Download Analysis of GNAZ Gene Polymorphism in Bipolar Affective Disorder

American Journal of Medical Genetics (Neuropsychiatric Genetics) 88:324–328 (1999)
Analysis of GNAZ Gene Polymorphism in Bipolar
Affective Disorder
Takuya Saito,1 Demitri F. Papolos,1 Danielle Chernak,1 Mark H. Rapaport,2 John R. Kelsoe,2 and
Herbert M. Lachman1*
1
Department of Psychiatry, Program of Behavioral Genetics, Albert Einstein College of Medicine, Bronx, New York
Department of Psychiatry, University of California at San Diego, San Diego, California
2
Evidence for a bipolar disorder (BPD) susceptibility locus on chromosome 22q11 has
been provided in several studies. One candidate gene that maps to this region is the
G-protein ␣ subunit gene G␣z (GNAZ). We
have identified a common silent polymorphism in GNAZ exon 2 by single strand conformation polymorphism analysis. The frequency of this polymorphism was determined in a control population (n=84) and in
patients with BPD (n=88). The data showed
a statistical trend toward a difference in the
distribution of alleles in patients with BPD
compared with control subjects (chi
square=3.2, 1 df, P=0.073, two-tailed). No significant difference was detected when the
GNAZ polymorphism was analyzed in control subjects and schizophrenia patients
(n=63, P=0.92). These data continue to provide some support for a BPD susceptibility
gene on 22q11, possibly in linkage disequilibrium with the GNAZ 309 polymorphism.
Am. J. Med. Genet. (Neuropsychiatr. Genet.)
88:324–328, 1999. © 1999 Wiley-Liss, Inc.
KEY WORDS: bipolar disorder; G-protein;
chromosome 22; manic depression; manic depressive
illness
Part of this work was presented at the annual American Psychiatry Association meetings (Toronto, 1998).
Contract grant sponsor: Scottish Rite Schizophrenia Research;
Contract grant sponsor: American Psychiatric Association; Contract grant sponsor: National Institute of Mental Health; Contract grant number: MH47612; Contract grant sponsor: Novartis.
*Correspondence to: Herbert M. Lachman, Department of Psychiatry, Program of Behavioral Genetics, Albert Einstein College
of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461.
E-mail: [email protected]
Received 24 April 1998; Accepted 9 October 1998
© 1999 Wiley-Liss, Inc.
INTRODUCTION
Bipolar disorder (BPD) is a common psychiatric condition characterized by periods of depression alternating with mania (BPI) or hypomania (BPII). Family,
twin, and adoption studies show that genetic factors
play an important role in its development [Bertelson et
al., 1977; Craddock and McGuffin, 1993; Mendlewicz
and Rainer, 1977; Nurnberger et al., 1994]. However,
despite a decade of intensive research, mapping BPD
susceptibility genes to specific chromosomal loci has
been very difficult. Although early genetic linkage
studies using parametric lod score determinations provided strong evidence for loci on chromosomes X and
11, the results were not replicated [Baron et al., 1987;
Berretini et al., 1990; Egeland et al., 1987; Gershon,
1991; Kelsoe et al., 1989; Mendlewicz et al., 1987]. In
the past few years several loci including 18p, 18q, 4p,
13q, 15q, and 21q have been mapped using model-free,
nonparametric methods of statistical analysis that are
more useful for complex nonmendelian traits [Berretini
et al., 1994; Blackwelder and Elston, 1985; Blackwood
et al., 1996; DeBruyn et al., 1995; Detera-Wadleigh et
al., 1997; Freimer et al., 1996; Gurling et al., 1995;
Risch, 1990; Stine et al., 1995; Stine et al., 1997; Straub
et al., 1994; Suarez et al., 1978; Weeks and Lange,
1988].
Recently, we have also used parametric and nonparametric multipoint analyses in 17 multiplex pedigrees to map a possible BPD susceptibility locus on
chromosome 22q11 [Lachman et al., 1997a]. A maximum lod of 2.51 was obtained under a dominant model
and 50% heterogeneity at marker D22S303. Similar
findings were subsequently reported by Edenberg et al.
[1997], who obtained a maximum lod score of 2.46 for
marker D22S533, which also maps to 22q11.
One gene that maps near D22S303 is GNAZ, a member of the G-protein family of signal transducers
[Fields and Casey, 1997; Fong et al., 1988; Matsuoka et
al., 1988; Matsuoka et al., 1990]. G-proteins are heterotrimeric proteins, composed of ␣, ␤ and ␥-subunits
that are critical cellular signal transducers involved in
the activation of adenyl cyclase, phosphoinositide metabolism, and calcium and potassium channel function
[Casey et al., 1990; Guderman et al., 1997; Simon et al.,
GNAZ Gene Polymorphism in Bipolar Affective Disorder
1991]. One function reported for GNAZ is agonist mediated inhibition of adenyl cyclase, similar to G␣i.
