Download Substrate

Supporting Information
Appendix S1:
Experimental procedures
Microorganisms and culture conditions. Microorganisms were obtained from culture
collections or selected from soil as previously described (Miyadera and Imura, 1999; Sato
et al., 2007). In particular, Bacillus cereus ATCC 14579 was obtained from American
Type Culture Collection and grown aerobically on Luria-Bertani (LB) medium.
Thermoanaerobacter tengcongensis MB4T was obtained from DSMZ, Braunschweig,
Germany, strain number 15242. It was grown in 100 ml of DSMZ-medium #965 and
trace elements solution #141 at 70 °C under anaerobic condition for 3 days. E. coli strains
BL21 and DH5α were from Novagen or Invitrogen.
Chemicals. 2-Benzyloxy-propionic acid ethyl esters (BnLAE) were prepared from lactic
acid ethyl ester and benzyl chloride and provided by Daiichi Pharmaceuticals Ltd., as
either a racemic mixture or purified enantiomers. All other chemicals were of the highest
purity commercially available.
Enantioselective resolution of racemic BnLAE. The enantiomeric ratio E, a measure
for the selectivity of an enzymatic resolution, was calculated through the remaining
substrate enantiomeric excess (e.e.) and the extent of conversion based on an internet
program (http://www-orgc.tu-graz.ac.at/. Chen et al., 1982). The enantiomeric excess
was determined by HPLC (Waters Millenium System) using a Chiralcel OJ column with
the following conditions: isocratic elution, n-hexane/2-propanol (50/50); flow rate: 0.5
ml/min; detection at 220 nm; run time: 20 min.
Cloning of BcEST-encoding gene. Genomic DNA of B. cereus ATCC 14579 was
prepared by the method of Wilson (1994). Degenerate primers for the amplication of the
esterase-encoding gene were designed based on the codon usage of the B. cereus
penicillin-binding protein 3 gene (Miyamoto et al., 2002) and B. cereus benzil reductaseencoding genes (Kanaya et al., 1999, Maruyama et al., 2001 and 2002). The following 4
primers were synthesized:
NT1 (29-mer, based on the N-terminal sequence: MIKPATMEFV):
5’-ATGAT(T/A)AA(A/G)CC(T/A)GC(T/A)AC(A/G)ATGGA(A/G)TT(T/C)GT;
FR1 (29-mer; based on the complementary sequence of part of the internal sequence:
EEIAQDPVQI)
5’-ATTTG(T/A)AC(T/A)GG(A/G)TCTTG(A/T)GC(A/T)AT(T/C)TC(T/C)TC;
FR2: 21-mer, based on the complementary sequence of the internal sequence:
DTDGQPI):
5’-(A/T)AT(T/A)GGTTG(A/T)CC(A/G)TC(T/C)GT(A/G)TC;
and FR3 (21-mer, based on the complementary sequence of part of the internal sequence:
YYRTVWN)
5’-ATTCCA(T/A)AC(T/C)GT(A/G)CG(A/G)TA(A/G)TA.
200 ng of B. cereus DNA and 2.5U rTaq DNA polymerase (Amersham Biosciences #270798-05) were mixed in a total volume of 50µl 10X buffer (500 mM KCl, 15 mM MgCl2,
100 mM Tris-HCl, pH 9) containing 250 µM of dNTP and 15 pmole of each primer set
(NT1-FR1, NT1-FR2, NT1-FR3). The thermal cycling profile was: 1x 2 min at 94ºC,
followed by 25x 94ºC, 1 min; 52ºC, 1 min; 72ºC, 2 min (Perkin Elmer 9600).
The primer pairs NT1-FR1 and NT1-FR3 amplified an estimated 500-bp and 560-bp
fragments, respectively. No result was obtained by the NT1-FR2 combination,
subsequently attributed to a miscall in the peptide sequence (DTDGQPI to DTNGQPI)
and hence poor primer design. Sequencing of the NT1-FR3 amplified fragment
established a 549-bp DNA sequence that encompasses the peptide regions of FR1 and
FR2.
