* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA and the Genome
Biochemistry wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Non-coding RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genome evolution wikipedia , lookup
Genetic code wikipedia , lookup
Molecular cloning wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Community fingerprinting wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Gene expression wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Silencer (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Biosynthesis wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Molecular evolution wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Higher Biology Unit 1 DNA and the Genome Pupil Name and Class Learning Intentions 1. The structure and replication of DNA Structure of DNA Nucleotides are composed of deoxyribose sugar, phosphate and a base. Nucleotides join together to form a sugar–phosphate backbone. Base pairing occurs between the two strands of DNA between adenine, thymine and guanine, cytosine. These base pairs bond by weak hydrogen bonds. The DNA helix is double stranded, and has an anti-parallel structure, with deoxyribose and phosphate at 3' and 5' ends of each strand. Organisation of DNA in different organisms Circular chromosomal DNA and plasmids can be found in prokaryotes. Circular plasmids can be found in yeast Circular chromosome can be found in mitochondria and chloroplasts of eukaryotes. Linear chromosomes can be found in the nucleus of eukaryotes. This DNA is tightly packaged with associated proteins. Replication of DNA Prior to cell division DNA is replicated by DNA polymerase. A primer is required to start replication. DNA is unwound and unzipped to form two template strands. This process occurs at several locations o the DNA molecule. DNA is replicated by DNA polymerase in only one direction; adding complementary nucleotides to the deoxyribose (3') end of a DNA strand. Fragments of DNA are joined together by ligase. Polymerase chain reaction (PCR) PCR is the amplification of DNA (in vitro) using complementary primers for specific target sequences at the two ends of the region to be amplified. The stages in the process of PCR The applications of PCR Structure of DNA Key Concepts DNA is inherited. DNA is the genetic material of living things. DNA is located within the nucleus of all cells apart from red bl ood cells. DNA is a long chemical sequence and this sequence contains the information needed for that living thing to develop, survive and pass its genetic information on to the next generation. The DNA chemical sequence differs between individuals. The pattern of this sequence is called the genotype. DNA is composed of two polynucleotide chains. Nucleotides consist of a sugar, phosphate and base. Nucleotides bond to form a sugar–phosphate backbone. The two polynucleotide chains run antiparallel, with a deo xyribose sugar at the 3′ end and a phosphate group at the 5′ end. The nucleic acid bases are paired by hydrogen bonding in the centre to form a double helix. Base pairing is specific, with adenine pairing with thymine and cytosine pairing with guanine. DNA Structure Two strands of nucleotides twisted into a right-handed double helix The three components of nucleotides are: The bases are termed adenine, thymine, guanine and cytosine. The sugar is a deoxyribose with a pentameric (five-membered ring). Phosphate Phosphate group Deoxy-ribose sugar Base - adenine guanine- cytosine - thymine - uracil Nucleotide structure These are defined by their ring structures. The purine-containing nucleotides are guanine and adenosine and the pyrimidine-containing nucleotides are cytosine and thymine. Pairing occurs through hydrogen bonds. The G–C bonds are stronger as there are three such bonds. The A–T bonds are weaker as there are two such bonds. The sugar–phosphate backbone Backbone is composed of alternating sugar and phosphate molecules. Sugar is joined to the phosphate group by ester bonds. This type of bonding is termed phospho-diester bonding. These are strong covalent bonds. Anti-parallel Nature The molecule is anti-parallel and the pentameric ring structures point in opposite directions on each strand. Phosphodiester bond links carbon 5’ to carbon 3’ on next nucleotide Organisation of DNA in different organisms Key concepts DNA exists in very long molecules that are packaged and organised in cells. The organisation of DNA is different in prokaryotes and eukaryotes. Prokaryotes usually have a single circular chromosome. Eukaryotes usually have several linear chromosomes, which are packaged. Eukaryotic cells also contain mitochondrial DNA, and chloroplast DNA in green plants. The DNA in chromosomes undergoes four stages of packaging to achieve the most condensed state, seen during metaphase. DNA combines with proteins to achieve its packaged state. In the cells of both prokaryotes and eukaryotes DNA is organised into structures called chromosomes. In eukaryotes these are linear and numerous, whereas in prokaryotes there is usually a single circular chromosome. Prokaryotes are a domain of organisms comprising the bacteria and cyanobacteria, characterized by the absence of a distinct, membrane-bound nucleus or membrane-bound organelles, and by DNA that is not organised into chromosomes. Eukaryotes are a domain of organisms having cells each with a distinct nucleus within which the genetic material is contained. Eukaryotes include fungi, plants, and animals. Replication of DNA Prior to cell division DNA is replicated by DNA polymerase. Briefly the stages in DNA replication are: 1. A primer is required to start replication. 