However, it differs from the G␣i family of proteins in
that it is not inhibited by pertussis toxin [Fields and
Casey, 1997]. We and others have previously suggested
that G-proteins are very feasible candidate genes in
BPD [Avissar et al., 1988; Lachman and Papolos,
1989]. Lithium, the major drug used in the treatment
of BPD, has been found in some studies to inhibit Gprotein activation [Avissar et al., 1988]. Differences in
G-protein levels and in agonist stimulated GTP binding have been detected in mononuclear leukocytes of
patients with BPD [Avissar et al., 1997]. Lithium also
appears to have an affect at a level distal to G-protein
activation since it inhibits forskolin and calmodulin
stimulated adenyl cyclase [Mork and Geisler, 1987;
Mork and Geisler, 1995].
More than two dozen genes encoding various ␣, ␤,
and ␥ G-protein subunits have been identified. The capacity of G-protein subunits to mix and match components and couple to different neurotransmitter receptors, thereby providing the opportunity for a single defective subunit protein to interact with multiple
neurotransmitter/signal transduction pathways, is a
particularly suggestive property for a candidate gene
in an illness characterized by mood extremes. GNAZ
has unique properties that make it an interesting candidate gene to consider in BPD. First, it is expressed at
relatively high levels in the brain compared with other
tissue [Matsuoka et al., 1988]. Second, GNAZ has a
relatively slow rate of GTP hydrolysis compared with
other ␣-subunits, requiring a G-protein activating protein (GAP) for maximal activity [Casey et al., 1990]. A
delay in GTP hydrolysis caused by reduced GTPase
activity would lead to enhanced effector target activation. Third, GNAZ is inhibited by nanomolar concentrations of Mg++, a property that could present a specific target for lithium since Li+1 and Mg+2 compete
with each other at some targets, including sites necessary for G-protein guanine nucleotide exchange [Avissar et al., 1991; Casey et al., 1990]. Fourth, GNAZ is
coupled to receptors that are activated by neurotransmitters and neuropeptides implicated in affective disorders including the ␣1-adrenergic, 5-HT1A, mu and
kappa opioid, melatonin, and dopamine DRD2 receptors [Ammer and Schulz, 1993; Butkerait et al., 1995;
Ho and Wong, 1997; Lai et al., 1995; Yung et al., 1995].
Finally, GNAZ is an excellent substrate for protein kinase C (PKC)-mediated phosphorylation; PKC has
been suggested as a potential target of lithium [Ho and
Wong, 1997; Manji and Lenox, 1994].
The 22q11 linkage findings and the experimental
and theoretical considerations described in the preceding paragraphs led us to examine GNAZ as a potential
candidate gene for BPD. A preliminary scan of the gene
by single strand conformation polymorphism (SSCP)
analysis identified a silent C→T transition at codon
103 (henceforth referred to as the 309 polymorphism).
This polymorphism was used in an association study
conducted on 88 patients with BPD and 84 control subjects. The data show a statistical trend toward an increase in 309T in patients with BPD compared with
controls.
325
METHODS
Subjects
Patients with BPD were diagnosed on the basis of
either a schedule for affective disorder and schizophrenia-life-time version for bipolar spectrum disorder
(SADS)-LB interview or structured clinical interview
for Diagnostic and Statistical Manual of Mental Disorders (DSM-III R) diagnosis [Endicott and Spitzer,
1978]. There were 54 patients with BPI and 34 with BPII
in the study; 60 (68%) were female. All patients were
Caucasians of European ancestry. Included in the analysis were 14 probands from our BPD linkage study.
The mean age was 44.8±11.7. Control subjects (n⳱84)
were Caucasian individuals of European ancestry
drawn from hospital and medical school staff and students matched for geographical location, age, and gender with the patient population. Fifty-two controls
were female (62%) with a mean age of 42.9±12.8. No
formal testing procedure was used to screen for underlying psychiatric illness. However, subjects were excluded as controls if they had a personal or family history of BPD, severe depression or schizophrenia.
Schizophrenic subjects (n⳱63) were diagnosed by Research diagnostic criteria (RDC) and DSM-III R criteria
based on information obtained from a SADS interview
or from semistructured interview and chart review
[Spitzer et al., 1978]. The patients were Caucasians of
European ancestry matched for age with the control
and BPD populations (42.6±9.4). The schizophrenic
subjects, however, were not matched for gender since
there was a predominance of males in the patient population available for analysis (19/63 female subjects).
