* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Microarray Applications
Nucleic acid analogue wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene regulatory network wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Deoxyribozyme wikipedia , lookup
SNP genotyping wikipedia , lookup
Genome evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Molecular evolution wikipedia , lookup
Gene expression wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gene expression profiling wikipedia , lookup
Course LMP 1506S Clinical Applications of Genomics and Proteomics Thursday, April 15, 2004, 9-11 am MSB Room 6205 DNA mRNA Protein Eleftherios P. Diamandis MD,Ph.D ([email protected]) Website:www.acdclab.org Where could you find my lecture slides? Go to my website: www.acdclab.org Click on “Teaching” Find lecture title and follow instructions on how to download it My Objective (unique for this course) To demonstrate how new technological advances in genomics and proteomics can be used to help patients A link between discovery and clinical applicability is important and constitutes what is currently known as “Translational Research” Microarrays What is a microarray? A microarray is a compact device that contains a large number of well-defined immobilized capture molecules (e.g. synthetic oligos, PCR products, proteins, antibodies) assembled in an addressable format. You can expose an unknown (test) substance on it and then examine where the molecule was captured. You can then derive information on identity and amount of captured molecule. Microscope slide DNA microarray 16 17 18 7 Actin DNA CyclinD DNA DHFR DNA 8 RB DNA E2F1 DNA tubulin DNA 9 control DNA Myc DNA Src1 DNA Microarray Technology Manufacture or Purchase Microarray Hybridize Detect Data Analysis Advantages of Microarrays Small volume deposition (nL) Minimal wasted reagents Access many genes / proteins simultaneously Can be automated Potentially quantitative Limitations of Microarrays Relatively new technology (10 years old) Still has technical problems (background) Poor reproducibility between investigators Still mostly manual procedure Relatively expensive Applications of Microarrays Gene expression patterns Single nucleotide polymorphism (SNP) detection Sequence by hybridization / genotyping / mutation detection Study protein expression (multianalyte assay) Protein-protein interactions Provides: Massive parallel information If Microarrays Are So Good Why Didn’t We Use Them Before?? Not all genes were available No SNPs known No suitable bioinformatics New proteins now becoming available Microarrays and associated technologies should be regarded as by-products of the Human Genome Initiative and bioinformatics Reviews on Microarrays A whole issue on Microarray Technology has been published by Nature Genetics, Dec. 2002 (Vol. 32) Books: Bowtell D. Sambrook J. DNA Microarrays. Cold Spring Harbor Laboratory Press, 2003 Schena M. Microarray Analysis. Wiley Liss, 2003 History 1991 - Photolithographic printing (Affymetrix) 1994 - First cDNA collections are developed at Stanford. 1995 - Quantitative monitoring of gene expression patterns with a complementary DNA microarray 1996 - Commercialization of arrays (Affymetrix) 1997- Genome-wide expression monitoring in S. cerevisiae (yeast) 2000 – Portraits/Signatures of cancer 2003 - Introduction to clinical practice Microarray Fabrication Two Major Methods: [a] Affymetrix Photolithography (400,000 spots in 1.25 x 1.25 cm area!) [b] Everybody else Mechanical deposition (printing) [0.5 - 2nL] on glass slides, membranes,etc Principles of DNA Microarrays (printing oligos by photolithography) (Fodor et al. Science 1991;251:767-773) Microarrays, such as Affymetrix’s GeneChip, now include all 50,000 known human genes. Science, 302:211, 10 October, 2003 Affymetrix Expression Arrays They immobilize oligonucleotides (de novo synthesis; 25 mers) For specificity and sensitivity, they array ~10 or more oligos per gene Latest version covers 50,000 genes (whole human genome) in one array (Agilent Technologies has the same density array; G4112A) They label-test RNA with biotin and detect with streptavidinfluor conjugates Preparation of Labeled mRNA for Hybridization Use oligo-dT with a T7 RNA polymerase promoter for reverse transcription of extracted mRNA (procedure makes cDNA) Use T7 RNA polymerase and biotin-labeled ribonucleotides for in vitro transcription (produces biotinylated, single-stranded cRNA) Alternatively: You can directly label cRNA with Cy-3 and Cy-5 fluors using T7 RNA polymerase Microarray Applications Differential Gene Expression sample 1 (tumor tissue) RNA extraction and labeling to determine expression level RNA cDNA cRNA Cy5-UTP red fluorescence reverse transcriptase, T7 RNA polymerase cDNA RNA sample 2 (reference) cRNA Cy3-UTP green fluorescence sample of interest compared to standard reference Reference tissue cRNA (green) Tumor tissue cRNA (red) 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 Human genes on a microarray slide Differential Gene Expression (Budding vs Non-Budding Yeast) Normal vs. Normal Normal vs. Tumor Lung Tumor: Up-Regulated Lung Tumor: Down-Regulated Lung Tumor: Up-Regulated Signal transduction Cytoskeleton Proteases/Inhibitors Kinases Lung Tumor: Up-Regulated Signal transduction Cyclin B1 Cytoskeleton Cyclin-dependent kinase Tumor expressionrelated protein Proteases/Inhibitors Kinases Lung Tumor: Down-Regulated Signal transduction Proteases/Inhibitors Cytoskeleton Kinases Lung Tumor: Down-Regulated Signal transduction Cytoskeleton Tumor necrosis factor-related protein Proteases/Inhibitors Kinases Genes Common to Many Tumors (e.g.Kidney; Liver; Lung) Up-regulated Down-regulated Microarray Applications Whole Organism Biology Whole Genome Biology With Microarrays Cell cycle in yeast Study of all yeast genes simultaneously! Red: High expression Blue: Low expression Lockhart and Winzeler Nature 2000;405:827-836 Microarray Applications Single Nucleotide Polymorphism (SNP) Analysis Single Nucleotide Polymorphisms (SNP) DNA variation at one base pair level; found at a frequency of 1 SNP per 1,000 - 2,000 bases A map of 1.42 x 106 SNPs has been described in humans (Nature 2001; 409:928-933) by the International SNP map working group Identification: Mainly a by-product of human genome sequencing at a depth of x10 and overlapping clones 60,000 SNPs fall within exons; the rest are in introns Why Are SNPs Useful? Human genetic diversity depends on SNPs between individuals (these are our major genetic differences, plus micro/minisatellites) Specific combinations of alleles (called “Haplotypes”) seem to play a major role in our genetic diversity How does this genotype affect the phenotype Disease predisposition? Why Are SNPs Useful? Diagnostic Application Determine somebody’s haplotype (sets of SNPs) and assess disease risk. Be careful: These disease-related haplotypes are not as yet known! Nature 2003 426: 789-796 Genotyping: SNP Microarray Immobilized allele-specific oligo probes Hybridize with labeled PCR product Assay multiple SNPs on a single array TTAGCTAGTCTGGACATTAGCCATGCGGAT GACCTGTAATCG TTAGCTAGTCTGGACATTAGCCATGCGGAT GACCTATAATCG Many other methods For SNP analysis have been developed SNP Analysis by Microarray GeneChip® HuSNPTM Mapping Assay (Affymetrix) More than 10,000 single nucleotide polymorphisms (SNPs) covering all 22 autosomes and the X chromosome in a single experiment. Coverage:1 SNP per 210 kb of DNA Needs:250 ng of genomic DNA-1 PCR reaction Commercial Microarray for Clinical Use (Pharmacogenomics) Roche Product CYP 450 Genotyping (drug metabolizing system) FDA Confusion Class 1 medical device? (no PMA) Class 2 or 3 medical device? (requires pre-market approval) From: Nature Biotechnology 2003 21:959-60 “The US government has blocked the sale of a new kind of DNA diagnostic test, putting up an unexpected barrier to the marketing of technology to distinguish genetic differences in how patients metabolize certain drugs.” Science 2003 302: 1134 SNP Detection by Mass Spectrometry High throughput detection of SNPs can be achieved by mass spectrometry SNP Center in Toronto (PMH) runs a Sequenom Mass Spectrometry system Microarray Applications Sequencing by Hybridization Sequencing By Hybridization Address the need for high-speed, low-cost sequencing of large sequences in parallel. Example: Consider examining 50Kb of sequence for 1,000 individuals. Conventional Method 50Kb x 1,000 = 50 Mb of sequence. At a rate of 500 bases per lane and 30 sequencing lanes, you can produce 15 Kb of sequence per day. You need 10 years for the project. Microarray With one microarray of 1.25 x 1.25 cm dimension, you can scan 50 Kb of sequence at once. You need 1,000 microarrays to complete task. This may be completed in a few days. Sequencing by Microarray Technology GeneChip