2. The DNA molecule unwinds 3. The DNA molecule unzips (as the weak hydrogen bonds, between complementary bases, break). This happens at several locations along the DNA molecule. Helicase is the name of the enzyme involved. 4. Free DNA nucleotides align themselves with their complementary nucleotide on the open chain at deoxyribose 3’ end. 4. New weak hydrogen bonds form between complementary bases (remember A-T, G-C). 5. The other strand of DNA is copied in sections (fragments) and is called the lagging strand. 6. Adjacent new nucleotides are linked through the sugar and phosphate molecules by strong chemical bonds to form the “backbone” of the new strand. 7. Fragments of DNA are joined together by ligase. 8. The new molecule winds up into a double helix. Polymerase Chain Reaction Key concepts Small sections of DNA can be replicated in vitro using the PCR. PCR manipulates the natural process of DNA replication. PCR is now an automated technique widely used in many areas of research and industry. PCR requires template DNA, Taq polymerase, di-deoxynucleic acids with each of the four DNA bases, Mg 2+ , primers and a buffer. PCR involves continuous and repeated cycles of heating and cooling. PCR is a fundamental and everyday technique in many laboratories, whether used by academia, industry or government. PCR is a valuable analytical tool and is routinely used for research purposes; diagnosing diseases, be they inherited or infectious, genetic fingerprinting, paternity cases, forensics, quality assurance in the food industry and even molecular archaeology. However, because of its incredible sensitivity scrupulous precautions have to be taken to keep unwanted DNA out of a reaction mixture. The technique PCR was developed by Kary Mullis in the mid 1980s, revolutionising molecular biology. He received the Nobel Prize for chemistry for its conception in 1993. The technique enables specific sections of DNA to be amplified (replicated) in vitro, producing millions of copies from a DNA template. Mullis developed the technique manually, and it can still be carried out using water baths. However, the technique is now fully automated in laboratories, using thermal cyclers no bigger than a bread machine. From a single piece of DNA, PCR is capable of making billions of copies of a particular sequence. This relies on all the ingredients needed for DNA replication being present: the target sequence, or template DNA, free deoxynucleotides, DNA primers and heat -stable DNA polymerase such as Taq polymerase. Typically the primers are about 8-15 nucleotides long and are complimentary to the ends of the target sequence. Usually 30 cycles, or reactions, are carried out one after the other. Each cycle is made up of three parts: 1. Denaturation 2. Annealing 3. Extension denaturation The mixture is heated to 90°C to separate the two strands of DNA. The temperature is lowered to 55°C, allowing the primers to specifically bind to the target sequence by complimentary base pairing. By heating to 72°C Taq polymerase will synthesise new DNA from the target sequence. annealing extension The technique manipulates the cell’s natural mechanism for replication by using DNA polymerase and the following steps: 1. 2. 3. 4. 5. Sample DNA is denatured by heating to give two polynucleotide chains. Sequence-specific primers, which are small sequences of singlestranded DNA anneal to the DNA flanking the section of interest. One primer anneals to one strand (forward primer), another to the other DNA strand (reverse primer). Polymerase begins to replicate the DNA section of interest using the primers as a starter sequence. The mixture also includes: dideoxynucleotides of each base type to enable the formation of the new DNA strand Mg 2+ , which is a polymerase cofactor a buffer to keep the pH stable. The mixture now contains the original template plus the newly amplified sections. The cycle begins again using the original and copied DNA as templates. At the end of each cycle the newly synthesised fragments act as fresh templates so if there is a single piece of DNA to begin with then after the first cycle there would be two, after the second cycle four, after the third cycle eight, after the fourth cycle sixteen, and so on (doubles every cycle). As the reaction is exponential, millions of copies are produced in about 3 hours The primers are written starting with the 5' end (phosphate of the first nucleotide) and finishing with the 3' end (deoxyribose of the last nucleotide). 