Genotype
GNAZ coding exons (2 and 3) were screened in 10
subjects with BPI for mutations by SSCP analysis using published sequence information [Fong et al., 1988;
Matsuoka et al., 1988; Matsuoka et al., 1990]. In addition, the GTPase domain in the 5⬘ portion of exon 2 was
screened by direct sequencing of polymerase chain reaction (PCR)-amplified fragments. The subjects analyzed were probands from the families that provided
the highest lod scores for 22q11 in our linkage study
[Lachman et al., 1997a]. SSCP and DNA analysis was
performed on overlapping PCR fragments. For SSCP,
32
P-labeled PCR products were generated in a 20-␮L
volume using the following primers that spanned
GNAZ coding regions in exons 2 and 3: GTGTCCCCTGTGGCAAGAGG (primer 1) and TGCGGGTCAGCGAGTCGATG (−70 to 250, translation start site is
position 1); CTCAGGATCGACTTCCACAA and CGATGCGCTCCAGGTCGTTC (270–490); ACAGGCCTGCTTCAGCCCGCT and CACTTACTGTCTGGTTATCC (primer 2)(411–723/intron 2); CCAGAGTCGGATGGCAGA and GTCTCCTTGTTGCGGTTCAG
(intron 2/724–950); GCTGTCTACATCCAGCGGCA
and TGGATTGGGCCTCTCTAGCA (901–1150) [Matsuoka et al., 1988; Matsuoka et al., 1990]. Five microliters of PCR product was added to 7 ␮L of denaturing
buffer (90% formamide, 0.01N NaOH, 0.5X TBE, 0.25%
xylene cyanol and 0.25% bromocresol purple). The
samples were denatured by heating to 9°C for 5 min
326
Saito et al.
and then quenched at 4°C prior to loading. An aliquot
(3 ␮L) was loaded onto a 5% acrylamide gel containing
5% glycerol and 0.5×TBE. Nondenatured PCR product
was loaded on each gel. The DNA was separated by
electrophoresis at constant power (30 watts) at room
temperature with constant fanning until the xylene
cyanol dye migrated a distance of 45 cm. Following
electrophoresis, the gel was dried and exposed to X-ray
film at room temperature without intensifying screens
for 24–72 hr. Band shifts signifying allelic differences
were observed by visual inspection of the autoradiograms. SSCP genotypes were read independently by
two investigators (H.M.L and T.S.).
A region approximately encompassing the translation start and position 290, which includes the GTP
hydrolytic site, was analyzed by DNA sequence analysis. A PCR product was generated using primers 1 and
2 (see above) and treated with shrimp alkaline phosphatase and exonuclease I to remove unused primer
(United States Biochemical). A sequence ladder was
generated using Sequenase and the reverse primer
CGGGGCCCGTCAGCGCAAAG (position 350).
Data Analysis
Allele frequencies were organized in a 2 × 2 contingency table comparing genotype and phenotype (control versus BPD and control versus schizophrenia). A
chi-square analysis (with Yate’s correction) was performed.
RESULTS
The GTPase domain is commonly mutated in functional alterations of G-protein ␣-subunits and Ras.
However, DNA sequence analysis did not reveal any
polymorphisms in the GNAZ GTPase domain in the 10
subjects analyzed (not shown). Screening by SSCP revealed a band shift in eight out of 10 subjects when
primers spanning positions 270–490 were used. DNA
sequence analysis showed that the SSCP band was due
to a C→T transition at position 309. Although the polymorphism creates a restriction fragment length polymorphism (RFLP) for the enzyme Hga I, genotyping by
PCR-RFLP was difficult because of partial digestion
caused by the loss of Hga I activity after a short period
of incubation at 37°C. Consequently, all genotypes
were determined by SSCP analysis. Under the conditions described in Methods, both DNA strands and both
alleles generated by the 309 polymorphism could be
separated on the same SSCP gel. The frequency of the
309 polymorphism was determined in a population of
patients with BPD and control subjects. As seen in
Table I, the frequency of 309T was 0.318 in patients
with BPD and 0.226 in controls. There was a statistical
trend toward a difference in allele frequencies between
controls and patients with BPD (P⳱0.073, two-tailed).
