinant plasmid

This is often called gene cloning



For transformation to be successful, the plasmid
must only have one recognition site for the
restriction enzyme or else it would be cut into a
bunch of useless pieces
Naturally occurring plasmids do not always have
a single site, so engineered plasmids are used
They contain multiple cloning sites, which is a
single region that contains unique recognition
sites for an assortment of restriction enzymes
When are these technique used?
a) Medical Applications



Scientists have already placed a number of
human genes into bacteria.
The gene that produces human insulin has
been spliced into E.coli bacteria.
The human DNA directs the bacteria to
produce human insulin, a hormone essential
for regulating blood sugar.
Diabetes Mellitus




Insufficient/lack of production of
insulin.
People with this disorder regulate
their blood sugar levels by taking
insulin injections.
Traditionally, insulin has been
extracted from pig and cow
pancreases. Downsides of this are
that the insulin differs from human
insulin and some people have
allergic reactions to it.
Human insulin produced by E. coli
was first marketed in Canada in
1983.
b) Agricultural


Genetic engineering is also being
used to produce strains of wheat,
cotton, and soybeans that carry a
bacterial gene that makes the
plants resistant to the
herbicides used by many farmers
to control weeds.
This gene would make it easier to
grow crops while still ensuring
that the weeds are destroyed.

The first gene-spliced fruit that was approved
for human consumption were tomatoes
engineered with “anti-sense” genes that retard
spoilage.

Crop plants are also being engineered to resist
certain pathogens and pest insects. Tomato and
tobacco plants, for example, have been
engineered to carry and express certain genes of
viruses that normally infect and damage plants.
By having the viral gene, these plants are
“vaccinated” against attack by the viruses
themselves.
2) DNA Fingerprinting

If enough body tissue
or semen is left at a
crime scene, forensic
laboratories can
perform tests to
determine the blood
type or tissue type.
DNA Fingerprinting


This DNA fingerprint can then be used to
compare against other fingerprints (possible
suspects, DNA found at a crime scene or family
member DNA).
Prior to 1993, these tests had limitations - they
required LARGE amounts of DNA (not what
you would see on CSI).
DNA Fingerprinting

Now because of a technology called
polymerase chain reaction (PCR), a small
DNA sample can be copied/amplified which
means multiple copies of it can be made to
provide enough DNA to produce a fingerprint.
 Such tests have limitations.
First, they require fairly fresh
tissue in significant amounts.
 Second, because there are so
many people with the same
blood type, this approach can
only exclude a subject; it is
not evidence of guilt.
 DNA testing CAN identify the guilty
individual with a higher degree of certainty,
since the DNA VNTR (variable number
tandem repeat) nucleotide sequence of
everyone is unique (except identical twins).
 Two humans will have the vast majority of
their DNA sequence in common. Genetic
fingerprinting exploits highly variable
repeating sequences called microsatellites.
Think of DNA as a train. All trains you see have
different numbers of cars on them. This is just like
different people having different numbers of VNTR
sequences on their DNA.
 The probability of two people having the same
number of VNTR’s for one gene is 1/900 000!

How do they do this?

The technology used to
produce a DNA fingerprint is
called gel electrophoresis.
Steps involved:


The amplified DNA sample is
placed in a well in the agarose
gel (analogous to a lane in a
swimming pool).
–The VNTR fragments (of differing sizes) in
the DNA are separated when electricity is
applied to the gel.


DNA fragments have a
negative charge and are
therefore pulled to the
other side of the gel due
to their attraction to the
opposite positive side.
The distance that the
fragments travel in the
gel are based on the size
of the fragments.
Segments of
DNA from
PCR
Who would move through the
agarose “gel forest” faster????
The smallest fragments travel the furthest.
 After a period of time, the fragments finish
separating. The bands can be viewed when a
dye is applied and a pattern of bands can be
seen. This pattern is known as a DNA
fingerprint.
 The banding patterns on one person’s DNA
fingerprint can then be compared to the
banding patterns of another DNA fingerprint.