For Southern hybridization, genomic DNA of B. cereus was digested with AvaI,
BamHI, EcoRI, HincII, HindIII, KpnI, PstI, SacI, SalI, SmaI, SphI and XbaI. Southern
hybridization was carried out using a 560-bp NT1-FR3 PCR-amplified fragment that was
labeled by random primed DNA labeling using dioxigenin-dUTP as probe. Conditions of
hydridization were: pre-hybridization 1 hr at 65ºC and hybridization o/n at 65ºC, in
standard buffer: 5x SSC, 0.1% N-lauroylsarcosine, 0.02% SDS, 1% blocking reagent
(#1096176 from Roche Applied Science) dissolved in maleic acid buffer (100 mM maleic
acid, 150 mM NaCl, pH 7.5). Probe-target hybrids were detected by an enzyme-linked
immunoassay specific to dioxigenin as described by the manufacturer. The results were
recorded on a X-ray film.
An ~8-kb HindIII fragment from B. cereus was chosen for cloning. The vector and E.
coli strain used were pGEM3zf (3.199-kb) and DH5α, respectively. The resulting
recombinant plasmid of 10.5-kb length was designated pGEMHindIII#2. Using the
available and new synthetic primers, the esterase gene was sequenced at first, and then
the entire fragment. Fluorescence DNA sequencing was carried out using the ABI Prism
377 sequencer and using the Big Dye Terminator Cycle Sequencing v.2 Ready Reactions
(Applied Biosystems).
Construction of overexpression clone of the BcEST-encoding gene. Sub-cloning of
the esterase gene was carried out using the pSD80 expression vector (Smith et al., 1996).
The gene was amplified using the following primers and pGEMHindIII #2 as template.
ABHYD1
5’ CCGGAATTCATGATTAAGCCTGCAACAATGGA
ABHYD2
5’ CCCAAGCTTATATCCAACACTTCTCATTT
The underlined sequences indicate the EcoRI and HindIII recognition sequence,
respectivley. ATG signifies the initiator codon of the esterase. After amplification, the
930-bp fragment was digested with EcoRI and HindIII. The fragment was purified with
QiaEXII and ligated to pSD80 that was digested with EcoRI-HindIII. The resulting
plasmid was designated pBcEST in the host strain E. coli BL21.
Error-prone PCR of BcEST. A library of clones was constructed using random point
mutagenesis following a slightly modified protocol for error-prone PCR described by
Zhao et al. (1999). The obtained PCR-products were purified using QiaEXII, digested
with EcoRI and HindIII and transformed in E. coli BL21 (DE3). Successfully
transformed cells were transferred in a sterile masterblock (2ml 96-well deep well plates)
containing LB medium and ampicillin (100µg/ml) and grown overnight at 37°C. These
cells were then used to inoculate another set of 96-well plates which contained the same
medium. After 3 hours of growth at 37°C, they were induced by adding 1mM IPTG.
Aliquots of induced cells were heat treated in a thermocycler using the following thermo
profile: 30 min at 53°C, 5 min at 4°C, and 10 min at 25°C. Remaining esterase activity
was measured in sodium phosphate buffer (25 mM, pH 7) containing bromothymol blue
and substrate (S-BnLAE). The color change from blue to yellow due to free acid formed
indicated enzyme activity.
A second round of error-prone PCR was performed with the transformants with
improved thermostability using the same protocol, but enzyme activity was measured
after incubation at 55°C (30 min).
Cloning of TtEST-encoding gene. Genomic DNA of T. tengcongensis MB4T was
prepared accordingly and amplified using the following primers:
TtEST3 NdeI: 5’-GGGAATTCCATATGTGTAGAGTAATATATAAAA and
TtEST2 HindIII: 5’-CCCAAGCTTTTATCTCCTCCCCTATTTCTCAA.