The number of 309T homozygotes was too small to obtain meaningful data by chi-square analysis of genotypes. However, when the genotypes were pooled to
increase the number of subjects in each cell of the contingency table the findings continued to show a statistical trend. Among patients with BPD, 50/88 (56.8%)
had one or two 309T alleles compared with 36/84
TABLE I. Distribution of GNAZ 309 Alleles*
Allele frequency
(n)
Subjects [n]**
BPD [88]
CONT [84]
SCH [63]
Genotype frequency
(n)
T
C
TT
TC
CC
(56)
.318
(38)
.226
(27)
.214
(120)
.682
(130)
.774
(99)
.784
(6)
.068
(2)
.024
(4)
.063
(44)
.500
(34)
.405
(19)
.302
(38)
.432
(48)
.571
(40)
.635
*Allele frequency: BPD vs control: chi square ⳱ 3.2, 1 df, p ⳱ 0.037,
one-tailed, p ⳱ 0.073, two-tailed, relative risk ⳱ 1.41. SCH vs control
frequency: chi square ⳱ 0.01, 1 df, p ⳱ 0.92. Genotype: BP vs control: all
subjects with one or two 309T alleles compared with all homozygotes for
309C (chi-square ⳱ 2.82, 1 df, p ⳱ 0.047, one-tailed, p ⳱ 0.093, two-tailed,
relative risk ⳱ 1.33.
**Bipolar disorder (BPD), schizophrenia (SCH), controls (CONT) T and C
are GNAZ 309 alleles.
(42.9%) controls (P⳱0.093, two-tailed). Interestingly,
there was no difference in the frequency of 309T in
patients with BPI and BPII (0.310 and 0.329 respectively, not shown).
We also analyzed a group of 63 schizophrenic subjects since there have been reports of linkage to chromosome 22q12 by some investigators [Coon et al., 1994;
Gill et al., 1996; Vallada et al., 1995]. The frequency of
309T in chronic schizophrenics was similar to controls
(0.214) and a comparison by chi-square showed no significant difference (P⳱0.92).
DISCUSSION
There are indications that chromosome 22q11 may
contain one or more BPD susceptibility genes. This region was investigated initially as a result of work we
and others have conducted on velo cardio facial syndrome (VCFS), a congenital disorder caused by a chromosome 22q11 microdeletion. The disorder is characterized by a typical facial appearance, cleft palate, cardiac defects, learning disabilities, and psychiatric
illness [Morrow et al., 1995; Papolos et al., 1996; Scambler et al., 1992; Shprintzen et al., 1978; Shprintzen et
al., 1992]. Papolos et al. [1996] found that a high percentage of patients fulfilled criteria for BP spectrum
disorders, in particular rapid cycling BPD. The clinical
and genetic findings in VCFS suggest that ‘loss of function‘ of a gene or genes in the deleted region increases
the susceptibility to develop BPD and other psychiatric
problems. One gene that maps to the deleted region is
catechol O-methyltransferase (COMT), which encodes
one of the major enzymes involved in catecholamine
metabolism [Axelrod and Tomchick, 1958; Morrow et
al., 1995; Scambler et al., 1992]. COMT activity is subject to a common genetic polymorphism that leads to
enzyme variants with either high or low activity [Boudikova et al., 1990; Lachman et al., 1996a; Lotta et al.,
1995; Weinshilboum and Raymond, 1977]. We have
provided some evidence that ultra rapid cycling BPD in
patients with VCFS is associated with the COMT allele
encoding the low enzyme activity variant [Lachman et
al., 1996b]. However, it appears that genetic factors
other than COMT also play a role in the development of
the psychiatric problems found in VCFS [Lachman et
al., 1996b]. COMT may also increase the cycling fre-
GNAZ Gene Polymorphism in Bipolar Affective Disorder
quency in patients with BPD resulting in an ultra ultra
rapid cycling pattern [Papolos et al., 1998; Kirov et al.,
1998]. However, COMT does not appear to exert a ‘‘major gene effect’’ in the pathogenesis of BPD [Gutierrez
et al., 1997; Lachman et al., 1997b].
The findings in VCFS prompted our analysis of
22q11 in 17 multiplex families. Using parametric
methods of analysis under a dominant model, we obtained a maximum lod of 2.51 at marker D22S303,
which maps approximately 8 cm telomeric to the VCFS
deleted region [Lachman et al., 1997a]. Similar results
were provided by Edenberg et al. [1997] for marker
D22S533. Since mapping of complex traits is not precise [Terwilliger et al., 1997], it is conceivable that the
putative BPD susceptibility gene identified in these
studies may be the same gene that causes BPD when
deleted in patients with VCFS. However, arguing
against this idea is our finding of strongly negative lod
scores obtained in the linkage study using markers
flanking the VCFS deleted region [Lachman et al.,
1997a].