Who is Guilty?
Suspect 2!
How do you know?
The bands match

Other uses for DNA fingerprinting:
Identification of catastrophe victims
 Identify endangered species (poaching)
 Prevent sports memorabilia fraud

Superbowl footballs
 2000 Summer Olympics memorabilia

DNA and Mutations



Mutations are inheritable changes in the genetic
material
They can arise from mistakes in DNA
replication when one nitrogen base is substituted
for another
X-rays, UV rays, and chemicals that can alter
DNA and are called mutagenic agents
If DNA is altered, mRNA will also be affected.
A change in a single amino acid could result in a
completely different protein being produced
There are three main types of mutations:
Substitution – one base replaces another
Insertion – a base is inserted between two existing
bases
Deletion – a base is deleted from the DNA
sequence
These types of mutations can cause a shift in
the DNA sequence, which would result in a
miscoded protein.
If the protein is a vital one, the cell may die.
When mutations occur, they are repeated each
time the cell undergoes mitosis (or meiosis)
Point Mutations




Changes to one single base pair of DNA
Silent mutation
 No effect on the operation of the cell because they occur in
the non-coding region. ACA ACU
Missense mutation
 Leads to a different amino acid being placed in the
polypeptide
Nonsense mutation
 A stop codon replaces a codon specifying an amino acid
 Is often lethal to cells
Sickle cell anemia



Sickle cell anemia is a genetic disease caused by the
incorrect codon of one amino acid in a protein
Valine replaces glutamine as the sixth amino acid in one
of the protein changes coded for by DNA
Such a small change has a serious impact on the
formation of red blood cells, causing them to have a
sickle shape, which reduces their oxygen carrying
capacity.
Gene Mutations


Changes the coding for the amino acid
Deletion


When one or more nucleotide is removed, which can
lead to significant changes to the protein
Insertion

Inserting an extra nucleotide will cause a shift in the
codons causing different amino acids to be inserted

Translocation is the relocation of groups of base
pairs from one part of the genome to another


Usually occurs between two non-homologous
chromosomes, disrupting the normal structures of
genes. Leukemia
Inversion is a section of the chromosome that
has reversed its orientation in the chromosome

No gain or loss of genetic material, but a gene may
be disrupted
Oncogenes: Cancer


Cancer can be caused by nitrogen base
substitution, or the movement of genetic
material from one part of the chromosome to
another.
There are many cancer causing agents
(carcinogens):
X rays, UV radiation & mutagenic chemicals,
that promote the alteration of normal genes into
cancer causing genes. (oncogenes)
Every cell in your body has identical DNA, but
each cell is specific to its purpose.
In a skin cell, the “skin genes” are expressed,
while the “muscle genes” are not expressed.
How does a skin cell turn on certain genes while
turning off others? - by having “regulator genes.”
– act like switches to turn “on” or “off ” segments
of the DNA molecule.
Regulator genes produce proteins that have the
ability to turn “on” and “off ” the process of cell
division.
Oncogenes can either turn ON cell division
(leave the switch regulating cell division OPEN )
or INHIBIT an “off ” switch. Both situations
could lead to cancer.
Studies have indicated that cancer-causing
oncogenes are found in normal strands of
DNA. The question is if oncogenes are found
in normal cells, than why do normal cells not
become cancerous?
Current theory is that the cancer gene,
(oncogene), has been transposed to another gene
site.
Transposon- a DNA section that can change
positions within a genome
Such transpositions may have been brought about
by environmental factors or mutagenic chemicals.
The movement of the oncogene away from it’s
regulator gene may have caused the problem.
Causes of Genetic Mutations


Spontaneous mutations are caused by an error
of the genetic machinery
Mutagenic agents can cause induced mutations
due to exposure

Phylogeny is the proposed evolutionary history
of a group of organisms


Species that are closely related will share very similar
DNA sequences
Mitochondrial DNA can be used to trace
inheritance down the maternal line in mammals,
as the egg is the only source of the mitochondria
passed on to new offspring