5' (phosphate end) → CGAAATCGGTAGACGCTACG → 3' (deoxyribose end) (primer 1/CHc) 5' (phosphate end) → GGGGATAGAGGGACTTGAAC → 3' (deoxyribose end) (primer 2/CHd) DNA polymerase will only add nucleotides to the 3' (deoxyribose) end of the primer or to the growing chain of newly synthesised DNA. Only bases which specifically compliment the DNA template will be joined to the strand being synthesised, ensuring that the original DNA sequence is copied letter for letter or base for base. Each strand of DNA in the double helix runs in opposite directions, i.e. the strands are anti-parallel. The arrows show the direction of synthesis. Template DNA Primer 3' (deoxyribose end) 5' (phosphate end) .......GCTTTAGCCATCTGCGATGC.............. 5' (phosphate end) CGAAATCGGTAGACGCTACG → 3' (deoxyribose end) Primer Template DNA 3' (deoxyribose end) 5' (phosphate end) ← CAAGTTCAGGGAGATAGGGG 5' (phosphate end) .......GTTCAAGTCCCTCTATCCCC.............. 3' (deoxyribose end) By knowing the target sequence it is possible to make billions of copies of a chosen piece of DNA in a relatively short time. Since the primers used in PCR are unique to each target sequence, the PCR reaction is very specific and in theory can amplify a single DNA sequence from a complex mixture of DNA molecules. The following diagram illustrates the PCR technique. Applications of PCR PCR is used widely, for example: 1. 2. 3. 4. 5. DNA profiling/fingerprinting: PCR is used to rapidly identify individuals. Specific regions of DNA known to vary between individuals are amplified using fluorescently labelled primers and then analysed using capillary gel electrophoresis. Profiling is not only used in forensics but also in plant variety identification, paternity testing and evolutionary biology. Disease diagnosis: DNA sequences that are known to indicate certain genetic disorders or diseases are amplified using PCR for the purposes of diagnosis. Archaeological analysis: Ancient DNA, degraded over the years, can be amplified and used in archaeological, paleontological and evolutionary research. Population studies: Analysis of human or other species’ population genetics can be rapidly performed using PCR analysis. Sequencing: DNA sequence analysis previously took place following lengthy cloning experiments, which have now been replaced by PCR. Learning Intentions 2. Gene expression Gene expression is controlled by the regulation of transcription and translation. The genetic code used in transcription and translation is found in all forms of life. The phenotype is determined by the proteins produced as the result of gene expression, influenced by intra- and extra-cellular environmental factors. Only a fraction of the genes in a cell are expressed. Structure of RNA RNA is a single stranded molecule, has a replacement of thymine with uracil and deoxyribose with ribose compared to DNA. mRNA is transcribed from DNA in the nucleus and translated into proteins by ribosomes in the cytoplasm. rRNA and proteins form the ribosome. tRNA (transfer) amino acids to the ribosome. Each tRNA carries a specific amino acid. Protein Synthesis Transcription of DNA into primary and mature RNA transcripts includes RNA polymerase and complementary base pairing. The introns of the primary transcript of mRNA are non-coding and are removed in RNA splicing. The exons are coding regions and are joined together to form mature transcript. This process is called RNA splicing. Different mRNA molecules are produced from the same primary transcript depending on which RNA segments are treated as exons and introns. Translation of mRNA into a polypeptide by tRNA at the ribosome. Start and stop codons exist. Proteins Proteins have a large variety of structures and shapes resulting in a wide range of functions One gene can result in many proteins as a result of RNA splicing and post-translational modification. Post translation protein structure is modified by cutting, folding and combining polypeptide chains or by adding phosphate or carbohydrate groups to the protein. Know examples of fibrous, globular and conjugated proteins proteins. The genetic code used in transcription and translation is found in all forms of life. The phenotype is determined by the proteins produced as the result of gene expression, influenced by intra- and extra-cellular environmental factors. Only a fraction of the genes in a cell are expressed. Gene expression is controlled by the regulation of transcription and translation. Structure of RNA RNA stands for ribonucleic acid. There are three main differences between RNA and DNA. RNA is single stranded, a uracil base has replaced thymine and the nucleotide contains a ribose sugar instead of deoxyribose sugar. Phosphate group Base - adenine guanine- cytosine - uracil Ribose sugar - uracil RNA DNA Single stranded Double stranded Uracil Thymine Ribose sugar Deoxyribose sugar There are three forms of RNA involved in protein synthesis: messenger RNA (mRNA) and transfer RNA (tRNA). mRNA is formed inside the nucleus from free nucleotides and carries a copy of the DNA code from the nucleus to the ribosome to direct the synthesis of proteins. Do you remember this from the cell ultrastructure and protein synthesis sections in National 5? The ribosomes are found in the cytoplasm either f loating freely or attached to the rough endoplasmic reticulum. Ribosomes floating freely are used to synthesis proteins for use within the cell; those attached to the ER synthesise proteins for export or inclusion in the membrane. Ribosomes are formed from proteins and a third type of RNA known as ribosomal RNA (rRNA). Each tRNA carries a specific amino acid to the ribosome for attachment to the peptide chain. Use the information on the information cards to describe what is happening at each stage in this diagram. 