GNAZ maps to a YAC clone adjacent to D22S303
(unpublished observations). Based on its map location
near D22S303 and the theoretical considerations outlined in the introduction, GNAZ has to be viewed as a
feasible candidate gene for involvement in BPD. Scanning GNAZ exons by SSCP analysis identified a common nonfunctional polymorphism at position 309. Using a case control design we now report a trend toward
an increase in the frequency of GNAZ 309T in patients
with BPD. The screening for allelic differences should
be considered preliminary since only 20 alleles were
analyzed and SSCP may miss 20–30% of mutations
when only a single electrophoresis condition is used.
Furthermore, analysis of the intron-exon borders was
limited because intron sequence data that could be
used to generate a PCR product that encompassed the
two relevant intron-exon borders was unavailable.
The modest trend toward an association found in this
study could be a type I error caused by population
stratification, a common problem in association studies. However, the finding that the distribution of alleles
in schizophrenic subjects was similar to that found in
control subjects argues against this idea. Additional
analysis in other populations of BPD patients is necessary, preferentially using family-based association
studies. If an association between BPD and 309T is
established, it would suggest that the polymorphism is
in linkage disequilibrium with a disease causing functional alteration located in GNAZ or in a nearby gene.
REFERENCES
Ammer H, Schulz R. 1993. Alterations in the expression of G-proteins and
regulation of adenylate cyclase in human neuroblastoma SH-SY5Y
cells chronically exposed to low-efficiency mu-opioids. Biochem J 295:
263–271.
Avissar S, Schreiber G, Danon A, Belmaker RH. 1988. Lithium inhibits
adrenergic and cholinergic increases in GTP binding in rat cortex. Nature 331:440–442.
Avissar S, Murphy DL, Schreiber G. 1991. Magnesium reversal of lithium
inhibition of ␤-adrenergic and muscarinic receptor coupling to G proteins. Biochem Pharmacol 41:171–175.
Avissar S, Nechamkin Y, Roitman G, Schreiber G. 1997. Differential G
327
protein measures in mononuclear leukocytes of patients with bipolar
disorder are state dependent. J Affective Dis 43:85–93.
Axelrod J, Tomchick R. 1958. Enzymatic O-methylation of epinephrine and
other catechols. J Bio Chem 233:702–705.
Baron M, Risch N, Hamburger R, Mandel B, Kushner S, Newman M,
Drumer D, Belmaker RH. 1987. Genetic linkage beteen X-chromosome
markers and bipolar affective illness. Nature 326:289–292.
Berritini WH, Ferraro TN, Goldin LR, Weeks DE, Detera-Wadleigh SD,
Nurnberger JI, Gershon ES. 1994. Chromosome 18 DNA markers and
manic-depressive illness: evidence for a susceptibility gene. Proc Natl
Aca Sci 91:5918–5921.
Berretini WH, Goldin LR, Gelernter J, Gejman PV, Gershon ES, DeteraWadleigh SD. 1990. X-chromosome markers and manic-depressive illness: rejection of linkage of Xq28 in nine polar pedigrees. Arch Gen
Psychol 47:366–373.
Bertelson A, Havald B, Hauge M. 1977. A Danish twin study of manic
depressive disorder. Br J Psychiatry 130:330–351.
Blackwelder WC, Elston RC. 1985. A comparison of sib-pair linkage tests
for disease susceptibility loci. Genet Epidemiol 2:85–97.
Blackwood DH, He L, Morris SW, McLean A, Whitten C, Thomson M,
Walker MT, Woodburn K, Sharp CM, Wright AF, Shibasaki Y, St. Clair
DM, Porteous DJ, Muir MJ. 1996. A locus for bipolar disorder affective
disorder on chromosome 4p. Nat Genet 12:427–430.
Boudikova B, Szumlanski C, Maidak B, Weinshilboum R. 1990. Human
liver catechol-O-methyltransferase pharmacogenetics. Clin Pharmacol
Ther 48:381–389.
Butkerait P, Zheng Y, Hallak H, Graham TE, Miller HA, Burris KD, Molinoff PB, Manning DR. 1995. Expression of the human 5-hydroxytryptamine 1A receptor in Sf9 cells. Reconstruction of a coupled phenotype
by co-expression of mammalian G protein subunits. J Biol Chem 270:
18691–18693.
Casey PJ, Fong HKW, Simon MI, Gilman AG. 1990. Gz, a guanine nucleotide-binding protein with unique biochemical properties. J Bio Chem
265:2383–290.
Coon H, Holik J, Hoff M, Reimherr F, Wender P, Myles-Worsley M, Waldo
M, Freeman R, Byerley W. 1994. Analysis of chromosome 22 markers
in nine schizophrenia pedigrees. Am J Med Genet 54:72–79.
