Download USE of direct amelogenin gene PCR for sex determination in

USE of direct amelogenin gene PCR for sex determination in forensic
analysis
Archana P.Iyer
Department of Biochemistry
King Abdul Aziz University
Jeddah
Saudi Arabia
[email protected]
Abstract: Sex determination is an important aspect of forensic analysis. PCR based sex determination has recently
developed into a highly effective and quick procedure helping to narrow down on the sex of the suspect. However all
PCR based analyses are preceded by cumbersome and elaborate DNA extraction protocols. Another limiting factor is
the availability of very low amounts of starting material for DNA extraction from crime scenes. In the present study,
we have reported a simple and highly sensitive PCR based sex determination method from various simulated samples.
This method totally circumvents the need for DNA extraction methods and will aid in faster analyses of numerous
samples.
Keywords: PCR, amelogenin, sex determination, forensic analysis
Introduction
Determining the gender of an evidentiary sample can be an important part of casework
analyses. Gender information, particularly when combined with mitochondrial DNA
analysis, can serve to distinguish biological evidence from two people who share the
same DNA type(s) but differ by sex. This can be done based on studying the combination
of sex chromosomes that determine the sex of an offspring; in humans the sex
chromosomes of a normal female are XX and the sex chromosomes of a normal male are
XY (1). Sex determination can be particularly crucial in forensic casework such as rape
cases or cases of missing persons. Biological traces have to be genetically typed and the
classification of the sex is of great importance for further investigations. Sexing of preimplantation embryos can serve as an important tool for improving herd for a desired
purpose. A large number of invasive and noninvasive methods for sexing embryos are
available. However, ideally the technique to be applied should not have any adverse
effect on embryo survivability, its conception rate and subsequent development. Besides,
the technique should be simple and easy to carry out, repeatable, and accurate and time
saving. The polymorphic nature of tandemly repeated DNA sequences that are
widespread throughout the human genome have made them important genetic markers
for gene mapping studies, linkage analysis, and human identity testing . While there are
literally hundreds of STR systems that have been mapped throughout the human genome,
only a few dozen STR loci have been investigated for application to human identity
testing. These STR loci are found on almost every chromosome in the genome and may
be amplified using a variety of polymerase chain reaction (PCR) primers. Tetranucleotide
repeats have been most popular among forensic scientists due to their fidelity in PCR
amplification, although some tri- and pentanucleotide repeats are also in use. Desirable
features for STR systems include a high heterozygosity, a regular repeat unit,
distinguishable alleles, and capability for robust amplification using PCR (2).
Amelogenin is a low-molecular-weight, highly conserved protein found in developing
tooth enamel, and belongs to a family of extracellular matrix (ECM) proteins (3).
Amelogenins are secreted by ameloblasts, and constitute 90% of the enamel organic
matrix. As the proteins are digested and removed, the mineral crystals grow in wellorganized prism patterns. (4)
The genes for amelogenin can be used in sex determination of samples from unknown
human origin through the Polymerase Chain Reaction (PCR). Using primers specific for
intron 1 of the gene, the gene sequence for the intron can be amplified. The X
chromosome gene, AMELX, gives rise to a 106 bp amplification product (amplicon) and
the Y chromosome gene, AMELY, a 112 bp amplicon. Hence, the AMELX contains a 6
bp deletion in the intron 1. Therefore, when the amplicons are run on an agarose gel,
samples from male sources (XY) will show two bands on an agarose gel (one for the 106
bp fragment and one for the 112 bp fragment), while females (XX) will show only one
band. Thus, this process allows for sex determination of unknown samples. (5)
Material and Methods
Sample preparation: Volunteers (both male and female were asked to spot their blood on
cloth and wood table surfaces. The spots were left to dry overnight. Using sterile swabs,
the dried blood was collected in eppendorf tubes containing 200 uL lysis buffer (0.5%
Tween and 200 mM KCl). The tubes were boiled at 95 C for 20 mins, centrifuges at
10,000 rpm for 5 mins and 10 uL of the supernatant was used directly for PCR. Similarly
hair samples with follicles were collected from male and female volunteers. Saliva also
was collected and the samples were processed in lysis buffer as mentioned above. Whole
blood collected from the volunteers was also used as a control to verify the sex
determination results.
PCR for amelogenin gene was set up using the forward primer
5’CCCTGGGCTCTGTAAAGAATAGTG3’
and
reverse
primer
5’ATCAGAGCTTAAACTGGGAAGCTG3’. The reaction mix contained 10 µL of the
supernatant from each of the samples processed, 20 pm of each of the primers, 200 µM
dNTPs, 1x Taq polymerase buffer (containing 1.5 mM MgCl2) and 0.75 U of Taq
polymerase in a final volume of 25 µL. The thermo-cycling conditions were: 95 for 4
min, and 30 cycles of 94 for 30 s, 65 for 30 s, 72 for 30 s, and finally 72 for 7 min. The
PCR products 106/112 bp for males (XY) and 112 bp (XX) for females were separated
on 3% agarose gel.
Results
We were able to identify males and females from all the simulated samples such as dried
blood spots, saliva and hair based on the 106/112 bp fragments for the XY males and the
single 106 bp fragment for the XX females. The bands were compared to the bands
obtained from whole blood. A clear distinction between the sexes was obtained using the
PCR.
Figure 1
PCR for differentiation between XX females and XY males from various samples
Lane 1 : XY DNA from whole blood
Lanes 2,5,6 & 8 : XY DNA from dried blood spot
Lanes 3 & 9 : XY DNA from saliva
Lane 4: XX DNA from whole blood
Lane 7: XX DNA from dried blood
M - marker
Discussion
The amelogenin XY gene specific PCR yields 112 bp product from the Y chromosome
and 106 bp product from the X chromosome. The expected product sizes were obtained
with DNA extracted from males and females. In a bid to circumvent the need for
elaborate DNA extraction protocols, we used whole blood, blood stains on cloth and
furniture, saliva, hair fragments and nails as samples and boiled them in a solution of
Triton X-100 or Tween 20 at 95 C for 20 mins and used the supernatant as templates for
the PCR. The expected size products were obtained and a clear distinction of sexes could
be made from the bands obtained. The samples used were decided upon based on
simulations to a crime scene where evidence is mostly obtained in the above forms. This
study clearly shows that the PCR is highly sensitive and reliable and a clear cut sex
differentiation could be made using very little starting material and without DNA
extraction. This protocol would pave the way for faster and less cumbersome analyses of
multiple samples within a short span of about 3 hours.
References
1. Ostler S, Sun A. Fetal sex determination: the predictive value of 3 common myths.
CMAJ 1999; 161(12): 1525-1526.
2. Ross J, Parson W, Furac I, Kubat M, Holland M. Multiplex PCR amplification of
eight STR loci in Austrian and Croatian Caucasian populations. Int J Leg Med 2001;
115(1): 57-60.
3. Brinkmann B. Is the amelogenin sex test valid? Int J Legal Med 2002; 116(2): 63.
4. Mannucci A, Sullivan KM, Ivanov PL, Gill P. Forensic application of a rapid and
quantitative DNA sex test by amplification of the X-Y homologous gene amelogenin. Int
J Leg Me 1994; 106: 190-193.
5. Mitchell, R. J., Kreskas, M., Baxter, E., Buffalino, L., and van Oorschot, R. A. (2006)
An investigation of sequence deletions of amelogenin (AMELY), a Y-chromosome locus
commonly used for gender determination. Ann.Hum Biol. 33(2): 227-240