1. Post translation protein structure modification by cutting and combining polypeptide chains or by adding phosphate or carbohydrate groups to the protein. Proteins are held in a three-dimensional shape. Proteins have a large variety of structures and shapes resulting in a wide range of functions Peptide bonds form to bind amino acids in a chain called a polypeptide, polypeptide chains can be folded to form the 3 dimensional shape of a protein, held together by hydrogen bonds and interactions between individual amino acids. 2. Fibrous proteins include silk, actin, collagen and keratin. Globular proteins include hormones, antibodies, membrane proteins and enzymes. Conjugated proteins include haemoglobin. 3. 4. Transcription Transcription copies the information in DNA into an RNA molecule. This occurs in the nucleus. Transcription of DNA into primary and mature RNA transcripts involves RNA polymerase and complementary base pairing. RNA polymerase enzyme attaches to a sequence of DNA known as the promoter. It then moves along the DNA, unwinding the double helix and breaking the hydrogen bonds holding the base pairs together to create a transcription bubble. This first stage is known as initiation. This is followed by elongation, in which free RNA nucleotides enter the transcription bubble and align with the complementary base pairs on the DNA moving from 3’ to 5’. The RNA nucleotides are held in place by hydrogen bonding while strong covalent bonds form between the phosphate of one nucleotide and the 5’carbon of the adjacent nucleotide. The final stage is termination, in which the transcription termination sequence is recognised on the DNA and the RNA polymerase enzyme is released. The RNA that has been produced at this st age is known as the primary transcript. This primary transcript now requires to be modified. The primary transcript of RNA is composed of introns and exons. The introns are non-coding regions of genes and so do not appear in the mRNA in eukaryotic cells. The exons are coding regions of genes and so do appear in the mRNA. The introns of the primary transcript of mRNA are removed in RNA splicing. In RNA splicing the primary transcript is cut at the boundaries between the introns and exons. The introns are removed and the exons joined together. The mRNA can then leave the nucleus via a nuclear pore and enter the cytoplasm. Translation Translation is the process in which a polypeptide is synthesised from an mRNA template. Translation of mRNA into a polypeptide by tRNA occurs at the ribosome. tRNA folds due to base pairing to form a triplet anticodon site and an attachment site for a specific amino acid. The triplet anticodon site is complimentary to the triplet codon site on the mRNA. Each codon codes for a particular amino acid. There are far more possible codons than amino acids. There are 64 (4 3 ) possible combinations of the four bases but only 20 amino acids occurring in nature. This has led to more than one codon coding for an amino acid. There are three codons that do not code for amino acids: UGA, UAA and UAG. The occurrence of these in the genetic code terminates translation and therefore they are known as stop codons. The genetic code also includes start codons, where translation begins. In eukaryotes this is almost always AUG, which also codes for the amino acid methionine. In prokaryotes occasionally other codons may be used. During translation the mRNA passes through the ribosome. The codons are recognised by tRNA. Each tRNA carries a particular amino acid. The appropriate tRNA brings its amino acid to the ribosome as it moves along the mRNA. Adjacent amino acids join with a peptide bond. The tRNA then leaves the ribosome. This process continues until a stop codon is reached and the polypeptide is released. Proteins One gene can result in many proteins as a result of RNA splicing and post-translational modification. Different mRNA molecules are produced from the same primary transcript depending on which RNA segments are treated as exons and introns. This is called alternative RNA splicing. The exons can be combined in different ways through a variety of methods. The most common is exon skipping, where an exon may be removed or included. Once translation is complete the protein can be modified to alter the protein’s function. Examples include the addition of a phosphate or carbohydrate. Learning Intentions 2. Gene Expression Cellular differentiation The process by which a cell develops more specialised functions by expressing the genes characteristic for that type of cell is called differentiation. Differentiation into specialised cells occurs from meristems in plants; embryonic and tissue (adult) stem cells in animals. Meristems are regions of unspecialised cells in plants that are capable of cell division. Stem cells are relatively unspecialised cells in animals that can continue to divide and can differentiate into specialised cells of one or more types. In the very early embryo, embryonic stem