Craddock N, McGuffin P. 1993. Approaches to the genetics of affective
disorders. Ann Med 25:317–322.
DeBruyn A, Souery D, Mendelbaum K, Mendelwicz J, Van Broeckhoven C.
1995. Linkage analysis of families with bipolar (BP) illness and chromosome 18 markers. Biol Psychiatr 39:679–688.
Detera-Wadleigh SD, Radner JA, Yoshikawa T, Sanders AR, Goldin LR,
Turner G, Rollins DY, Moses T, Guroff JJ, Kazuba D, Maxwell ME,
Edenberg HJ, Fouroud T, Lahiri D, Nurnberger JI, Stine OC, McMahon F, Meyers DA, MacKinnon D, Simpson S, McInnis M, DePaulo JR,
Rice J, Goate A, Reich T, Blehar MC, Gershon ES. 1997. Initial genome
screen for bipolar disorder in the NIMH Genetics Initiative pedigrees:
chromosomes 4, 7, 9, 18, 19, 20, and 21q. Am J Med Genet (Neuropsychiatr Genet) 74:254–262.
Edenberg HJ, Fouroud T, Connealy PM, Sorbel JJ, Carr K, Crose C, Willig
C, Zhao J, Miller M, Bowman E, Mayeda A, Leela Rau N, Smiley C,
Rice JP, Goate A, Reich T, Stien OC, McMahon F, DePaulo JR, Meyers
D, Detera-Wadleigh SD, Goldin LR, Gershon ES, Blehar MC, Nurnberger JI. 1997. Initial genome screen for bipolar disorder in the NIMH
Genetics Initiative pedigrees: chromosomes 3, 5, 15, 16, 17, and 22. Am
J Med Genet (Neuropsychiatr Genet) 74:238–246.
Egeland JA, Gerhard DS, Pauls DL, Sussex JN, Kidd KK, Allen CR,
Hostetter AM, Housman DE. 1987. Bipolar affective disorder linked to
DNA markers on chromosome 11. Nature 325:783–787.
Endicott J, Spitzer RL. 1978. A diagnostic interview: The Schedule for
Affective Disorders and Schizophrenia. Arch Gen Psychiatr 35:837–
844.
Fields TA, Casey PJ. 1997. Signaling functions and biochemical properties
of pertussis toxin-resistant G-proteins. Biochem J 321:561–571.
Fong HKW, Yoshimoto KK, Eversole-Cire P, Simon MI. 1988. Identification of a GTP-binding protein ␣-subunit that lacks an apparent ADPribosylation site for pertussis toxin. Proc Natl Acad Sci 85:3066–3070.
Freimer NB, Reus VI, Escamilla MA, McInnes LA, Spesny M, Leon P,
Service SK, Smith LB, Silva S, Rojas E, Gallegos A, Meza L, Fournier
E, Baharloo S, Blankenship K, Tyler DJ, Batki S, Vinogradov S, Weissenbach J, Barondes SH, Sandkuijl LA. 1996. Genetic mapping using
haplotype, association, and linkage methods suggests a locus for severe
bipolar disorder (BPI) at 18q22-23. Nat Genet 12:436–441.
328
Saito et al.
Gershon ES. 1991. Marker genotyping errors in old data on X-linkage in
bipolar illness. Bio Psychiatr 29:721–729.
Gill M, Vallada H, Collier D, Sham P, Holmans P, Murray R, McGuffin P,
Nanko S, Owen M, Antonarakis S, Housman D, Kazazian H, Nestadt
G, Pulver AE, Straub RE, MacLean CJ, Walsh D, Kendler KS, DeLisi
L, Polymeropoulos M, Coon H, Bylerley W, Lofthouse R, Gershon E,
Read CM, et al. 1996. A combined analysis of D22S278 marker alleles
in affected sib-pairs: support for a susceptibility locus for schizophrenia at chromosome 22q12. Schizophrenia collaborative linkage group.
Am J Med Genet 67:40–45.
Gutierrez B, Bertranpetit J, Guillamat R, Valles V, Arranz MJ, Kerwin R,
Fananas L. 1997. Association analysis of the catechol O-methyltransferase gene and bipolar affective disorder. Am J Psychiatr 154:
113–115.
Gurling H, Smyth C, Maloney E, Rifkin L, O’Neill J, Murphy P, Curtis D,
Petursson H, Brynjolfsson J. 1995. Linkage findings in bipolar disorder. Nat Genet 7:246–249.
Gudermann T, Schoneberg T, Schultz G. 1997. Functional and structural
complexity of signal transduction via G-protein-coupled receptors. Ann
Rev Neurosci 20:199–427.