The bold nucleotides are the NdeI and HindIII sites, respectively. The underlined
sequences indicate the initiator codon and the complement of the termination codon of
TtEST, respectively. For gene amplification, 100 µl PCR reaction contained 10 µl of 10x
thermopolymerase buffer (New England Biolabs Inc), 200 µM of each dNTP, 30 pmole
of each of two primers, 5 µl of genomic DNA, 5 U Taq DNA polymerase (New England
Biolabs, Beverley, MA) and water. The reaction was started by heating (96 °C for 2 min),
followed by 25 cycles of the following thermal profile: 94 °C for 1 min, 54 °C for 1 min
and 72 °C for 2 min. The PCR mixture was migrated on an 0.8 % agarose gel and the
929-bp fragment was isolated and purified with QIAEXII. The purified PCR fragment
and pET17b vector (Novogen) were digested with NdeII and HindIII and subsequently
ligated and transformed in CaCl2 competent-BL21 cells. The resulting plasmid (4.235-kb)
pETTtEST was analyzed on a 0.8 % agarose gel and the insert was sequenced
accordingly.
Growth conditions and cell disruption of Escherichia coli BL21. E. coli BL21(DE3)
harboring pETTtEST and pLysS plasmid and E. coli BL21(DE3) harboring pBcEST
(including its mutants EH5and I2C12) were maintained on LB media containing glycerol
(50 %, vol/vol) at –80 °C. For protein expression experiments, a fresh LB-agar plate (1.5
% Agar agar) containing either ampicillin (50 µg/mL) (BcEst) or ampicillin (50 µg/mL)
and chloramphenicol (35 µg/mL) (TtEST) was prepared from the respective stock culture
and one colony was transferred to a 10 ml preculture (LB medium containing the same
antibiotics) and grown overnight. Main cultivation was carried out in 2-liter Erlenmeyer
flasks containing 1 litre LB medium and antibiotics using 3 mL of the preculture. Cells
were grown at 37 °C to an OD600 of approximately 0.6 and BcEST and TtEST production
was induced by addition of IPTG (1 mM). About 3 hours after induction, the cells were
harvested by centrifugation (5,000 x g, 20 min, 4 °C) and washed twice with 50 mM
sodium phosphate buffer (pH 7.0). The pellet was resuspended in the same buffer and
crude extract obtained by passing the cell suspension twice through a French pressure cell
(SLM Instruments, Urbana, Ill.) operating at 20,000 psi followed by centrifugation
(20,000 x g, 30 min, 4°C) to remove unbroken cells and debris.
Enzymatic assays and kinetics. Initially, the esterase assay using whole cells was
carried out in a mixture that either consisted of: (R)-BnLAE, (S)-BnLAE or a racemic
mixture (2 mg in methanol), 25 mM sodium phosphate buffer pH 7 (250µl), 0.1% bromo
thymol blue solution (20µl of 0.5% stock in ethanol and diluted 5x in H2O) and culture of
organism (50µl). This procedure was followed in the epPCR experiment. Subsequently, a
modified activity assay was introduced. This 1-ml reaction assay consisted of Tris-HCl
buffer (2 mM, pH 8.0), 4 µL of phenol red (0.5 % in ethanol), an appropriate amount of
enzyme, and the reaction was started by adding 2 µl of BnLAE substrate. Either pure
enantiomers or a racemic mixture were used. Due to the release of free acid by an active
esterase, a drop of pH leading to a color change from red to yellow can be followed
spectrophotometrically by measuring a decrease in A558 nm and an increase in A435 nm (Fig.
S6). The change in A435 nm is directly proportional to the release of free acid from the
substrate. A standard curve using HCl (0-400µM) was recorded at 435 nm and used to
quantify the enzyme activity. Specific activity was defined as µmole acid produced per
minute (U) per mg of protein (U/mg).
Alternatively, for quantification of the enzyme activity, a reaction mixture of 20 mL
was prepared containing Tris-HCl buffer (2 mM, pH 8.0) and 5 µL of R,S-BnLAE. The
reaction was started using an appropriate amount of enzyme and the pH was maintained
by adding 0.1 M NaOH using an automated pH titration system (Titrator TTT80,
Autoburette ABU80, Titrigraph module REA160, pH stat unit REA 270; Radiometer,
Copenhagen, Denmark). Specific activity was defined as µmole NaOH per minute (U)
used for neutralization of produced acid per mg of protein (U/mg).