p53 Assay Reagents p53 Primer Set: PCR primer pairs of exons 2-11 optimized for a single-tube multiplex reaction Fragment Reagent: DNase 1 for DNA fragmentation Control Oligonucleotide F1: Positive hybridization control p53 Reference DNA: Human placental DNA GeneChip p53 Assay Performance Characteristics Bases of genomic DNA analyzed 1262 bp Base calling accuracy for missense mutations > 99.9% Time from purified DNA to data 4.5 hrs Maximum steady state throughout equivalent to 6310 bp/hr As validated on a set of 60 human p53 genomic DNA samples. “Maximum steady state through-put based on one GeneChip analysis system. Microarray Applications-Non Human - Chips Avaliable Now (2004) Pathogens (detection of Bird-Flu Virus strains) Smallpox (bioterrorism) Malaria (Plasmodium anopheles) Zebrafish/Xenopus laevis (model organisms) SARS Virus sequencing Microarray Applications Food Expert-ID (available by Bio-Merieux;2004) DNA chip can verify quickly the animal species composition and the authenticity of raw or processed food and animal feed By providing multi-species identification, FoodExpert-ID will help to improve safety of food for human and animal consumption, thereby contributing to consumer health protection Microarray Applications Protein Microarrays Protein Microarrays Protein microarrays are lagging behind DNA microarrays Same idea but immobilized elements are proteins instead of nucleic acids Number of elements (proteins) on current protein microarrays are limited (approx. 500) Antibodies for high density microarrays have limitations (crossreactivities) Aptamers or engineered antibodies/proteins may be viable alternatives (Aptamers:RNAs that bind proteins with high specificity and affinity) Applications Screening for: Small molecule targets Post-translational modifications Protein-protein interactions Protein-DNA interactions Enzyme assays Epitope mapping High-throughput proteomic analysis Label all Proteins in Mixture Protein array now commercially available by BD Biosciences(2002) Haab et al. Genome Biology 2000;1:1-22 Cytokine Specific Microarray (Microarray version of ELISA) IL-1 IL-6 IL-10 marker protein cytokine Detection system BIOTINYLATED MAb ANTIGEN CAPTURE MAb VEGF MIX Competing High Throughput Protein Technologies Bead-Based Technologies Luminex-flow cytometry Illumina-bead chips Microfluidics Zyomyx Mass spectrometry Ciphergen-protein chips Microarray Clinical Applications Cancer Diagnostics Molecular Portraits of Cancer Rationale: The phenotypic diversity of breast and other tumors might be accompanied by a corresponding diversity in gene expression patterns that can be captured by using cDNA microarrays Then Systematic investigation of gene expression patterns in human tumors might provide the basis of an improved taxonomy of breast cancers Perou et al. Nature 2000;406:747-752 Molecular Portraits of Cancer Breast Cancer Perou et al. Nature 2000;406:747-752 Green: Underexpression Black: Equal expression Red: Overexpression Left Panel: Cell Lines Right Panel: Breast Tumors Figure Represents 1753 Genes Differential Diagnosis of Childhood Malignancies Ewing Sarcoma: Yellow Rhabdomyosarcoma: Red Burkitt Lymphoma: Blue Neuroblastoma: Green Khan et al. Nature Medicine 2001;7:673-679 Differential Diagnosis of Childhood Malignancies (small round blue-cell tumors, SRBCT) EWS = Ewing Sarcoma NB = Neuroblastoma RMS = Rhabdomyosarcoma BL = Burkitt’s Lymphoma Note the relatively small number of genes necessary for complete discrimination Khan et al. Nature Medicine 2001;7:673-679 Microarray Milestone: June 2003 Start Date Question: Can microarray profiling be used in clinical practice? Prognosis/Prediction of therapy/Selection of patients who should be treated aggressively? Nature 2002; 415: 530-536 NEJM 2002; 347: 1999-2009 Van’t Veer and colleagues are using microarray profiling as a routine tool for breast cancer management (administration of adjuvant chemotherapy after surgery). Their profile is based on expression of 70 genes Treatment Tailoring by Profiling premenopausal, lymph node negative Gene Expression profiling 60% 40% Poor signature ~ 56 % metastases at 10 yrs ~ 50 % death at 10 yrs Good signature ~ 13 % metastases at 10 yrs ~ 4 % death at 10 yrs Adjuvant chemo- and hormonal therapy No adjuvant therapy or hormonal therapy only 295 patients survival metastases-free Kaplan-Meier Survival Curves time (years) time (years) Profiling in