Ho MK, Wong YH. 1997. Functional role of amino-terminal serine16 and
serine27 of G alphaz in receptor and effector coupling. J Neurochem
68:2514–2522.
Kelsoe JR, Ginns EI, Egeland JA, Gerhard DS, Goldstein AM, Bale SJ,
Pauls DL, Long RT, Kidd KK, Conte, Housman DE, Paul M. 1989.
Re-evaluation of the linkage relationship between chromosome 11p loci
and the gene for bipolar affective disorder in the old order Amish.
Nature 342:238–243.
Kirov G, Murphy KC, Arranz MJ, Jones I, McCandles F, Kunugi H, Murray RM, McGuffin P, Collier DA, Owen MJ, Craddock N. 1998. Low
activity allele of catechol-O-methyltransferase gene associated with
rapid cycling bipolar disorder. Molecular Psychiatr 3: 342–345.
Lachman HM, Papolos D. 1989. Abnormal signal transduction: A hypothetical model for bipolar affective disorder. Life Sci 45:1413–1426.
Lachman H, Papolos DF, Saito T, Yu YM, Szumlanski CL, Weinshilboum
RM. 1996a. Human catechol-O-methyltransferase pharmacogenetics:
Description of a functional polymorphism and its potential application
to neuropsychiatric disorders. Pharmacogenetics 6:243–250.
Lachman HM, Morrow B, Shprintzen R, Veit S, Parsia SS, Faedda G,
Goldberg R, Kucherlapati R, Papolos DF. 1996b. Association of codon
108/158 catechol O-methyltransferase gene polymorphism with the
psychiatric manifestations of velo-cardio-facial syndrome. Am J Med
Genet (Neuropsychiatr Genet) 67:468–472.
Lachman HM, Kelsoe JR, Remick JA, Sadovnick D, Rapaport MH, Lin M,
Pazur BA, Roe AA, Saito T, Papolos DF. 1997a. Linkage studies support a possible locus for bipolar disorder near the velo-cardio-facial
syndrome region on chromosome 22. Am J Med Genet (Neuropsychiatr
Genet) 74:121–128.
Lachman HM, Kelsoe J, Moreno L, Katz S, Papolos DF. 1997b. No evidence
for linkage of COMT polymorphism in bipolar disorder. Psychiatr
Genet 7:13–17.
Lai HW, Minami M, Satoh M, Wong YH. 1995. Gz coupling to the rat
kappa-opioid receptor. FEBS Lett 360:97–99.
Lotta T, Vidgren J, Tilgmann C, Ulmanen I, Melen K, Julkunen I, Taskinen J. 1995. Kinetics of human soluble and membrane-bound catechol
O-methyltransferase: a revised mechanism and description of the thermolabile variant of the enzyme. Biochemistry 34:4202–210.
Manji HK, Lenox RH. 1994. Long-term action of lithium: a role for transcriptional and postranscriptional factors regulated by protein kinase
C. Synapse 16:11–28.
Matsuoka M, Itoh H, Kozasa T, Kaziro Y. 1988. Sequence analysis of cDNA
and genomic DNA for a putative pertussis toxin-insensitive guanine
nucleotide-binding regulatory protein ␣ subunit. Proc Natl Acad Sci
85:5384–5388.
Matsuoka M, Itoh H, Kaziro Y. 1990. Characterization of the human gene
for Gx␣, a pertussis toxin-insensitive regulatory GTP-binding protein.
J Bio Chem 265:13215–13220.
Mendlewicz J, Rainer JD. 1977. Adoption study supporting genetic transmission in manic-depressive illness. Nature 368:327–329.
Mendlewicz J, Simon P, Sevy S, Charon F, Brocas H, Legros S, Vassart G.
1987. Polymorphic DNA marker and X chromosome and manic depression. Lancet 1:1230–1232.
Mork A, Geisler A. 1995. Effects of chronic lithium treatment on agonistenhanced extracellular concentrations of cyclic AMP in the dorsal hippocampus of freely moving rats. J Neurochem 65:134–139.
Mork A, Geisler A. 1987. Effects of lithium on calmodulin-stimulated adenylate cyclase activity in cortical membranes from rat brain. Pharmacol Toxicol 60:17–23.
Morrow B, Goldberg R, Carlson C, Gupta RD, Sirotkin H, Collins J, Dunham I, O’Donnell H, Scrambler P, Shprintzen RJ, Kucherlapati R.
1995. Molecular definition of the 22q11 deletions in velo-cardio facial
syndrome. Am J Hum Genet 56:1391–1403.