Kinetic parameters of the esterases (Km and kcat) were determined by using the doublereciprocal transformation (Lineweaver-Burk plot) of the Michaelis-Menten equation
under steady-state conditions. Initial reaction rates were measured at 25 °C in Tris-HCl
buffer (2 mM, pH 8.0) by using a substrate concentration between 0.1 mM and 10 mM.
Protein purification. Crude extract, containing the respective esterase (BcEST, EH5,
I2C12, and TtEST), was loaded onto a DEAE-Sepharose FF column (XK16/20)
previously equilibrated with 50 mM sodium phosphate buffer, pH 7.0 (buffer A). The
column was washed with the same buffer and the enzyme was eluted using a linear
gradient of 0-200 mM NaCl in buffer A. Active fractions were collected, pooled, and
solid ammonium sulfate (AS) was added to give a final concentration of 20 %. The
enzyme containing solution was subsequently applied to a Butyl-S Sepharose 6 FF
column (XK 16/20) previously equilibrated with 20 % AS in buffer A and washed first
with the same buffer followed by buffer A. Using these conditions, the esterases
remained on the column and were eluated by a linear gradient of buffer A to distilled
water. Active fractions were collected, pooled and concentrated by ultrafiltration (YM 10
membrane, 50 mL stirring cell, Amicon, USA). If necessary, the enzyme was further
purified by application to a Superose 12 HR (10/60) gel filtration column previously
equilibrated with buffer A containing 150 mM NaCl. Protein was eluated with the same
buffer (flow rate of 1 mL/min) and collected in 0.5 ml fractions. Active fractions were
pooled and concentrated by ultrafiltration.
Protein analysis. The protein concentration was determined by Bradford method
(Bradford, 1976) or alternatively by a micro-Biuret method (Itzhaki and Gill, 1964).
Bovine serum albumin was used as protein standard. During purification, protein
concentration was estimated by measuring the absorption at 280 nm. Gel electrophoresis
was performed in 10% or 12% polyacrylamide containing 0.1 % SDS (Laemmli, 1970).
The SDS-gels were silver stained (Marcinka et al., 1992) or by conventional Coomassie-
blue. The molecular mass of the native enzyme was determined by gel filtration on a
Superose 12 column calibrated by protein standards available from Pharmacia (Sweden)
or Bio-Rad (USA).
Determination of amino terminal sequence. Purified enzyme was separated by SDSgel electrophoresis and blotted to a polyvinylidene difluoride (PDF) membrane (Bio-Rad,
USA). Amino-terminal amino acid sequence determination was performed with a
sequencer (473A; Applied Biosystems) by the Edman method. Phenylthiohydantoin
amino acids were analyzed by HPLC with a reversed-phase column (Edman and
Henschen, 1975).
Determination of pH, temperature optimum, and thermostability of esterases. For
all esterases, enzyme activity was assayed using (R,S)-BnLAE as substrate in Tris-HCl
buffer (50 mM, pH 7.5, 8.0, 8.5, 9.0) and Na-Glycine buffer (50 mM, pH 9.0, 9.5, 10.0,
10). For estimation of the temperature optimum Tris-HCl buffer (50 mM, pH 9.0) was
preheated and kept at the desired temperature, and enzyme and substrate were
subsequently added. Enzyme activity was calculated using the previously described
HPLC method.
To test the thermostability of the respective esterase, enzyme preparations were
incubated at the desired temperature for variable times, subsequently chilled on ice, and
the remaining enzyme activity was determined by HPLC.