cells differentiate into all the cell types that make up the organism. Research and therapeutic uses of stem cells Stem cell research provides information on how cell processes such as cell growth, differentiation and gene regulation work. Stem cells can be used as model cells to study how diseases develop or for drug testing. Stem cells can be use in the repair of diseased or damaged tissue e.g. used in skin grafts, bone marrow transplants and cornea repair Sources of stem cells can include embryonic stem cells, tissue (adult) stem cells and attempts to reprogram specialised cells to embryonic state (induced pluripotent stem cells). Tissue (adult) stem cells replenish differentiated cells that need to be replaced and give rise to a more limited range of cell types. Once a cell becomes differentiated it only expresses the genes that produce the characteristic for that cell type. The ethical issues of stem cell use and the regulation of their use. Cellular differentiation The process by which a cell develops more specialised functions by expressing the genes characteristic for that type of cell is called differentiation. Differentiation into specialised cells occurs from meristems in plants; embryonic and tissue (adult) stem cells in animals. Meristems are regions of unspecialised cells in plants that are capable of cell division. Cells produced in meristems differentiate into specialised cells. There are two types of meristem found in plants: apical and l ateral. The apical meristems are found at root and shoot tips where plant growth occurs. Lateral meristems (cambium) cause the plant to grow outwards (horizontally) and are responsible for the thickening of stems in plants which return year after year. This occurs in the cambium and is responsible for the growth of wood on a tree trunk. The cells found in apical meristems are a useful tool in plant tissue culture. They are described as being totipotent, which means they are capable of becoming any cell within the plant. These cells can therefore be used to grow entirely new plants that are clones of the original plant. Basically a piece of plant (shoot tip, node etc) is put in nutrient medium that encourages growth. The composition of the medium can be changed to produce a mass of undifferentiated cells called a callus or an entire plant. Stem cells are relatively unspecialised cells in animals that can continue to divide and can differentiate into specialised cells of one or more types. In the very early embryo, embryonic stem cells differentiate into all the cell types that make up the organism. Human embryonic stem cells can be grown in the lab from cells taken from early embryos at a stage of development called the blastocyst. The blastocyst is made up of two layers of cells – and outer layer that would form part of the placenta, and an inner layer of cells that have the ability to make all the tissues of the embryo. Embryonic stem cells are derived by removing the outer layer and culturing the inner layer of cells in the lab. These cells are described as being pluripotent. Tissue (adult) stem cells replenish differentiated cells that need to be replaced and give rise to a more limited range of cell types. These cells are described as being multipotent and are sometimes referred to as somatic stem cells. These multipotent cells replenish the cells that make up particular organs in the body. Research and therapeutic uses of stem cells Stem cell research provides information on how cell processes such as cell growth, differentiation and gene regulation work. Stem cells can be used as model cells to study how diseases develop or for drug testing. Stem cells can be use in the repair of diseased or damaged tissue e.g. used in skin grafts, bone marrow transplants and cornea repair Sources of stem cells can include embryonic stem cells, tissue (adult) stem cells and attempts to reprogram specialised cells to embryonic state (induced pluripotent stem cells). Tissue (adult) stem cells replenish differentiated cells that need to be replaced and give rise to a more limited range of cell types. Once a cell becomes differentiated it only expresses the genes that produce the characteristic for that cell type. Embryo cells must not be allowed to develop beyond 14 days, around the same time a blastocyst would be implanted in a uterus. Other ethical considerations include the use of induced pluripotent stem cells and the use of nuclear transfer techniques. Learning Intentions 3. Genome The genome of an organism is its hereditary information encoded in DNA. DNA sequences that code for protein are defined as genes Most of the eukaryotic genome consists of these non-coding sequences. The structure of the genome Coding and non-coding sequences include those that regulate transcription and those that are transcribed to RNA but are never translated. Non-translated from of RNA include tRNA, rRNA (ribosomal) and RNA fragments. Some non-coding sequences have no known function. Mutations Mutations are changes in the genome that can result in no protein or an altered protein being expressed. Single gene mutations involve the alteration of a DNA nucleotide sequence as a result of the substitution, insertion or deletion of nucleotides. Single