Clinical Practice Metastatic potential is an early and inherent ability rather than late and acquired Predictive power of prognostic signature confirmed in validation series Prognostic profile outperforms clinical parameters ~30-40% reduction of unnecessary treatment and avoidance of undertreatment (LN0 and LN+) Therapeutic Implications Who to treat: Prognostic profile as diagnostic tool Prognostic profile implemented in clinical trials improvement of accurate selection for adjuvant therapy (less under- and over-treatment) reduction in number of patients & costs (select only patients that are at metastatic risk) How to treat: Predictive profile for drug response selection of patients who benefit Commercial Clashes Oncotype DX by “Genomic Health Inc”, Redwood City, CA A prognostic test for breast cancer metastasis based on profiling 250 genes; 16 genes as a group have predictive value; $3,400 per test 215,000 breast cancer cases per year (potential market value > $500 million!) No validation of test; No FDA approval Test has no value for predicting response to treatment Science 2004;303:1754-5 Commercial Clashes Mammaprint marketed by Agendia, Amsterdam, The Netherlands Based on L.Van’t Veer publications Test costs Euro 1650; based on 70 gene signature Prospective trials underway Celera and Arcturus developing similar tests (prognosis/prediction of therapy) Science 2004;303:1754-5 Tissue Microarrays Printing on a slide tiny amounts of tissue Array many patients in one slide (e.g. 500) Process all at once (e.g. immunohistochemistry) Works with archival tissue (paraffin blocks) Gene Expression Analysis of Tumors cDNA Microarray Lakhani and Ashworth Nature Reviews Cancer 2001;1:151-157 Tissue Microarray Alizadeh et al. J Pathol 2001;195:41-52 Histochemical staining of microarray tissue cores of ovarian serous adenocarcinoma H&E hK6 Histochemical staining of a microarray tissue core of ovarian clear cell adenocarcinoma H&E hK6 Histochemical staining of a microarray tissue core of ovarian serous adenocarcinoma H&E hK6 Microarray Future: Conclusions Must go beyond describing differentially expressed genes Inexpensive, high-throughput, genome-wide scan is the end game for research applications Protein microarrays will be deployed within the next few years Publications are now being focused on biology rather than technology SNP analysis-population surveys, SNP map Pharmacogenomics Diagnostics Industrialized biology: Rapid replacement of single-gene experiments CIPHERGEN.com The ProteinChip® Company ProteinChip® Arrays: SELDI affinity chip surfaces (Ciphergen) Reverse Phase Anionic Cationic NR SO4 SO4 Receptor Ligand SO4 NR Enzyme IMAC Normal Phase NR Me(II) Me(II) Me(II) Antibody Protein A/G DNA The SELDI Process and ProteinChip® Arrays • Sample goes directly onto the ProteinChip Array • Proteins are captured, retained and purified directly on the chip (affinity capture • Surface is “read” by Surface-Enhanced Laser Desorption/Ionization (SELDI) ® ) Laser Molecular Weight 100 m2 to 1 mm2 Sample ProteinChip® Array TOF-MS Detection PBS II System 7.5 5 2.5 TOF-MS 2000 Detector Ionized proteins are detected and their mass determined by Time-of-Flight Mass Spectrometry 8000 Serum Fingerprint by Mass Spectrometry Results Classification by Proteomic Pattern Cancer Unaffected New Cluster Unaffected Women No evidence of ovarian cysts Benign ovarian cysts <2.5cm Benign ovarian cysts >2.5cm Benign gynecological inflammatory disorder 2/24 1/19 0/6 0/7 22/24 18/19 6/6 0/7 0/24 0/19 0/6 7/7 Women with Ovarian Cancer Stage I Stage II, III, IV 18/18 32/32 0/18 0/32 0/18 0/32 Petricoin III EF, et al. Lancet 2002;359:572-577 Serum Proteomic Patterns for Detection of Prostate Cancer (Petricoin et al. JNCI 2002;94:1576-1578) Comparison of the actual histopathologic diagnosis following a single sextant biopsy set with the predicted diagnosis from proteomic pattern analysis of patients’ serum samples obtained prior to biopsy Predicted diagnosis by proteomic pattern analysis Actual histopathologic diagnosis N Prostate cancer Stage I Stage II 38 7 31 Benign disease PSA level, ng/mL <4 4 - 10 > 10 75 137 16 Cancer N (%) 36 (95) 7 29 5 (7) 40 (29) 6 (37) Benign N (%) 2 (5) 0 2 70 (93) 97 (71) 10 (63) Petricoin et al. JNCI 2002; 94: 1576-1578 Current Reviews/Opinions/Commentaries Diamandis, EP Clin Chem 2003; 49: 1272-1275 Diamandis EP J Natl Cancer Inst 2004; 96: 353-356 Diamandis