Circular dichroism spectra. Circular dichroism (CD) spectra were recorded in the far
UV (200-250 nm) using a Jasco J-810 spectropolarimeter (Jasco International Co., Ltd.,
Tokyo, Japan) connected to a thermostat with samples of purified protein (200 µl, 0.75
mg/ml) in 10 mM sodium phosphate buffer (pH 7.0) placed in a circular quartz cell (path
length of 0.05 cm). To study thermal unfolding of the proteins, ellipticity of the samples
(1.5 mg/ml) was monitored between 20 °C and 90 °C at a scan rate of 40 °C per hour at
222 nm.
Thermodynamics of the enzyme-catalyzed reaction. The thermal properties of an
enzyme consist of its activation energy (Ea) and its thermal stability. The optimum
temperature of an enzyme catalyzed reaction can be described as an effect of temperature
on the catalytic reaction (kcat) and the irreversible inactivation of the enzyme catalyst (kd,
first order rate constant of denaturation) which will both increase with increasing
temperature and also depends on the duration of the assay.
The Arrhenius equation describes the dependence of the rate constant of the reaction
on the temperature and the activation energy. (1) k = Ae –Eα/RT which can be transformed
to ln (k) = -Eα/R x 1/T + ln (A) where A is the Arrhenius or prefactor, and R is the gas
constant (1.98 cal K-1 mol-1). The activation energy for the enzyme catalyzed reaction
was estimated by plotting ln kcat vs. T-1 and calculating the slopes of the linear regression.
In a catalytic reaction the enzyme and the substrate form a complex which has to be
activated in order to release the product and free enzyme. The free energy of activation
(G‡) which describes the “energy barrier” of the reaction must be added to generate this
activated complex (Low et al., 1973). To calculate the free energy of activation the
following equations were used (Lehrer et al., 1970):
(1)
G‡ = H‡ -T S‡
(2)
H‡ = Ea – RT
(3)
S‡ = 4.576 (log kcat – 10.753 – log T + Ea/4.576 T)
(H‡ is the enthalpy, and S‡ the entropy of activation)
Computational Methods. The homology models of BcEST and TtEST were built with
Swiss Model (Arnold et al., 2006) using 1VA4, 1U2E, and 1A8Q as template PDB files.
Amino acid alignments were done using T-Coffee (Notredame et al., 2000) and imported
into Deep View for delivery to the Swiss Model servers. Four short insertions relative to
the template structures were not included in the BcEST model (G129-G132, A164-A169,
P194-Y197 and H226-Q235). The homology model of BcEST was further refined by
conjugate gradient energy minimization using the AMBER molecular mechanics forcefield (Cornell et al., 1995).
References:
Arnold K., Bordoli L., Kopp J., and Schwede T. (2006). The SWISS-MODEL
Workspace: A web-based environment for protein structure homology modelling.
Bioinformatics 22:195-201.
Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:
248-254.
Chen, C.-S., Fujimoto, Y., Girdaukas, G., and Sih, C.J. (1982) Quantitative analyses of
biochemical kinetic resolutions of enantiomers. J Am Chem Soc 104: 7294-7299.
Cornell, W.D., Cieplak, P., Bayly, C.I., Gould, I.R., Merz, K.M., Ferguson, D.M.,
Spellmeyer, D.C., Fox, T., Caldwell, J.W., and Kollman, P.A. (1995) A second
generation force field for the simulation of proteins, nucleic acids, and organic
molecules. J Am Chem Soc 117: 5179-5197.
Edman, P. and Henschen, A. (1975) Sequence determination. p. 232-279. In S. B.
Needleman (ed.), Protein sequence determination. A source book for methods and
techniques. 2nd ed., Springer-Verlag KG, Berlin, Germany.
Itzhaki, R. F., and Gill, D. M. (1964) A micro-biuret method for estimating proteins.
Anal. Biochem 9: 401-410.
Kanaya, S., Yamada, Y., Kudo, Y., and Ikemura, T. (1999) Studies of codon usage and
tRNA genes of 18 unicellular organisms and quantification of Bacillus subtilus
tRNAs: gene expression level and species-specific diversity of codon usage based on
multivariate analysis. Gene 238:143-155.