nucleotide substitutions and inversion are point mutations and can be silent, neutral, missense, or nonsense. Single-nucleotide substitutions include: missense, nonsense and splice-site mutations. Splice site mutations can alter post-translational processing. Nucleotide insertions or deletions result in frame-shift mutations or an expansion of a nucleotide sequence repeat. Regulatory sequence mutations can alter gene expression. Chromosome structure mutations involve duplication, deletion and translocation. Mutations and gene duplication are important in evolution Polyploidy results from errors during the separation of chromosomes during cell division can result in cells with whole genome duplications. Polyploidy is important in the evolution of human food crops. Polyploidy examples include banana (triploid) and potato (tetraploid) as well as swede, oil seed rape, wheat and strawberry. Polyploidy is very rare in animals. 3. Genome The genome of an organism is its hereditary information encoded in DNA. DNA sequences that code for protein are defined as genes. A genome is made up of genes and other DNA sequences that do not code for proteins. Most of the eukaryotic genome consists of these non-coding sequences. (a) The structure of the genome Genes code for proteins. The genome is made up of genes and other DNA that does not code for proteins: eg Gene regulatory sequences, which control transcription, DNA, which is transcribed into transfer RNA (tRNA) or ribosomal RNA (rRNA), and small pieces of RNA and DNA sequences that have no known function. Coding and non-coding sequences make up the genome. Introns are common in eukaryotes and the number and length varies a lot between species. One gene can code for many different proteins depending on how many exons or which exons are spliced together. Proteins are mostly enzymes that carry out the ‘instructions’ of the gene, giving us our characteristics. Often one characteristic is controlled by more than one gene so it is a complex business. (b) Mutations are changes in the genome that can result in no protein or an altered protein being expressed. Naturally occurring mutations are rare, they occur randomly and spontaneously. Mutations can be induced by mutagenic agents such as gamma rays, X-rays and UV light. Tar in cigarettes, certain food additives and many chemicals are thought to induce mutations. Some mutagens are also carcinogens – cancer-causing mutations. Most mutant alleles are recessive so are only seen in the phenotype when two recessive alleles are present. However, some are dominant (achondroplasia) and some are sex-linked (haemophilia). Some mutations give rise to better genes and provide alternative choices on which natural selection can act. They are considered to be the raw material of evolution. (i) Gene Mutations The three types of mutations you need to know about are nucleotide substitution, insertion and deletion. You will also study examples of the effects of mutations i.e. sickle cell anaemia. Point mutation Occurs at a single point – substitution. Generally not too harmful, most of the protein remaining unaffected. Only one amino acid affected so the protein will probably be functional. (single nucleotide polymorphism) Frame-shift mutation After a deletion or insertion the open reading frame is moved one base pair forward or backward. This is generally harmful since all the amino acids in the primary structure of the protein will have changed from the mutation onwards. The protein will probably be non-functioning. (ii) Chromosome structure mutations Mutations and gene duplication are important in evolution e.g. evidence of formation of human chromosome 2 from fusion of two ancestral chromosomes and gene duplication leading to alpha and beta globins in haemoglobin. Polyploidy Occurs due to errors during the separation of chromosomes during cell division can result in cells with whole genome duplications. It is the failure of the spindle fibres, complete non-disjunction, which gives rise to a doubling of the chromosome complement of the gamete cells. For example, a plant which undergoes complete non-disjunction will form diploid gametes. If these self-fertilise a tetraploid plant will result. Polyploidy organisms have more than two sets of chromosomes: some sources estimate that over 70% of flowering plants are polyploids. Polyploids must have matching sets of homologous chromosomes in order to be fertile. Polyploidy examples include banana (triploid) and potato (tetraploid) as well as swede, oil seed rape, wheat and strawberry. Polyploidy is important in the evolution of human food crops. Polyploidy is very rare in animals. Learning Intentions 3. Genome Evolution Evolution is the changes in organisms over generations as a result of genomic variations. Gene transfer Vertical (inheritance) from parent to offspring occurs as a result of sexual or asexual reproduction. Horizontal inheritance in prokaryotes and viruses occurs as they can exchange genetic material by conjugation. This can result in rapid evolutionary change. Prokaryotes and viruses can also transfer sequences horizontally into the genomes of eukaryotes. Selection Natural selection is the non-random increase in frequency of DNA