EP Mol Cell Proteomics 2004;3:367-78 Other Technological Advances Comparative Genomic Hybridization A method of comparing differences in DNA copy number between tests (e.g. tumor) and reference samples Can use paraffin-embedded tissues Good method for identifying gene amplifications or deletions by scanning the whole genome Comparative Genomic Hybridization Cot1DNA blocks repeats) Label with Cy-3 Label with Cy-5 Nature Reviews Cancer 2001;1:151-157 Comparative Genomic Hybridization Arrayed CGH Same as previous slide but use arrays of BAC clones instead of chromosomes Laser Capture Microdissection An inverted microscope with a low intensity laser that allows the precise capture of single or defined cell groups from frozen or paraffin-embedded histological sections Allows working with well-defined clinical material Tumor Heterogeneity (Prostate Cancer) Tumor Cells: Red Benign Glands: Blue Rubin MA J Pathol 2001;195;80-86 Laser Capture Microdissection LCM uses a laser beam and a special thermoplastic polymer transfer cap (A).The cap is set on the surface of the tissue and a laser pulse is sent through the transparent cap,expanding the thermoplastic polymer. The selected cells are now adherent to the transfer cap and can be lifted off the tissue and placed directly onto an eppendorf tube for extraction (B). Rubin MA, J Pathol 2001;195:80-86 Molecular Profiling of Prostate Cancer Rubin MA, J Pathol 2001;195:80-86 The Future?? Cancer Patient Surgery/Biopsy Cancerous Tissue Array Analysis Tumor Fingerprint Individualized Treatment The Future?? General Population Imaging Multiparametric/miniature testing of serum on a protein array Mass spectrometric serum/urine proteomic pattern generation Screen-positive patients Prevention; Effective Therapy The Future?? Asymptomatic individuals Whole genome SNP analysis Predisposition to certain disease Prevention (drugs; lifestyle) Surveillance Systems Biology A “new” buzzword Aims to explain biological phenomena by combining: * Biology/Medicine * Mathematics * Physics * Engineering * Chemistry * Computer Science See: http://www.systemsbiology.org/ http://systems-biology.org/ Systems Biology Venter Re-Enters Sequencing Craig Venter ……. experimental laboratory dedicated to evaluating breakthrough sequencing technology with the goal of sequencing a person’s genome in a single day for only $1,000 - a fraction of current costs. Nature Biotechnology 2002;20:965 If I want my DNA sequenced…how much would it cost today? Fundraising campaigns often repay donors with mugs, buttons or books as a token of thanks, but DNA sequencer J. Craig Venter is offering something more personal. People who donate $500,000 to his recently formed J. Craig Venter Science Foundation can have their genome analyzed and get the results on a disk. Science 2002;298:947 New slides-updates Mass spetrometric tissue imaging See Nature Med 2001;7:493-496 Prostate Gene Expression Profiles The top 210 genes with a statistically significant difference in expression between prostate cancer and BPH. Data are organized in a matrix format following hierarchical clustering analysis of the 210 genes. Each row represents a single gene; each column represents a prostate sample. Normalized ratios correlating to the abundance of mRNA relative to a common reference are represented by colors; red, down-regulated relative to reference; green, up-regulated relative to reference; black, approximately same as reference. Color saturation represents the magnitude of deviation from the reference. Selected clusters of genes are listed with corresponding gene symbol and IMAGE clone ID. Luo et al. Cancer Res 2001; 61: 4683-4688 Prostate Gene Expression Profiles Overview of experimental procedures for gene expression profiling of prostate tissues. Prostate samples were trimmed and sectioned to enrich epithelial content in each specimen and to facilitate sample homogenization. Total RNA was extracted from the samples and labeled with Cy3-dUTP in a RT reaction. RNA from a pool of two BPH specimens was labeled in parallel with Cy5-dUTP and used as reference sample for all of the 16 prostate cancer and nine BPH samples. Labeled products from the test samples were mixed with the labeled reference and cohybridized to microarrays containing cDNAs for 6500 human genes. Images were scanned, and data were analyzed to study the gene expression patterns. Luo et al. Cancer Res 2001; 61: 4683-4688