Kumar, S.,Dudley, J., Nei, M., and Tamura, K. (2008) MEGA: A biologist-centric
software for evolutionary analysis of DNA and protein sequences. Brief Bioinform 9:
299-306.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227:680-685.
Lehrer, G.M., and Barker, R. (1970) Conformational changes in rabbit muscle aldolase:
Kinetic studies. Biochemistry 9:1533-1540.
Low, P.S, Bada, J.L., and Somero, G.N. (1973) Temperature adaptation of enzymes: roles
of the free energy, the enthalpy, and the entropy of activation.. Proc Nat Acad Sci
70:430-432.
Marcinka, K., Roehring, C. and Kluge, S. (1992) Changes in protein patterns of pea
plants systematically infected with red clover mottle virus. Biochem.Physiol Planz
188:187-193.
Maruyama, R., Nishizawa, M., Itoi, Y., Ito, S. and Inoue, M. (2001) Isolation and
expression of a Bacillus cereus gene encoding benzil reductase. Biotechnol Bioeng
75: 630-633.
Maruyama, R.,. Nishizawa, M, Itoi, Y., Ito, S., and Inoue, M. (2002) The enzymes with
benzil reductase activity conserved from bacterial to mammals. J Biotechnol 94:157169.
Miyadera, A., and Imura, A. (1999) Enantioselective synthesis of a key intermediate of
Levofloxacin using microbial resolution. Tetrahedron: Asymmetry 10: 119-123.
Miyamoto, T., Sayed, M.A., Sasahara, R., Sukimoto, K., Umezaki, A., Honjoh, K., Iio,
M., and Hatano, S. (2002). Cloning and overexpression of Bacillus cereus penicillinbinding protein 3 gene in Escherichia coli. Biosci Biotechnol Biochem 66: 44-50.
Notredame C., Higgins D.G., and Heringa J. (2000) T-Coffee: A novel method for
multiple sequence alignments. J Mol Biol 302:205-217.
Wilson, K. 1994. Preparation of genomic DNA from bacteria. p. 2.4.1-2.4.5. In F. A.
Ausubel, R. Brent, R. E. Kingston, D. D. Moore,J. G. Seidman, J. A. Smith, and K.
Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New
York, N.Y.
Sato, K., Yagi, T., Kubota, K. and Imura, A. (2007) Process for preparation of optically
active propoxyaniline derivatives (US Patent 7217560).
Smith, S. P., Barber, K. R., Dunn, S. D. and Shaw, G. S. (1996) Structural influence of
cation binding to recombinant human brain S100b: evidence for calcium-induced
exposure of a hydrophobic surface. Biochemistry 35:8805-8814
Zhao H., Moore J.C., Volkov, A.A., and Arnold, F.H. (1999) Methods for optimizing
industrial enzymes by directed evolution. In Demain, A.L. and Davies, J.E. (eds)
Manual of Industrial Microbiology and Biotechnology. ASM Press, Washington.D.C.
pp.597-604.
Fig. S1.
Coomassie blue-stained protein gel of E. coli crude extracts separated on SDS-10%
PAGE. Size markers are as indicated in kDa; Lane 1. E.coli BL21 non-induced; 2.
pSD80, non-induced; 3. pSD80 induced 4 hr; 4. pBcEST 3 hr induction (supernatant); 5.
same as 4 (pellet); 6. pBcEST 4hr induction (supernatant); 7. same as 6 (pellet).