sequences that increase survival. Sexual selection is an increase in successful reproduction. Genetic drift The random increase and decrease in frequency of sequences, particularly in small populations, as a result of neutral mutations and founder effects. Speciation Speciation is the generation of new biological species by evolution. A species is a group of organisms capable of interbreeding and producing fertile offspring, and which does not normally breed with other groups. The importance of geographical barriers in allopatric speciation. The importance of behavioural or ecological barriers in sympatric speciation. Hybrid zones form in regions where the ranges of closely related species meet e.g. hooded crow and carrion crow zone in Scotland. Inheritance Genetic sequences are inherited vertically from parent to offspring as a result of sexual or asexual reproduction. Prokaryotes can exchange genetic material horizontally, resulting in rapid evolutionary change (conjugation). Prokaryotes and viruses can transfer sequences horizontally into the genomes of eukaryotes. HORIZONTAL GENE TRANSFER by CONJUGATION E. coli P.syringae pillus chromosome antibiotic resistance gene Bacteria can pick up pieces of DNA from its surroundings - from another bacteria that has died. Selection. Natural selection is the non-random increase in frequency of sequences that increases survival (natural selection) or successful reproduction (sexual selection). The non-random reduction in frequency of deleterious sequences. The differences in outcome as a result of stabilising, directional and disruptive selection. Characteristics which increase the chances of mating may become exaggerated but may also decrease the organism’s chances of survival. Genetic drift. Genetic drift is the change in the frequencies of alleles in a population that occur by chance, rather than because of natural selection, ie the random accumulation of mutations in the absence of natural selection (selection pressure). The random increase and decrease in frequency of sequences, particularly in small populations, as a result of neutral mutations and founder effects. The founder effect, a type of genetic drift, is the loss of genetic variation that occurs when a new population is established by a very small number of individuals from a larger population. Speciation ‘On the other hand, ‘we may feel sure that any variation in the least degree injurious would be rigidly destroyed. This preservation of favourable variations and the rejection of injurious variat ions, I call natural selection.’ Charles Darwin (1859) on the origin of species by the means of natural selection. Speciation is the generation of new biological species by evolution. A species is a group of organisms capable of interbreeding and producing fertile offspring, and which does not normally breed with other groups. It is difficult to apply the species definition to asexually reproducing organisms. There are different definitions of the term species e.g. biological species concept and phylogenetic species concept. Allopatric speciation is the evolution of new species in populations that are geographically isolated from one another. Geographical barriers are important in allopatric speciation. Sympatric speciation is the evolution of new species in populations that live in the same geographic area. Behavioural or ecological barriers are in place to prevent gene exchange within a given area. Behavioural barriers, such as breeding patterns or rituals, and ecological barriers, such as food availability, may operate in sympatric speciation. The formation of hybrid zones in regions where the ranges of closely related species meet e.g. hooded crow and carrion crow zone in Scotland. Learning Intentions 3. Genome Genomic sequencing The sequence of nucleotide bases can be determined for individual genes and entire genomes. To compare sequence data, computer and statistical analyses (bioinformatics). Evidence for evolution Evidence from phylogenetics and molecular clocks has been used to determine the main sequence of events in evolution. The use of sequence data to study the evolutionary relatedness among groups of organisms. The use of sequence data and fossil evidence to determine the main sequence of events in evolution of life: cells, last universal ancestor, photosynthetic organisms, eukaryotes, multicellularity, animals, land plants, vertebrates. Comparison of genomes from different species Comparison of genomes reveals that many genes are highly conserved across different organisms. Many genomes have been sequenced, particularly of disease-causing organisms, pest species and species that are important model organisms for research. Personal genomics and health – Pharmacogenetics Analysis of an individual’s genome may lead to personalised medicine through knowledge of the genetic component of risk of disease and likelihood of success of a particular treatment. Comparison of individual’s genomes focuses on point mutations, repetitive sequence errors and blocks of duplication and deletion. There are difficulties in distinguishing between neutral and harmful mutations in both genes and regulatory sequences, and in understanding the complex nature of many diseases.