Nurnberger JI, Goldin LR, Gershon ES. 1994. Genetics of affective disorders. In Post RM, Ballanger JC, editors. Neurobiology of mood disorders. Baltimore: Williams and Wilkins. p 76–101.
Papolos DF, Faedda GL, Veit S, Goldberg R, Morrow B, Kucherlapati R,
Shprintzen RJ. 1996. Bipolar spectrum disorders in patients diagnosed
with velo-cardio-facial syndrome: does a hemizygous deletion of chromosome 22q11 result in bipolar affective disorder? Am J Psychiatr
153:1541–1544.
Papolos DF, Veit S, Faedda G, Saito T, Lachman HM. 1998. Association of
codon 108/158 catechol-o-methyltransferase gene polymorphism with
ultra ultra rapid cycling bipolar disorder. Molecular Psychiatr 3:346–
349.
Risch N. 1990. Linkage strategies for genetically complex traits. The power
affected relative pairs. Am J Hum Genet 46:229–241.
Scambler P, Kelly D, Lindsay E, Williamson R, Goldberg R, Shprintzen R,
Wilson DI. 1992. Velo cardio facial syndrome associated with chromosome 22q11 deletions encompassing the DiGeorge Locus. Lancet 339:
1138–1139.
Shprintzen RJ, Goldberg R, Golding-Kushner KJ, Marion RW. 1992. Lateonset psychosis in the velo-cardio-facial syndrome. Am J Med Genet
42:141–142.
Shprintzen RJ, Goldberg RB, Lewin ML, Sidoti EJ, Berkman MD, Argamaso RV, Young D. 1978. A new syndrome involving cleft palate, cardiac anomalies, typical facies, and learning disabilities: velo-cardiofacial syndrome. Cleft Palate J 15:56–62.
Simon MI, Strathmann MP, Gautam N. 1991. Diversity of G-proteins in
signal transduction different. Science 252:802–808.
Spitzer RL, Endicott J, Robins E. 1978. Research Diagnostic Criteria: Rationale and reliability. Arch Gen Psychiatr 35:773–782.
Stine OC, McMahon FJ, Chen L-S, Xu J, Meyers DA, MacKinnon DF,
Simpson S, McInnis MG, Rice JP, Goate A, Reich T, Edenberg HJ,
Foround T, Nurnberger JI, Detera-Wadleigh SD, Goldin LR, Guroff J,
Gershon ES, Blehar MC, DePaulo JR. 1997. Initial genome screen for
bipolar disorder in the NIMH Genetics Initiative pedigrees: chromosomes 2, 11, 13, 14 and X. Am J Med Genet (Neuropsychiatr Genet)
74:263–269.
Stine OC, Xu J, Koskela R, McMahon FJ, Gschwend M, Friddle C, Clark
CD, McInnis MG, Simpson SG, Breschel TS, Vishio E, Riskin K, Feilotter H, Chen E, Shen S, Folstein S, Meyers D, Botstein D, Marr T,
DePaulo R. 1995. Evidence for linkage of bipolar disorder to chromosome 18 with a parent of origin effect. Am J Hum Genet 57:1384–1394.
Straub RE, Lehner T, Luo Y, Loth JE, Shao W, Sharpe L, Alexander JR,
Das K, Simon R, Fieve RR, Lerer B, Endicott J, Ott J, Gilliam TC,
Baron M. 1994. A possible vulnerability locus for BP affective disorder
on chromosome 21. Nat Genet 8:291–296.
Suarez B, Rice J, Reich T. 1978. The generalized sib pair IBD distribution:
Its use in the detection of linkage. Ann Hum Genet 42:87–94.
Terwilliger JD, Shannon WD, Lathrop GM, Nolan JP, Goldin LR, Chase
GA, Weeks DE. 1997. True and false positive peaks in genomewide
scans: Applications of length-biased sampling to linkage mapping. Am
J Hum Genet 61:430–438.
Vallada H, Curtis D, Sham PC, Murry RM, McGuffin P, Nanko S, Gill M,
Owen M, Collier DA. 1995. Chromosome 22 markers demonstrate
transmission disequilibrium with schizophrenia. Psychiatr Genet 5(3):
127–130.
Weeks DE, Lange K. 1988. The affected pedigree member method of linkage analysis. Am J Hum Genet 42:315–326.
Weinshilboum RM, Raymond FA. 1977. Inheritance of low erythrocyte catechol-O-methyltransferase activity in man. Am J Hum Genet 29:125–
135.
Yung LY, Tsim ST, Wong YH. 1995. Stimulation of cAMP accumulation by
the cloned Xenopus melatonin receptor through Gi and Gz proteins.
FEBS Lett 372:99–102.