Fig. S2. Phylogenetic analysis of BcEST. The Genbank accession numbers for the
respective proteins, annotated as either alpha/beta fold family hydrolaase, 3-oxoadipate
enol-lactonase, or in some unnamed protein product or conserved hypothetical protein,
are as follows: (1) ACK89548.1 (2) AAP27115.1 (3) AAS42215.1 (4) ACM13522.1 (5)
AU17266.1 (6) AAT62319.1 (7) ACO28098.1 (8) ABY44194.1 (9) ACK96374.1 (10)
BcEST (GQ243224) (11) ACK59771.1 (12) ABS22367.1 (13) ABX31253.1 (14)
ACB86291.1 (15) ABV38133.1 (16) ABZ77297.1 (17) ACL19790.1 (18) ABX81126.1
(19) TtEST (AAM23832.1) (20) EAS01633.1 (21) EAR92522.1 (22) CAK56695.1 (23)
BAH42062.1 (24) BAD39794.1 (25) ACL97306.1 (26) AAK25687.1 (27) ABI78668.1
(28) ABC62566.1 (29) ABS62973.1 (30) ABN96204.1 (31) ABG91905.1 (32)
BAH48442.1 (33) ABK68474.1 (34) ABM15056.1 (35) ABP44844.1 (36) ACB02466.1
(1U2E) (37) ACC84816.1 (38) AAB60168.1 (1VA4) (39) AAC43253.1 (1A8Q). The
tree was generated using MEGA4 (Kumar et al., 2008).
Comparison of stability of BcEst and mutants
100
90
Relative Activity (%)
80
70
60
50
40
BcEST
EH5
2IC12
30
20
10
0
0
5
10
15
20
Time of treatment at 55 °C (min)
Comparison of stability of BcEst and mutants
100
90
BcEst
EH5
2IC12
Relative Activity (%)
80
70
60
50
40
30
20
10
0
0
5
10
15
Time of treatment at 60 °C (min)
Fig. S3.
20
Fig. S4a.
5.0
f(x) = -3.2274x + 14.4338
f(x) = -3.2021x + 14.3806
f(x) = -3.0590x + 13.9337
4.5
ln v
BcEst
EH5
2IC12
Ea = 6.4 kcal mol-1
4.0
Ea = 6.3 kcal mol-1
Ea = 6.1 kcal mol-1
3.5
3.0
3.1
3.2
1/T (K-1) x 103
3.3
Fig. S4b.
2.4
f(x) = -2.4 x + 9.535
2.2
2.0
ln v
TtEST
1.8
1.6
Ea = 4.8 kcal mol-1
1.4
1.2
3.0
3.1
3.2
1/T (K-1) x 103
3.3
3.4
Fig. S5.
-48
-56
-50
-52
-58
BcEST
EH5
2IC12
TtEST
-56
-60
-58
-60
-62
-62
-64
-64
-66
-68
-66
20
25
30
35
40
45
50
55
60
65
Temperature (°C)
70
75
80
85
90
CD (222 nm)
CD (222 nm)
-54
Fig. S6
A
B
1.2
0.20
558 nm
435 nm
1.0
0.15
4 replica
linear regression
A435
Absorbance
0.8
0.6
0.10
0.4
0.05
0.2
0.0
0.00
400
450
500
550
600
(nm)
0s
30 s
60 s
90 s
120 s
150 s
0
50
100
150
200
250
300
350
400
HCl (µM)
180 s
210 s
240 s
270 s
Colorimetric assay of esterase activity using Phenol-Red. (A) Time course of enzymeinduced color shift of Phenol-Red, (B): Standard curve for the quantification of
enzymatic reaction. (C) linear increase of A435 nm over time due to esterase activity.
Absorbance (435 nm)
0.15
Esterase activity (5 replica)
Regression
0.10
0.05
0.00
0
30
60
90
Time (s)
120
150
180
Table S1. Comparison of the substrate specificity of BcEST and TtEST
Substrate
Spec. Activity (U/mg)
BcEST
TtEST
(B. cereus)
(T. tengcongensis )
1-Naphthylacetate
1.8
2.6
1-Naphthylbutyrate
3.8
2.4
Indoxylacetate
1.4
1.2
4-Methylumbelliferyl butyrate
n.d.1
0.6
4-Methylumbelliferyl caprylate
-2
0.5
4-Methylumbelliferyl hexanoate
-
0.4
p-Nitrophenyl acetate
n.d
0.9
p-Nitrophenyl butyrate
n.d.
0.8
Methyl cinnamic acid
-
0.007
Tributyrin
-
-
1)
not determined , 2) no detectable activity